Ecological Strategies for Resource Use by Three Bromoviruses in Anthropic and Wild Plant Communities
Abstract
:1. Introduction
2. Materials and Methods
2.1. Description of Study Sites and Sampling
2.2. Detection of Viral Reads and Estimation of Host Range
2.3. Virus Set Memberships and Co-Occurrence Simulations
2.4. Genetic Diversity and Population Genomic Analysis
2.5. Population Genetic Structure
3. Results
3.1. Detection of Viral Reads and Estimation of Host Range
3.2. Virus Set Memberships and Co-Occurrence Simulations
3.3. Genetic Diversity Analysis
3.4. Population Genetic Structure
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Virus | Gene | Primer Name | Forward and Reverse Primer 5′-3′ | NCBI Accession | Position in Accession | Amplicon Size (nt) |
---|---|---|---|---|---|---|
CMV | CP | Fny-CMV_F | CGTTGCCGCTATCTCTGCTAT | NC_001440.1 | 1661–1681 | 70 |
Fny-CMV_R | GGATGCTGCATACTGACAAACC | NC_001440.1 | 1709–1730 | 70 | ||
TAV | CP | TAV_83_F | GCCATCCCTTCAACATCCGA | NC_003836.1 | 1377–1396 | 83 |
TAV_83_R | TCGGTCGAACATCCAACGAA | NC_003836.1 | 1440–1459 | 83 | ||
PZSV | CP | PZSV_70_F | GGGCTCTCTATGTCTGTTGA | NC_003651.1 | 1721–1740 | 70 |
PZSV_70_R | GCCTACTTTCAGATTCCGTG | NC_003651.1 | 1771–1790 | 70 |
CMV Crop | CMV Edge | CMV Oak | CMV W.Land | TAV Crop | TAV Edge | TAV Oak | TAV W.Land | PZSV Crop | PZSV Edge | PZSV Oak | PZSV W.Land | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
RT-PCR | 10 | 28 | 22 | 13 | 5 | 40 | 7 | 1 | 2 | 46 | 2 | 8 |
HTS (2C) | 10 | 30 | 23 | 13 | 6 | 45 | 8 | 1 | 2 | 54 | 6 | 8 |
CMV Coverage Depth | ||||
---|---|---|---|---|
HTS Library | Query Matches | RNA1 (3345 nt) | RNA2 (3050 nt) | RNA3 (2216 nt) |
PV061 | 2,416,188 | 179,936.55 | 198,048.20 | 20,299.70 |
PV132 | 593,212 | 44,177.24 | 48,623.93 | 4983.89 |
PV002 | 391,348 | 29,144.18 | 32,077.70 | 3287.93 |
PV011 | 288,047 | 21,451.22 | 23,610.41 | 2420.04 |
PV003 | 187,496 | 13,963.06 | 15,368.52 | 1575.26 |
PV120 | 3595 | 267.72 | 294.67 | 30.20 |
PV136 | 1833 | 136.51 | 150.25 | 15.40 |
PV148 | 1696 | 126.30 | 139.02 | 14.25 |
PV158 | 1465 | 109.10 | 120.08 | 12.31 |
PV014 | 1388 | 103.37 | 113.77 | 11.66 |
PV129 | 1286 | 95.77 | 105.41 | 10.80 |
PV115 | 1135 | 84.52 | 93.03 | 9.54 |
PV144 | 1003 | 74.69 | 82.21 | 8.43 |
PV130 | 917 | 68.29 | 75.16 | 7.70 |
PV137 | 859 | 63.97 | 70.41 | 7.22 |
PV112 | 757 | 56.37 | 62.05 | 6.36 |
PV009 | 730 | 54.36 | 59.84 | 6.13 |
PV141 | 713 | 53.10 | 58.44 | 5.99 |
PV151 | 711 | 52.95 | 58.28 | 5.97 |
PV001 | 626 | 46.62 | 51.31 | 5.26 |
PV154 | 609 | 45.35 | 49.92 | 5.12 |
PV146 | 607 | 45.20 | 49.75 | 5.10 |
PV070 | 432 | 32.17 | 35.41 | 3.63 |
PV114 | 388 | 28.89 | 31.80 | 3.26 |
PV110 | 381 | 28.37 | 31.23 | 3.20 |
PV437 | 337 | 25.10 | 27.62 | 2.83 |
PV015bgi | 250 | 18.62 | 20.49 | 2.10 |
PV104 | 225 | 16.76 | 18.44 | 1.89 |
PV101 | 207 | 15.42 | 16.97 | 1.74 |
PV021bgi | 186 | 13.85 | 15.25 | 1.56 |
PV113 | 166 | 12.36 | 13.61 | 1.39 |
PV103 | 156 | 11.62 | 12.79 | 1.31 |
PV095 | 142 | 10.57 | 11.64 | 1.19 |
PV035 | 134 | 9.98 | 10.98 | 1.13 |
PV106 | 129 | 9.61 | 10.57 | 1.08 |
PV105 | 123 | 9.16 | 10.08 | 1.03 |
PZSV Coverage Depth | ||||
HTS Libraries | Query Matches | RNA1 (3383 nt) | RNA2 (2435 nt) | RNA3 (2659 nt) |
PV219 | 1,264,272 | 93,428.32 | 129,802.05 | 118,867.24 |
PV220 | 581,355 | 42,961.50 | 59,687.37 | 54,659.18 |
PV143 | 224,342 | 16,578.63 | 23,033.06 | 21,092.70 |
PV178 | 36,053 | 2664.28 | 3701.54 | 3389.71 |
PV181 | 34,975 | 2584.61 | 3590.86 | 3288.36 |
PV212 | 1214 | 89.71 | 124.64 | 114.14 |
PV224 | 924 | 68.28 | 94.87 | 86.87 |
PV217 | 878 | 64.88 | 90.14 | 82.55 |
PV213 | 841 | 62.15 | 86.34 | 79.07 |
PV215 | 799 | 59.05 | 82.03 | 75.12 |
PV223 | 503 | 37.17 | 51.64 | 47.29 |
PV216 | 351 | 25.94 | 36.04 | 33.00 |
PV214 | 183 | 13.52 | 18.79 | 17.21 |
PV211 | 155 | 11.45 | 15.91 | 14.57 |
PV199 | 154 | 11.38 | 15.81 | 14.48 |
PV208 | 135 | 9.98 | 13.86 | 12.69 |
PV209 | 129 | 9.53 | 13.24 | 12.13 |
PV233 | 128 | 9.46 | 13.14 | 12.03 |
PV237 | 124 | 9.16 | 12.73 | 11.66 |
PV206 | 116 | 8.57 | 11.91 | 10.91 |
PV231 | 116 | 8.57 | 11.91 | 10.91 |
PV234 | 114 | 8.42 | 11.70 | 10.72 |
PV207 | 113 | 8.35 | 11.60 | 10.62 |
PV197 | 109 | 8.05 | 11.19 | 10.25 |
PV218 | 109 | 8.05 | 11.19 | 10.25 |
PV225 | 109 | 8.05 | 11.19 | 10.25 |
PV230 | 109 | 8.05 | 11.19 | 10.25 |
PV202 | 108 | 7.98 | 11.09 | 10.15 |
PV205 | 107 | 7.91 | 10.99 | 10.06 |
PV210 | 106 | 7.83 | 10.88 | 9.97 |
PV227 | 104 | 7.69 | 10.68 | 9.78 |
PV235 | 102 | 7.54 | 10.47 | 9.59 |
PV221 | 101 | 7.46 | 10.37 | 9.50 |
PV201 | 100 | 7.39 | 10.27 | 9.40 |
PV200 | 95 | 7.02 | 9.75 | 8.93 |
PV229 | 94 | 6.95 | 9.65 | 8.84 |
PV226 | 87 | 6.43 | 8.93 | 8.18 |
PV198 | 86 | 6.36 | 8.83 | 8.09 |
PV204 | 84 | 6.21 | 8.62 | 7.90 |
TAV Coverage Depth | ||||
HTS Library | Query Matches | RNA1 (3410 nt) | RNA2 (3074 nt) | RNA3 (2386 nt) |
PV120 | 844 | 61.88 | 68.64 | 88.43 |
PV232 | 816 | 59.82 | 66.36 | 85.50 |
PV155 | 648 | 47.51 | 52.70 | 67.90 |
PV151 | 539 | 39.52 | 43.84 | 56.48 |
PV158 | 396 | 29.03 | 32.21 | 41.49 |
PV136 | 335 | 24.56 | 27.24 | 35.10 |
PV148 | 326 | 23.90 | 26.51 | 34.16 |
PV129 | 314 | 23.02 | 25.54 | 32.90 |
PV115 | 294 | 21.55 | 23.91 | 30.80 |
PV144 | 263 | 19.28 | 21.39 | 27.56 |
PV132 | 174 | 12.76 | 14.15 | 18.23 |
PV137 | 169 | 12.39 | 13.74 | 17.71 |
PV156 | 159 | 11.66 | 12.93 | 16.66 |
PV145 | 148 | 10.85 | 12.04 | 15.51 |
PV141 | 142 | 10.41 | 11.55 | 14.88 |
PV131 | 119 | 8.72 | 9.68 | 12.47 |
PV119 | 116 | 8.50 | 9.43 | 12.15 |
PV154 | 106 | 7.77 | 8.62 | 11.11 |
PV146 | 106 | 7.77 | 8.62 | 11.11 |
PV152 | 101 | 7.40 | 8.21 | 10.58 |
Genus | Family | OTU Abbreviation | NCBI Title | Mean %ID | Min. %ID | Max. %ID |
---|---|---|---|---|---|---|
2C criteria | ||||||
Cucumovirus | Bromoviridae | CMV1 | Cucumber mosaic virus RNA 1 | 98.89 | 78.00 | 100.00 |
Cucumovirus | Bromoviridae | CMV2 | Cucumber mosaic virus RNA 2 | 98.03 | 78.67 | 100.00 |
Cucumovirus | Bromoviridae | CMV3 | Cucumber mosaic virus RNA 3 | 98.92 | 76.32 | 100.00 |
Anulavirus | Bromoviridae | PZSV1 | Pelargonium zonate spot virus RNA 1 | 92.69 | 77.33 | 98.40 |
Anulavirus | Bromoviridae | PZSV2 | Pelargonium zonate spot virus RNA 2 | 96.03 | 78.57 | 99.33 |
Anulavirus | Bromoviridae | PZSV3 | Pelargonium zonate spot virus RNA 3 | 97.46 | 76.55 | 100.00 |
Cucumovirus | Bromoviridae | TAV1 | Tomato aspermy virus RNA 1 | 94.03 | 80.92 | 100.00 |
Cucumovirus | Bromoviridae | TAV2 | Tomato aspermy virus RNA 2 | 98.88 | 88.08 | 100.00 |
Cucumovirus | Bromoviridae | TAV3 | Tomato aspermy virus RNA 3 | 98.19 | 89.33 | 100.00 |
6C criteria | ||||||
Cucumovirus | Bromoviridae | CMV1 | Cucumber mosaic virus RNA 1 | 99.03 | 85.33 | 100.00 |
Cucumovirus | Bromoviridae | CMV2 | Cucumber mosaic virus RNA 2 | 98.51 | 78.67 | 100.00 |
Cucumovirus | Bromoviridae | CMV3 | Cucumber mosaic virus RNA 3 | 99.02 | 76.32 | 100.00 |
Anulavirus | Bromoviridae | PZSV1 | Pelargonium zonate spot virus RNA 1 | 93.35 | 78.62 | 98.40 |
Anulavirus | Bromoviridae | PZSV2 | Pelargonium zonate spot virus RNA 2 | 96.19 | 79.33 | 99.33 |
Anulavirus | Bromoviridae | PZSV3 | Pelargonium zonate spot virus RNA 3 | 97.64 | 76.55 | 100.00 |
Cucumovirus | Bromoviridae | TAV1 | Tomato aspermy virus RNA 1 | 98.09 | 86.52 | 100.00 |
Cucumovirus | Bromoviridae | TAV2 | Tomato aspermy virus RNA 2 | 99.03 | 88.67 | 100.00 |
Cucumovirus | Bromoviridae | TAV3 | Tomato aspermy virus RNA 3 | 98.78 | 89.33 | 100.00 |
L1 spring | L2 spring | L3 spring | L4 spring | Mean ± SE π | |
---|---|---|---|---|---|
CMV | |||||
RNA1 | 0.000 | 0.003 | 0.003 | 0.001 | 0.002 ± 0.001 |
RNA2 | 0.001 | 0.004 | 0.002 | 0.001 | 0.002 ± 0.001 |
RNA3 | 0.000 | 0.010 | 0.004 | 0.001 | 0.004 ± 0.003 |
Mean ± SE π | 0.001 ± 0.000 | 0.006 ± 0.004 | 0.003 ± 0.001 | 0.001 ± 0.000 | |
TAV | |||||
RNA1 | 0.001 | 0.002 | 0.004 | 0.002 | 0.002 ± 0.001 |
RNA2 | 0.002 | 0.004 | 0.003 | 0.003 | 0.003 ± 0.001 |
RNA3 | 0.004 | 0.002 | 0.009 | 0.007 | 0.006 ± 0.003 |
Mean ± SE π | 0.002 ± 0.002 | 0.003 ± 0.001 | 0.005 ± 0.003 | 0.004 ± 0.003 | |
L1 autumn | L2 autumn | L3 autumn | L4 autumn | ||
PZSV | |||||
RNA1 | n.a | n.a | 0.003 | n.a | 0.003 ± 0.000 |
RNA2 | 0.006 | 0.010 | 0.006 | 0.004 | 0.007 ± 0.003 |
RNA3 | 0.005 | 0.005 | 0.003 | 0.005 | 0.005 ± 0001 |
Mean ± SE π | 0.006 ± 0.001 | 0.008 ± 0.004 | 0.004 ± 0.002 | 0.005 ± 0.001 |
References
- Aranda, M.A.; Freitas-Astúa, J. Ecology and Diversity of Plant Viruses, and Epidemiology of Plant Virus-Induced Diseases. Ann. Appl. Biol. 2017, 171, 1–4. [Google Scholar] [CrossRef]
- Elena, S.F.; Fraile, A.; García-Arenal, F. Evolution and Emergence of Plant Viruses. In Advances in Virus Research; Elsevier: Amsterdam, The Netherlands, 2014; Volume 88. [Google Scholar] [CrossRef]
- McLeish, M.J.; Fraile, A.; García-Arenal, F. Evolution of Plant–Virus Interactions: Host Range and Virus Emergence. Curr. Opin. Virol. 2019, 34, 50–55. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M.E.J.; Gowtage-Sequeria, S. Host Range and Emerging and Reemerging Pathogens. Emerg. Infect. Dis. 2005, 11, 1842–1847. [Google Scholar] [CrossRef] [PubMed]
- McLeish, M.J.; Fraile, A.; García-Arenal, F. Ecological Complexity in Plant Virus Host Range Evolution. Adv. Virus Res. 2018, 101, 293–339. [Google Scholar] [CrossRef] [PubMed]
- Lefeuvre, P.; Martin, D.P.; Elena, S.F.; Shepherd, D.N.; Roumagnac, P.; Varsani, A. Evolution and Ecology of Plant Viruses. Nat. Rev. Microbiol. 2019, 17, 632–644. [Google Scholar] [CrossRef] [PubMed]
- McLeish, M.; Sacristán, S.; Fraile, A.; García-Arenal, F. Coinfection Organizes Epidemiological Networks of Viruses and Hosts and Reveals Hubs of Transmission. Phytopathology 2019, 109, 1003–1010. [Google Scholar] [CrossRef]
- Hurlbert, S.H. The Measurement of Niche Overlap and Some Relatives. Ecology 1978, 59, 67–77. [Google Scholar] [CrossRef]
- Bedhomme, S.; Hillung, J.; Elena, S.F. Emerging Viruses: Why They Are Not Jacks of All Trades? Curr. Opin. Virol. 2015, 10, 1–6. [Google Scholar] [CrossRef]
- Cervera, H.; Ambros, S.; Bernet, G.P.; Rodrigo, G.; Elena, S.F. Viral Fitness Correlates with the Magnitude and Direction of the Perturbation Induced in the Host’s Transcriptome: The Tobacco Etch Potyvirus’tobacco Case Study. Mol. Biol. Evol. 2018, 35, 1599–1615. [Google Scholar] [CrossRef]
- Moreno-Pérez, M.G.; García-Luque, I.; Fraile, A.; García-Arenal, F. Mutations That Determine Resistance Breaking in a Plant RNA Virus Have Pleiotropic Effects on Its Fitness That Depend on the Host Environment and on the Type, Single or Mixed, of Infection. J. Virol. 2016, 90, 9128–9137. [Google Scholar] [CrossRef]
- González, R.; Butković, A.; Elena, S.F. Role of Host Genetic Diversity for Susceptibility-to-Infection in the Evolution of Virulence of a Plant Virus. Virus Evol. 2019, 5, vez024. [Google Scholar] [CrossRef] [PubMed]
- Alexander, H.M.; Mauck, K.E.; Whitfield, A.E.; Garrett, K.A.; Malmstrom, C.M. Plant-Virus Interactions and the Agro-Ecological Interface. Eur. J. Plant Pathol. 2014, 138, 529–547. [Google Scholar] [CrossRef]
- Gibbs, A.J.; Hajizadeh, M.; Ohshima, K.; Jones, R.A.C. The Potyviruses: An Evolutionary Synthesis Is Emerging. Viruses 2020, 12, 132. [Google Scholar] [CrossRef] [PubMed]
- Roossinck, M.J.; García-Arenal, F. Ecosystem Simplification, Biodiversity Loss and Plant Virus Emergence. Curr. Opin. Virol. 2015, 10, 56–62. [Google Scholar] [CrossRef] [PubMed]
- Jones, R.A.C. Plant and Insect Viruses in Managed and Natural Environments: Novel and Neglected Transmission Pathways. In Advances in Virus Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 101, pp. 149–187. [Google Scholar] [CrossRef]
- Johnson, E.E.; Escobar, L.E.; Zambrana-Torrelio, C. An Ecological Framework for Modeling the Geography of Disease Transmission. Trends Ecol. Evol. 2019, 34, 655–668. [Google Scholar] [CrossRef] [PubMed]
- Halliday, F.W.; Heckman, R.W.; Wilfahrt, P.A.; Mitchell, C.E. Past Is Prologue: Host Community Assembly and the Risk of Infectious Disease over Time. Ecol. Lett. 2019, 22, 138–148. [Google Scholar] [CrossRef]
- Hassell, J.M.; Newbold, T.; Dobson, A.P.; Linton, Y.M.; Franklinos, L.H.V.; Zimmerman, D.; Pagenkopp Lohan, K.M. Towards an Ecosystem Model of Infectious Disease. Nat. Ecol. Evol. 2021, 5, 907–918. [Google Scholar] [CrossRef]
- Muthukumar, V.; Melcher, U.; Pierce, M.; Wiley, G.B.; Roe, B.A.; Palmer, M.W.; Thapa, V.; Ali, A.; Ding, T. Non-Cultivated Plants of the Tallgrass Prairie Preserve of Northeastern Oklahoma Frequently Contain Virus-like Sequences in Particulate Fractions. Virus Res. 2009, 141, 169–173. [Google Scholar] [CrossRef]
- Roossinck, M.J.; Saha, P.; Wiley, G.B.; Quan, J.; White, J.D.; Lai, H.; Chavarría, F.; Shen, G.; Roe, B.A. Ecogenomics: Using Massively Parallel Pyrosequencing to Understand Virus Ecology. Mol. Ecol. 2010, 19 (Suppl. S1), 81–88. [Google Scholar] [CrossRef]
- Melcher, U.; Grover, V. Genomic Approaches to Discovery of Viral Species Diversity of Non-Cultivated Plants. In Recent Advances in Plant Virology; Elsevier: Amsterdam, The Netherlands, 2011; pp. 321–342. [Google Scholar]
- Bernardo, P.; Charles-Dominique, T.; Barakat, M.; Ortet, P.; Fernandez, E.; Filloux, D.; Hartnady, P.; Rebelo, T.A.; Cousins, S.R.; Mesleard, F.; et al. Geometagenomics Illuminates the Impact of Agriculture on the Distribution and Prevalence of Plant Viruses at the Ecosystem Scale. ISME J. 2018, 12, 173–184. [Google Scholar] [CrossRef]
- Kamitani, M.; Nagano, A.J.; Honjo, M.N.; Kudoh, H. A Survey on Plant Viruses in Natural Brassicaceae Communities Using RNA-Seq. Microb. Ecol. 2019, 78, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Susi, H.; Filloux, D.; Frilander, M.J.; Roumagnac, P.; Laine, A.L. Diverse and Variable Virus Communities in Wild Plant Populations Revealed by Metagenomic Tools. PeerJ 2019, 2019, e6140. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Fort, T.; Marais, A.; Lefebvre, M.; Theil, S.; Vacher, C.; Candresse, T. Leaf-Associated Fungal and Viral Communities of Wild Plant Populations Differ between Cultivated and Natural Ecosystems. Plant-Environ. Interact. 2021, 2, 87–99. [Google Scholar] [CrossRef] [PubMed]
- Maclot, F.; Debue, V.; Malmstrom, C.M.; Filloux, D.; Roumagnac, P.; Eck, M.; Tamisier, L.; Blouin, A.G.; Candresse, T.; Massart, S. Long-Term Anthropogenic Management and Associated Loss of Plant Diversity Deeply Impact Virome Richness and Composition of Poaceae Communities. Microbiol. Spectr. 2023, 11, e04850-22. [Google Scholar] [CrossRef] [PubMed]
- McLeish, M.J.; Zamfir, A.D.; Babalola, B.M.; Peláez, A.; Fraile, A.; García-Arenal, F. Metagenomics Show High Spatiotemporal Virus Diversity and Ecological Compartmentalisation: Virus Infections of Melon, Cucumis Melo, Crops and Adjacent Wild Communities. Virus Evol. 2022, 8, veac095. [Google Scholar] [CrossRef] [PubMed]
- Bujarski, J.; Gallitelli, D.; García-Arenal, F.; Pallás, V.; Palukaitis, P.; Krishna Reddy, M.; Wang, A. ICTV Virus Taxonomy Profile: Bromoviridae. J. Gen. Virol. 2019, 100, 1206–1207. [Google Scholar] [CrossRef] [PubMed]
- Palukaitis, P.; García-Arenal, F. Cucumoviruses. Adv. Virus Res. 2003, 62, 241–323. [Google Scholar] [CrossRef]
- Palukaitis, P.; García-Arenal, F. (Eds.) Cucumber Mosaic Virus; The American Phytopathological Society: St. Paul, MN, USA, 2019; pp. 369–380. [Google Scholar] [CrossRef]
- Rhee, Y.; Tzfira, T.; Chen, M.H.; Waigmann, E.; Citovsky, V. Cell-to-Cell Movement of Tobacco Mosaic Virus: Enigmas and Explanations. Mol. Plant Pathol. 2000, 1, 33–39. [Google Scholar] [CrossRef]
- García-Arenal, F.; Escriu, F.; Aranda, M.A.; Alonso-Prados, J.L.; Malpica, J.M.; Fraile, A. Molecular Epidemiology of Cucumber Mosaic Virus and Its Satellite RNA. Virus Res. 2000, 71, 1–8. [Google Scholar] [CrossRef]
- Fereres, A.; Perry, K.L. Movement Between Plants: Horizontal Transmission. In Cucumber Mosaic Virus; The American Phytopathological Society: St. Paul, MN, USA, 2019; pp. 173–184. [Google Scholar] [CrossRef]
- Pagán, I. Movement Between Plants: Vertical Transmission. In Cucumber Mosaic Virus; The American Phytopathological Society: St. Paul, MN, USA, 2019; pp. 185–198. [Google Scholar] [CrossRef]
- Hollings, M.; Stone, O.M. Tomato Aspermy Virus 1971, CMI/AAB Descriptions of Plant Viruses No. 79; Association of Applied Biologists: Warwick, UK.
- Gallitelli, D. Properties of a Tomato Isolate of Pelargonium Zonate Spot Virus. Ann. Appl. Biol. 1982, 100, 457–466. [Google Scholar] [CrossRef]
- Lapidot, M.; Guenoune-Gelbart, D.; Leibman, D.; Holdengreber, V.; Davidovitz, M.; MacHbash, Z.; Klieman-Shoval, S.; Cohen, S.; Gal-On, A. Pelargonium Zonate Spot Virus Is Transmitted Vertically via Seed and Pollen in Tomato. Phytopathology 2010, 100, 798–804. [Google Scholar] [CrossRef] [PubMed]
- Gallitelli, D.; Rana, G.L.; Vovlas, C.; Martelli, G.P. Viruses of Globe Artichoke: An Overview. J. Plant Pathol. 2004, 86, 267–281. [Google Scholar]
- Escriu, F.; Cambra, M.A.; Luis-Arteaga, M. First Report of Pepper as a Natural Host for Pelargonium Zonate Spot Virus in Spain. Plant Dis. 2009, 93, 1346. [Google Scholar] [CrossRef] [PubMed]
- Giolitti, F.; Bejerman, N.; Nome, C.; Visintin, G.; de Breuil, S.; Lenardon, S. Biological and Molecular Characterization of an Isolate of Pelargonium Zonate Spot Virus Infecting Sunflower in Argentina. J. Plant Pathol. 2014, 96, 189–194. [Google Scholar] [CrossRef]
- Luo, H.; Wylie, S.J.; Jones, M.G.K. Identification of Plant Viruses Using One-Dimensional Gel Electrophoresis and Peptide Mass Fingerprints. J. Virol. Methods 2010, 165, 297–301. [Google Scholar] [CrossRef]
- Li, H.; Zhang, C.; Luo, H.; Jones, M.G.K.; Sivasithamparam, K.; Koh, S.H.; Ong, J.W.L.; Wylie, S.J. Yellow Tailflower Mild Mottle Virus and Pelargonium Zonate Spot Virus Co-Infect a Wild Plant of Red-Striped Tailflower in Australia. Plant Pathol. 2016, 65, 503–509. [Google Scholar] [CrossRef]
- Vovlas, C.; Gallitelli, D.; Conti, M. Preliminary Evidence for an Unusual Mode of Transmission in the Ecology of Pelargonium Zonate Spot Virus (PZSV). In Proceedings of the 4th International Plant Virus Epidemiology Workshop, Montpellier, France, 3–8 September 1989; pp. 302–305. [Google Scholar]
- Finetti-Sialer, M.; Gallitelli, D. Complete Nucleotide Sequence of Pelargonium Zonate Spot Virus and Its Relationship with the Family Bromoviridae. J. Gen. Virol. 2003, 84, 3143–3151. [Google Scholar] [CrossRef] [PubMed]
- McLeish, M.; Peláez, A.; Pagán, I.; Gavilán, R.; Fraile, A.; García-Arenal, F. Structuring of Plant Communities across Agricultural Landscape Mosaics: The Importance of Connectivity and the Scale of Effect. BMC Ecol. Evol. 2021, 21, 173. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads. EMBnet J. 2011, 17, 10. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
- Larsson, J. Eulerr: Area-Proportional Euler Diagrams with Ellipses Supervised By. 2020. Available online: https://cran.r-project.org/package=eulerr (accessed on 2 May 2021).
- Gotelli, N.J. Null Model Analysis of Species Co-Occurrence Patterns. Ecology 2000, 81, 2606–2621. [Google Scholar] [CrossRef]
- Gotelli, N.J.; Hart, E.M.; Ellison, A.M. EcoSimR: Null Model Analysis for Ecological Data. 2015. Available online: https://doi.org/10.5281/zenodo.16522 (accessed on 2 May 2021).
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Pfeifer, B.; Wittelsbu, U.; Ramos-onsins, S.E.; Lercher, M.J. PopGenome: An Efficient Swiss Army Knife for Population Genomic Analyses in R. Mol. Biol. Evol. 2014, 31, 1929–1936. [Google Scholar] [CrossRef] [PubMed]
- Gaafar, Y.Z.A.; Ziebell, H. Comparative Study on Three Viral Enrichment Approaches Based on RNA Extraction for Plant Virus/Viroid Detection Using High-Throughput Sequencing. PLoS ONE 2020, 15, e0237951. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K. Estimation of the Number of Nucleotide Substitutions When There Are Strong Transition-Transversion and G+C-Content Biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Jombart, T. Adegenet: A R Package for the Multivariate Analysis of Genetic Markers. Bioinformatics 2008, 24, 1403–1405. [Google Scholar] [CrossRef]
- Parker, J.; Rambaut, A.; Pybus, O.G. Correlating Viral Phenotypes with Phylogeny: Accounting for Phylogenetic Uncertainty. Infect. Genet. Evol. 2008, 8, 239–246. [Google Scholar] [CrossRef]
- Wang, T.H.; Donaldson, Y.K.; Brettle, R.P.; Bell, J.E.; Simmonds, P. Identification of Shared Populations of Human Immunodeficiency Virus Type 1 Infecting Microglia and Tissue Macrophages Outside the Central Nervous System. J. Virol. 2001, 75, 11686–11699. [Google Scholar] [CrossRef]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
- Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
- Johnson, P.T.J.; Preston, D.L.; Hoverman, J.T.; Richgels, K.L.D. Biodiversity Decreases Disease through Predictable Changes in Host Community Competence. Nature 2013, 494, 230–233. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.-K.; Kwon, S.-J.; Kim, K.-H. Replication and the Replicase. In Cucumber Mosaic Virus; The American Phytopathological Society (APS): St. Paul, MN, USA, 2019; pp. 123–131. [Google Scholar] [CrossRef]
- Palukaitis, P. Movement in the Plant. In Cucumber Mosaic Virus; The American Phytopathological Society (APS): St. Paul, MN, USA, 2019; pp. 155–171. [Google Scholar] [CrossRef]
- Zamfir, A.D.; Babalola, B.M.; Fraile, A.; McLeish, M.; Garcia-Arenal, F. Tobamoviruses Show Broad Host Ranges and Little Genetic Diversity among Four Habitat Types of a Heterogeneous Ecosystem. Phytopathology 2023. [Google Scholar] [CrossRef] [PubMed]
- Sacristán, S.; Fraile, A.; García-Arenal, F. Population Dynamics of Cucumber Mosaic Virus in Melon Crops and in Weeds in Central Spain. Phytopathology 2004, 94, 992–998. [Google Scholar] [CrossRef] [PubMed]
- Landis, D.A.; Wratten, S.D.; Gurr, G.M. Habitat Management to Conserve Natural Enemies of Arthropod Pests in Agriculture. Annu. Rev. Entomol. 2000, 45, 175–201. [Google Scholar] [CrossRef] [PubMed]
- Marshall, E.J.P.; Moonen, A.C. Field Margins in Northern Europe: Their Functions and Interactions with Agriculture. Agric. Ecosyst. Environ. 2002, 89, 5–21. [Google Scholar] [CrossRef]
- Clemente-Orta, G.; Albajes, R.; Achon, M.A. Early Planting, Management of Edges and Non-Crop Habitats Reduce Potyvirus Infection in Maize. Agron. Sustain. Dev. 2020, 40, 21. [Google Scholar] [CrossRef]
- A’Brook, J. The Effect of Plant Spacing on the Numbers of Aphids Trapped over the Groundnut Crop. Ann. Appl. Biol. 1968, 61, 289–294. [Google Scholar] [CrossRef]
- Fereres, A.; Irwin, M.E.; Kampmeier, G.E.; Weisser, W.W. Aphid movement: Process and consequences. In Aphids as Crop Pests; van Emden, H.F., Harrington, R., Eds.; CABI: Wallingford, UK, 2017; pp. 196–224. [Google Scholar] [CrossRef]
- Groen, S.C.; Jiang, S.; Murphy, A.M.; Cunniffe, N.J.; Westwood, J.H.; Davey, M.P.; Bruce, T.J.A.; Caulfield, J.C.; Furzer, O.J.; Reed, A.; et al. Virus Infection of Plants Alters Pollinator Preference: A Payback for Susceptible Hosts? PLoS Pathog. 2016, 12, 1005906. [Google Scholar] [CrossRef]
- Mauck, K.E.; De Moraes, C.M.; Mescher, M.C. Deceptive Chemical Signals Induced by a Plant Virus Attract Insect Vectors to Inferior Hosts. Proc. Natl. Acad. Sci. USA 2010, 107, 3600–3605. [Google Scholar] [CrossRef] [PubMed]
- Mauck, K.E.; De Moraes, C.M.; Mescher, M.C. Biochemical and Physiological Mechanisms Underlying Effects of Cucumber Mosaic Virus on Host-Plant Traits That Mediate Transmission by Aphid Vectors. Plant Cell Environ. 2014, 37, 1427–1439. [Google Scholar] [CrossRef] [PubMed]
- Mauck, K.E.; De Moraes, C.M.; Mescher, M.C. Infection of Host Plants by Cucumber Mosaic Virus Increases the Susceptibility of Myzus Persicae Aphids to the Parasitoid Aphidius Colemani. Sci. Rep. 2015, 5, 10963. [Google Scholar] [CrossRef]
- Mauck, K.E.; Smyers, E.; De Moraes, C.M.; Mescher, M.C. Virus Infection Influences Host Plant Interactions with Non-Vector Herbivores and Predators. Funct. Ecol. 2015, 29, 662–673. [Google Scholar] [CrossRef]
- Mhlanga, N.M.; Murphy, A.M.; Wamonje, F.O.; Cunniffe, N.J.; Caulfield, J.C.; Glover, B.J.; Carr, J.P. An Innate Preference of Bumblebees for Volatile Organic Compounds Emitted by Phaseolus Vulgaris Plants Infected With Three Different Viruses. Front. Ecol. Evol. 2021, 9, 626851. [Google Scholar] [CrossRef]
- Tepfer, M.; García-Arenal, F. Epidemiology and ecology. In Cucumber Mosaic Virus; The American Phytopathological Society (APS): St. Paul, MN, USA, 2019; pp. 37–45. [Google Scholar] [CrossRef]
- García-Arenal, F.; Fraile, A.; Malpica, J.M. Variability and genetic structure of plant virus populations. Annu. Rev. Phytopathol. 2001, 39, 157–186. [Google Scholar] [CrossRef]
- Fordyce, J.A. The Evolutionary Consequences of Ecological Interactions Mediated through Phenotypic Plasticity. J. Exp. Biol. 2006, 209, 2377–2383. [Google Scholar] [CrossRef]
- Janzen, D.H. On Ecological Fitting. Oikos 1985, 45, 308. [Google Scholar] [CrossRef]
CMV | TAV | PZSV | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Host Species | No. of Libraries (HTS2C) | CR | ED | OA | WL | CR | ED | OA | WL | CR | ED | OA | WL |
Allium sativum | 1 | + | + | ||||||||||
Amaranthus sp. | 4 | + | + | + | + | + | |||||||
Anacyclus clavatus | 3 | + | + | + | + | + | |||||||
Anchusa undulata | 3 | + | + | + | |||||||||
Anthriscus caucalis | 2 | + | + | + | |||||||||
Aristolochia pistolochia | 2 | + | + | + | + | ||||||||
Asparagus acutifolius | 3 | + | + | + | + | ||||||||
Asphodelus aestivus | 1 | + | |||||||||||
Asteriscus aquaticus | 2 | + | + | ||||||||||
Astragalus incanus | 1 | + | |||||||||||
Avenula bromoides | 1 | + | |||||||||||
Bassia scoparia | 1 | + | |||||||||||
Brachypodium phoenicoides | 2 | + | + | + | |||||||||
Brachypodium retusum | 3 | + | + | ||||||||||
Bromus sp. | 6 | + | + | + | + | + | + | + | + | ||||
Carduus bourgeanus | 8 | + | + | + | + | + | + | + | |||||
Centaurea melitensis | 1 | + | + | ||||||||||
Centranthus calcitrapae | 1 | + | + | ||||||||||
Chenopodium album | 5 | + | + | + | |||||||||
Cirsium arvense | 1 | + | + | ||||||||||
Convolvulus arvensis | 14 | + | + | + | + | + | + | + | |||||
Conyza bonariensis | 2 | + | + | + | |||||||||
Conyza canadensis | 3 | + | + | ||||||||||
Cucumis melo | 8 | + | + | + | |||||||||
Cynodon dactylon | 4 | + | + | + | |||||||||
Cyperus longus | 1 | + | |||||||||||
Dactylis glomerata | 1 | + | |||||||||||
Datura stramonium | 3 | + | + | + | + | ||||||||
Daucus sp. | 3 | + | + | ||||||||||
Unknown 4 | 3 | + | + | + | + | ||||||||
Unknown 5 | 1 | + | |||||||||||
Descurainia sophia | 2 | + | + | + | + | ||||||||
Diplotaxis erucoides | 11 | + | + | + | + | + | + | ||||||
Diplotaxis sp. | 1 | + | + | + | |||||||||
Diplotaxis virgata | 1 | + | |||||||||||
Echium vulgare | 2 | + | + | + | |||||||||
Erodium cicutarium | 3 | + | + | + | + | + | |||||||
Eruca vesicaria | 1 | + | + | ||||||||||
Eryngium campestre | 1 | + | |||||||||||
Festuca sp. | 1 | + | |||||||||||
Fumaria parviflora | 3 | + | + | + | |||||||||
Galium verum | 4 | + | + | + | + | + | + | ||||||
Geranium sp. | 4 | + | + | + | + | ||||||||
Helichrysum stoechas | 1 | + | |||||||||||
Hieracium pilosella | 1 | + | |||||||||||
Hirschfeldia incana | 1 | + | + | + | |||||||||
Hordeum matritense | 2 | + | + | + | + | ||||||||
Hordeum vulgare | 2 | + | + | + | |||||||||
Hypericum pubescens | 1 | + | |||||||||||
Jasminum fruticans | 1 | + | |||||||||||
Klasea pinnatifida | 1 | + | |||||||||||
Lactuca serriola | 6 | + | + | + | |||||||||
Leontodon sp. | 4 | + | + | + | + | + | + | ||||||
Lepidium draba | 4 | + | + | + | |||||||||
Lithospermum arvense | 1 | + | |||||||||||
Lolium perenne | 4 | + | + | + | |||||||||
Lotus corniculatus | 1 | + | |||||||||||
Malva sylvestris | 3 | + | + | + | |||||||||
Marrubium vulgare | 2 | + | |||||||||||
Medicago sp. | 1 | + | + | ||||||||||
Milium vernale | 2 | + | + | ||||||||||
Origanum vulgare | 1 | + | |||||||||||
Papaver rhoeas | 4 | + | + | + | + | + | |||||||
Phalaris minor | 2 | + | + | + | |||||||||
Phlomis lychnitis | 1 | + | |||||||||||
Picris echioides | 8 | + | + | + | + | + | + | + | |||||
Poaceae | 1 | + | + | ||||||||||
Portulaca oleraceae | 1 | + | + | ||||||||||
Potentilla sp. | 1 | + | + | + | |||||||||
Quercus coccifera | 4 | + | + | ||||||||||
Quercus ilex | 2 | + | |||||||||||
Reseda lutea | 1 | + | |||||||||||
Rubia peregrina | 7 | + | + | + | + | ||||||||
Rumex pulcher | 3 | + | + | ||||||||||
Salvia verbenaca | 1 | + | |||||||||||
Scandix pecten-veneris | 1 | + | + | + | |||||||||
Senecio jacobaea | 1 | + | ++ | ||||||||||
Silybum marianum | 7 | + | + | + | |||||||||
Sisymbrium runcinatum | 1 | + | |||||||||||
Solanum nigrum | 2 | + | + | ||||||||||
Sonchus oleraceus | 2 | + | + | ||||||||||
Staehelina dubia | 1 | + | |||||||||||
Stipa parviflora | 2 | + | + | + | |||||||||
Taraxacum officinale | 3 | + | |||||||||||
Teucrium botrys | 1 | + | |||||||||||
Teucrium capitatum | 2 | + | + | ||||||||||
Teucrium chamaedrys | 1 | + | + | ||||||||||
Teucrium pseudochamaepitys | 3 | + | + | ||||||||||
Thapsia villosa | 2 | + | + | + | |||||||||
Thymus vulgaris | 1 | + | |||||||||||
Torilis nodosa | 1 | + | + | ||||||||||
Trifolium campestre | 1 | + | |||||||||||
Verbascum sinuatum | 3 | + | |||||||||||
Vicia sp. | 2 | + | + | + | |||||||||
Xanthium strumarium | 1 | + | |||||||||||
Zea mays | 2 | + | |||||||||||
Host range by habitat (HTS2C) | 17 | 47 | 32 | 20 | 7 | 28 | 6 | 3 | 9 | 52 | 12 | 12 | |
Host range by ecosystem (HTS2C) | 88 | 38 | 67 |
Population | Observed C-Score | Simulated Mean C-Score | Cohens d | Lower CI d | Upper CI d | Lower p-Value | Upper p-Value | |
---|---|---|---|---|---|---|---|---|
Sim2 | Host species | |||||||
Crop | 8.00 | 9.71 | 0.43 | 0.47 | 0.47 | 0.241 | 0.574 | |
Edge | 6.67 | 19.85 | 1.51 | 1.66 | 1.66 | 0.017 | 0.869 | |
Oak | 85.00 | 40.74 | 3.31 | −3.55 | −3.30 | 0.999 | 0.001 | |
Wasteland | 50.00 | 25.17 | 2.94 | −3.20 | −2.93 | 0.999 | 0.001 | |
Sim4 | Host species | |||||||
Crop | 8.00 | 7.92 | 0.02 | −0.03 | −0.01 | 0.409 | 0.389 | |
Edge | 6.67 | 16.59 | 1.17 | 1.29 | 1.29 | 0.039 | 0.765 | |
Oak | 85.00 | 36.39 | 3.74 | −4.00 | −3.72 | 1.000 | 0.000 | |
Wasteland | 50.00 | 22.49 | 3.31 | −3.64 | −3.30 | 0.999 | 0.001 | |
Sim2 | HTS Libraries | |||||||
Crop | 49.67 | 29.48 | 2.05 | −2.20 | −2.04 | 0.973 | 0.021 | |
Edge | 111.00 | 265.00 | 2.42 | 2.66 | 2.66 | 0.004 | 0.996 | |
Oak | 101.33 | 44.30 | 3.65 | −4.01 | −3.63 | 1.000 | 0.000 | |
Wasteland | 63.33 | 28.75 | 3.42 | −3.74 | −3.40 | 1.000 | 0.000 | |
Sim4 | HTS Libraries | |||||||
Crop | 49.67 | 25.35 | 2.53 | −2.69 | −2.51 | 0.991 | 0.007 | |
Edge | 111.00 | 207.33 | 1.60 | 1.76 | 1.76 | 0.044 | 0.955 | |
Oak | 101.33 | 39.81 | 4.05 | −4.47 | −4.03 | 1.000 | 0.000 | |
Wasteland | 63.33 | 26.02 | 3.74 | −4.00 | −3.72 | 1.000 | 0.000 |
Segment | Crop | Edge | Oak | Wasteland | Mean ± SE π |
---|---|---|---|---|---|
RNA1 | 0.007 | 0.005 | 0.006 | 0.008 | 0.007 ± 0.001 |
RNA2 | 0.007 | 0.006 | 0.004 | 0.007 | 0.006 ± 0.001 |
RNA3 | 0.014 | 0.005 | 0.002 | 0.011 | 0.008 ± 0.005 |
Mean ± SE π | 0.009 ± 0.004 | 0.005 ± 0.001 | 0.004 ± 0.002 | 0.009 ± 0.002 |
Statistic | Obs. Mean | Obs. L. 95% CI | Obs. U. 95% CI | Null Mean | Null L. 95% CI | Null U. 95% CI | p-Value | |
---|---|---|---|---|---|---|---|---|
CMV RNA1 | ||||||||
Habitat effect | AI | 0.97 | 0.56 | 1.38 | 2.46 | 2.03 | 2.85 | 0.000 |
PS | 9.40 | 8.00 | 10.00 | 19.23 | 17.48 | 20.69 | 0.000 | |
Anthropic effect | AI | 0.36 | 0.26 | 0.60 | 1.09 | 0.76 | 1.45 | 0.000 |
PS | 3.00 | 3.00 | 3.00 | 7.39 | 5.91 | 8.39 | 0.000 | |
CMV RNA2 | ||||||||
Habitat effect | AI | 0.92 | 0.38 | 1.46 | 2.38 | 2.10 | 2.58 | 0.000 |
PS | 9.05 | 9.00 | 9.00 | 20.34 | 18.38 | 21.61 | 0.000 | |
Anthropic effect | AI | 0.44 | 0.06 | 0.77 | 1.18 | 0.93 | 1.38 | 0.000 |
PS | 4.01 | 4.00 | 4.00 | 8.74 | 7.40 | 9.90 | 0.000 | |
CMV RNA3 | ||||||||
Habitat effect | AI | 1.17 | 0.71 | 1.62 | 2.54 | 2.08 | 2.98 | 0.000 |
PS | 9.43 | 8.00 | 10.00 | 19.56 | 17.83 | 21.16 | 0.000 | |
Anthropic effect | AI | 0.58 | 0.22 | 0.91 | 1.21 | 0.82 | 1.54 | 0.010 |
PS | 4.36 | 4.00 | 5.00 | 8.77 | 7.08 | 10.00 | 0.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Babalola, B.; Fraile, A.; García-Arenal, F.; McLeish, M. Ecological Strategies for Resource Use by Three Bromoviruses in Anthropic and Wild Plant Communities. Viruses 2023, 15, 1779. https://doi.org/10.3390/v15081779
Babalola B, Fraile A, García-Arenal F, McLeish M. Ecological Strategies for Resource Use by Three Bromoviruses in Anthropic and Wild Plant Communities. Viruses. 2023; 15(8):1779. https://doi.org/10.3390/v15081779
Chicago/Turabian StyleBabalola, Bisola, Aurora Fraile, Fernando García-Arenal, and Michael McLeish. 2023. "Ecological Strategies for Resource Use by Three Bromoviruses in Anthropic and Wild Plant Communities" Viruses 15, no. 8: 1779. https://doi.org/10.3390/v15081779