Inflammatory Polymorphisms (IL-6 rs1800796, IL-10 rs1800896, TNF-α rs1800629, and IFITM3 rs12252) Are Not Associated with Post-COVID Symptoms in Previously Hospitalized COVID-19 Survivors
Abstract
:1. Introduction
2. Methods
2.1. Participants
2.2. DNA Collection and Genotyping
- ATGGCCAGGCAGTTCTACAACAGCC [C/G] CTCACAGGGGAGCCAGAACACAGA.
- TCCTCTTACCTATCCCTACTTCCCC [T/C] TCCCAAAGAAGCCTTAGTAGTGTTG.
- GAGGCAATAGGTTTTGAGGGGCATG [A/G] GGACGGGGTTCAGCCTCCAGGGTCC.
- GCATCTCATAGTTGGGGGGCTGGCC [A/G] CTGTTGACAGGAGAGAAGAAGGTTT.
2.3. Collection Data
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Christie, M.J.; Irving, A.T.; Forster, S.C.; Marsland, B.J.; Hansbro, P.M.; Hertzog, P.J.; Nold-Petry, C.A.; Nold, M.F. Of bats and men: Immunomodulatory treatment options for COVID-19 guided by the immunopathology of SARS-CoV-2 infection. Sci. Immunol. 2021, 6, 205. [Google Scholar] [CrossRef] [PubMed]
- Singh, H.O.; Choudhari, R.; Nema, V.; Khan, A.A. ACE2 and TMPRSS2 polymorphisms in various diseases with special reference to its impact on COVID-19 disease. Microb. Pathog. 2021, 150, 104621. [Google Scholar] [CrossRef]
- Mulchandani, R.; Lyngdoh, T.; Kakkar, A.K. Deciphering the COVID-19 cytokine storm: Systematic review and meta-analysis. Eur. J. Clin. Investig. 2021, 51, e13429. [Google Scholar] [CrossRef] [PubMed]
- Iwamura, A.P.D.; Tavares da Silva, M.R.; Hümmelgen, A.L.; Soeiro Pereira, P.V.; Falcai, A.; Grumach, A.S.; Goudouris, E.; Neto, A.C.; Prando, C. Immunity and inflammatory biomarkers in COVID-19: A systematic review. Rev. Med. Virol. 2021, 31, e2199. [Google Scholar] [CrossRef] [PubMed]
- Qudus, M.S.; Tian, M.; Sirajuddin, S.; Liu, S.; Afaq, U.; Wali, M.; Liu, J.; Pan, P.; Luo, Z.; Zhang, Q.; et al. The roles of critical pro-inflammatory cytokines in the drive of cytokine storm during SARS-CoV-2 infection. J. Med. Virol. 2023, 95, e28751. [Google Scholar] [CrossRef] [PubMed]
- Glotov, O.S.; Chernov, A.N.; Scherbak, S.G.; Baranov, V.S. Genetic risk factors for the development of COVID-19 coronavirus infection. Russ. J. Genet. 2021, 57, 878–892. [Google Scholar] [CrossRef]
- Chen, T.; Lin, Y.X.; Zha, Y.; Sun, Y.; Tian, J.; Yang, Z.; Lin, S.W.; Yu, F.; Chen, Z.S.; Kuang, B.H.; et al. A low-producing haplotype of interleukin-6 disrupting CTCF binding is protective against severe COVID-19. mBio 2021, 12, e0137221. [Google Scholar] [CrossRef]
- Abbood, S.J.A.; Anvari, E.; Fateh, A. Association between interleukin-10 gene polymorphisms (rs1800871, rs1800872, and rs1800896) and severity of infection in different SARS-CoV-2 variants. Hum. Genom. 2023, 17, 19. [Google Scholar] [CrossRef]
- Saleh, A.; Sultan, A.; Elashry, M.A.; Farag, A.; Mortada, M.I.; Ghannam, M.A.; Saed, A.M.; Ghoneem, E. Association of TNF-α G-308 a Promoter Polymorphism with the Course and Outcome of COVID-19 Patients. Immunol. Investig. 2022, 51, 546–557. [Google Scholar] [CrossRef]
- Li, Y.; Wei, L.; He, L.; Sun, J.; Liu, N. Interferon-induced transmembrane protein 3 gene polymorphisms are associated with COVID-19 susceptibility and severity: A meta-analysis. J. Infect. 2022, 84, 825–833. [Google Scholar] [CrossRef]
- Fernández-de-las-Peñas, C. Long COVID: Current definition. Infection 2022, 50, 285–286. [Google Scholar] [CrossRef] [PubMed]
- Soriano, J.B.; Murthy, S.; Marshall, J.C.; Relan, P.; Diaz, J.V.; WHO Clinical Case Definition Working Group on Post-COVID-19 Condition. A clinical case definition of post-COVID-19 condition by a Delphi consensus. Lancet Infect. Dis. 2022, 22, e102–e107. [Google Scholar] [CrossRef] [PubMed]
- Scharf, R.E.; Anaya, J.M. Post-COVID Syndrome in Adults: An Overview. Viruses 2023, 15, 675. [Google Scholar] [CrossRef] [PubMed]
- Hayes, L.D.; Ingram, J.; Sculthorpe, N.F. More Than 100 Persistent Symptoms of SARS-CoV-2 (Long COVID): A scoping review. Front. Med. 2021, 8, 750378. [Google Scholar] [CrossRef]
- Chen, C.; Haupert, S.R.; Zimmermann, L.; Shi, X.; Fritsche, L.G.; Mukherjee, B. Global prevalence of post COVID-19 condition or long COVID: A meta-analysis and systematic review. J. Infect. Dis. 2022, 226, 1593–1607. [Google Scholar] [CrossRef]
- Han, Q.; Zheng, B.; Daines, L.; Sheikh, A. Long-term sequelae of COVID-19: A systematic review and meta-analysis of one-year follow-up studies on post-COVID symptoms. Pathogens 2022, 11, 269. [Google Scholar] [CrossRef]
- Fernández-de-las-Peñas, C.; Notarte, K.I.; Macasaet, R.; Velasco, J.V.; Catahay, J.A.; Therese Ver, A.; Chung, W.; Valera-Calero, J.A.; Navarro-Santana, M. Persistence of post-COVID symptoms in the general population two years after SARS-CoV-2 infection: A systematic review and meta-analysis. J. Infect. 2023, 88, 77–88. [Google Scholar] [CrossRef] [PubMed]
- Global Burden of Disease Long COVID Collaborators; Wulf Hanson, S.; Abbafati, C.; Aerts, J.G.; Al-Aly, Z.; Ashbaugh, C.; Ballouz, T.; Blyuss, O.; Bobkova, P.; Bonsel, G.; et al. Estimated global proportions of individuals with persistent fatigue, cognitive, and respiratory symptom clusters following symptomatic COVID-19 in 2020 and 2021. JAMA 2022, 328, 1604–1615. [Google Scholar]
- Castanares-Zapatero, D.; Chalon, P.; Kohn, L.; Dauvrin, M.; Detollenaere, J.; Maertens de Noordhout, C.; Primus-de Jong, C.; Cleemput, I.; Van den Heede, K. Pathophysiology and mechanism of long COVID: A comprehensive review. Ann. Med. 2022, 54, 1473–1487. [Google Scholar] [CrossRef]
- PHOSP-COVID Collaborative Group. Clinical characteristics with inflammation profiling of Long-COVID and association with one-year recovery following hospitalisation in the UK: A prospective observational study. Lancet Respir. Med. 2022, 10, 761–775. [Google Scholar] [CrossRef]
- Lai, Y.J.; Liu, S.H.; Manachevakul, S.; Lee, T.A.; Kuo, C.T.; Bello, D. Biomarkers in long COVID-19: A systematic review. Front. Med. 2023, 10, 1085988. [Google Scholar] [CrossRef]
- Williams, E.S.; Martins, T.B.; Shah, K.S.; Hill, H.R.; Coiras, M.; Spivak, A.M.; Planelles, V. Cytokine deficiencies in patients with long-COVID. J. Clin. Cell Immunol. 2022, 13, 672. [Google Scholar]
- Silva Andrade, B.; Siqueira, S.; de Assis Soares, W.R.; de Souza Rangel, F.; Santos, N.O.; Dos Santos Freitas, A.; Ribeiro da Silveira, P.; Tiwari, S.; Alzahrani, K.J.; Góes-Neto, A.; et al. Long-COVID and Post-COVID health complications: An up-to-date review on clinical conditions and their possible molecular mechanisms. Viruses 2021, 13, 700. [Google Scholar] [CrossRef]
- Fernández-de-las-Peñas, C.; Giordano, R.; Díaz-Gil, G.; Gómez-Esquer, F.; Ambite-Quesada, S.; Palomar-Gallego, M.A.; Arendt-Nielsen, L. Post-COVID pain is not associated with inflammatory polymorphisms in people who had been hospitalized by COVID-19. J. Clin. Med. 2022, 11, 5645. [Google Scholar] [CrossRef]
- Fernández-de-las-Peñas, C.; Notarte, K.I.; Peligro, P.J.; Velasco, J.V.; Ocampo, M.J.; Henry, B.M.; Arendt-Nielsen, L.; Torres-Macho, J.; Plaza-Manzano, G. Long-COVID symptoms in individuals infected with different SARS-CoV-2 variants of concern: A systematic review of the literature. Viruses 2022, 14, 2629. [Google Scholar] [CrossRef] [PubMed]
- Du, M.; Ma, Y.; Deng, J.; Liu, M.; Liu, J. Comparison of long COVID-19 caused by different SARS-CoV-2 strains: A systematic review and meta-analysis. Int. J. Environ. Res. Public Health 2022, 19, 16010. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, A.; Iwagami, M.; Yasuhara, J.; Takagi, H.; Kuno, T. Protective effect of COVID-19 vaccination against long COVID syndrome: A systematic review and meta-analysis. Vaccine 2023, 41, 1783–1790. [Google Scholar] [CrossRef] [PubMed]
- Yuan, N.; Lv, Z.H.; Sun, C.R.; Wen, Y.Y.; Tao, T.Y.; Qian, D.; Tao, F.P.; Yu, J.H. Post-acute COVID-19 symptom risk in hospitalized and non-hospitalized COVID-19 survivors: A systematic review and meta-analysis. Front. Public Health 2023, 11, 1112383. [Google Scholar] [CrossRef] [PubMed]
- Ji, G.; Chen, C.; Zhou, M.; Wen, W.; Wang, C.; Tang, J.; Cheng, Y.; Wu, Q.; Zhang, X.; Wang, M.; et al. Post-COVID-19 fatigue among COVID-19 in patients discharged from hospital: A meta-analysis. J. Infect. 2022, 84, 722–746. [Google Scholar] [CrossRef]
- Ceban, F.; Ling, S.; Lui, L.M.W.; Lee, Y.; Gill, H.; Teopiz, K.M.; Rodrigues, N.B.; Subramaniapillai, M.; Di Vincenzo, J.D.; Cao, B.; et al. Fatigue and cognitive impairment in Post-COVID-19 Syndrome: A systematic review and meta-analysis. Brain Behav. Immun. 2022, 101, 93–135. [Google Scholar] [CrossRef] [PubMed]
- Fernández-de-las-Peñas, C.; Navarro-Santana, M.; Plaza-Manzano, G.; Palacios-Ceña, D.; Arendt-Nielsen, L. Time course prevalence of Post-COVID pain symptoms of musculoskeletal origin in patients who had survived to SARS-CoV-2 infection: A systematic review and meta-analysis. Pain 2022, 163, 1220–1231. [Google Scholar] [CrossRef] [PubMed]
- Fernández-de-las-Peñas, C.; Raveendran, A.V.; Giordano, R.; Arendt-Nielsen, L. Long COVID or Post-COVID-19 condition: Past, present and future research direction. Microorganisms 2023, 11, 2959. [Google Scholar] [CrossRef] [PubMed]
- Fernández-de-las-Peñas, C.; Arendt-Nielsen, L.; Díaz-Gil, G.; Gómez-Esquer, F.; Gil-Crujera, A.; Gómez-Sánchez, S.M.; Ambite-Quesada, S.; Palomar-Gallego, M.A.; Pellicer-Valero, O.J.; Giordano, R. Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors. Genes 2022, 13, 1935. [Google Scholar] [CrossRef] [PubMed]
- Smatti, M.K.; Al-Sarraj, Y.A.; Albagha, O.; Yassine, H.M. Host genetic variants potentially associated with SARS-CoV-2: A multi-population analysis. Front. Genet. 2020, 11, 578523. [Google Scholar] [CrossRef]
Total Sample (n = 408) | |
---|---|
Age, mean (SD), years | 58.5 (14.0) |
Sex, female n (%) | 198 (48.5%) |
Weight, mean (SD), kg. | 80.1 (17.0) |
Height, mean (SD), cm. | 166.5 (9.5) |
Number of co-morbidities, mean (SD) | 1.2 (1.0) |
Medical co-morbidities, n (%) | |
Hypertension | 143 (35.0%) |
Obesity | 98 (24.0%) |
Diabetes | 43 (10.5%) |
Asthma | 38 (9.3%) |
Cardiovascular Diseases | 38 (9.3%) |
Chronic Obstructive Pulmonary Disease | 10 (2.5%) |
Rheumatological Diseases | 3 (0.7%) |
Number of post-COVID symptoms, mean (SD) | 3.0 (1.7) |
Post-COVID symptoms, n (%) | |
Fatigue | 283 (69.3%) |
Pain Symptoms | 167 (40.9%) |
Memory Loss | 111 (27.2%) |
Hair Loss | 105 (25.7%) |
Concentration Loss | 47 (11.5%) |
Cognitive Blunting—Brain Fog | 45 (11.0%) |
Dyspnoea | 80 (19.6%) |
Ocular Disorders | 45 (11.0%) |
Skin Rashes | 56 (13.7%) |
Anosmia | 39 (9.5%) |
Gastrointestinal Disorders | 29 (7.1%) |
Ageusia | 23 (5.6%) |
Days in hospital, mean (SD) | 8.2 (7.8) |
G/G (n = 322) | C/G (n = 78) | C/C (n = 8) | p-Value | |
---|---|---|---|---|
Age, mean (SD), years | 58.7 (14.0) | 58.5 (14.5) | 57.0 (14.5) | 0.935 |
Sex, female n (%) | 158 (49.1%) | 35 (44.9%) | 5 (62.5%) | 0.757 |
Weight, mean (SD), kg. | 80.1 (16.7) | 79.7 (17.7) | 76.2 (20.4) | 0.806 |
Height, mean (SD), cm. | 166.5 (10.0) | 167 (8.8) | 163 (8.8) | 0.577 |
Number of co-morbidities, mean (SD) | 1.2 (0.95) | 1.3 (1.0) | 0.75 (0.7) | 0.310 |
Medical co-morbidities, n (%) | ||||
Hypertension | 110 (34.1%) | 31 (39.7%) | 2 (25.0%) | 0.672 |
Obesity | 78 (24.2%) | 19 (24.4%) | 1 (12.5%) | 0.798 |
Diabetes | 30 (9.3%) | 13 (16.7%) | 0 (0.0%) | 0.131 |
Asthma | 28 (8.7%) | 10 (12.8%) | 0 (0.0%) | 0.385 |
Cardiovascular Diseases | 30 (9.3%) | 8 (10.25%) | 0 (0.0%) | 0.663 |
Chronic Obstructive Pulmonary Disease | 10 (3.1%) | 0 (0.0%) | 0 (0.0%) | 0.263 |
Rheumatological Diseases | 3 (0.9%) | 0 (0.0%) | 0 (0.0%) | 0.669 |
Number of post-COVID symptoms, mean (SD) | 3.1 (1.7) | 2.7 (1.7) | 3.0 (1.8) | 0.195 |
Post-COVID symptoms, n (%) | ||||
Fatigue | 228 (70.8%) | 49 (62.8%) | 6 (75.0%) | 0.735 |
Pain Symptoms | 135 (41.9%) | 29 (37.2%) | 3 (37.5%) | 0.981 |
Memory Loss | 89 (27.6%) | 21 (26.9%) | 1 (12.5%) | 0.783 |
Hair Loss | 86 (26.7%) | 17 (21.8%) | 2 (25.0%) | 0.985 |
Concentration Loss | 37 (11.5%) | 10 (12.8%) | 0 (0.0%) | 0.595 |
Cognitive Blunting—Brain Fog | 38 (11.8%) | 7 (9.0%) | 0 (0.0%) | 0.507 |
Dyspnoea | 69 (21.4%) | 10 (12.8%) | 1 (12.5%) | 0.275 |
Ocular Disorders | 37 (11.5%) | 6 (7.7%) | 2 (25.0%) | 0.322 |
Anosmia | 30 (9.3%) | 8 (10.25%) | 1 (12.5%) | 0.936 |
Skin Rashes | 41 (12.7%) | 12 (15.4%) | 3 (37.5%) | 0.159 |
Gastrointestinal Disorders | 22 (6.8%) | 6 (7.7%) | 1 (12.5%) | 0.819 |
Ageusia | 14 (4.3%) | 8 (10.25%) | 1 (12.5%) | 0.102 |
Days in hospital, mean (SD) | 8.3 (8.2) | 7.1 (4.9) | 7.0 (6.3) | 0.422 |
T/T (n = 163) | T/C (n = 183) | C/C (n = 62) | p-Value | |
---|---|---|---|---|
Age, mean (SD), years | 58.2 (14.2) | 59.5 (13.9) | 57.5 (13.5) | 0.506 |
Sex, female n (%) | 82 (50.3%) | 93 (50.8%) | 23 (37.1%) | 0.372 |
Weight, mean (SD), kg. | 81.5 (19.5) | 78.5 (14.3) | 80.5 (16.7) | 0.225 |
Height, mean (SD), cm. | 167 (9.5) | 165.5 (9.5) | 169 (10.0) | 0.105 |
Number of co-morbidities, mean (SD) | 1.2 (1.0) | 1.3 (0.9) | 1.0 (1.0) | 0.160 |
Medical co-morbidities, n (%) | ||||
Hypertension | 60 (36.8%) | 66 (36.1%) | 17 (27.4%) | 0.541 |
Obesity | 41 (25.1%) | 45 (24.6%) | 12 (19.3%) | 0.714 |
Diabetes | 17 (10.4%) | 21 (11.5%) | 5 (8.1%) | 0.773 |
Asthma | 17 (10.4%) | 17 (9.3%) | 4 (6.4%) | 0.683 |
Cardiovascular Diseases | 13 (8.0%) | 18 (9.8%) | 7 (11.3%) | 0.730 |
Chronic Obstructive Pulmonary Disease | 7 (4.3%) | 2 (1.1%) | 1 (1.6%) | 0.149 |
Rheumatological Diseases | 0 (0.0%) | 3 (1.6%) | 0 (0.0%) | 0.158 |
Number of post-COVID symptoms, mean (SD) | 3.0 (1.6) | 2.9 (1.7) | 2.9 (1.9) | 0.481 |
Post-COVID symptoms, n (%) | ||||
Fatigue | 116 (71.2%) | 123(67.2%) | 44 (71.0%) | 0.895 |
Pain Symptoms | 70 (42.9%) | 74 (40.4%) | 24 (38.7%) | 0.895 |
Memory Loss | 42 (25.8%) | 51 (27.9%) | 19 (30.4%) | 0.814 |
Hair Loss | 39 (23.9%) | 51 (27.9%) | 15 (24.2%) | 0.742 |
Concentration Loss | 18 (11.05%) | 19 (10.4%) | 10 (16.1%) | 0.501 |
Cognitive Blunting—Brain Fog | 10 (11.7%) | 21 (11.5%) | 5 (8.05%) | 0.745 |
Dyspnoea | 39 (23.9%) | 27 (14.7%) | 14 (22.6%) | 0.134 |
Ocular Disorders | 21 (12.9%) | 17 (9.3%) | 7 (11.3%) | 0.602 |
Anosmia | 12 (7.4%) | 20 (10.9%) | 7 (11.3%) | 0.502 |
Skin Rashes | 25 (15.3%) | 26 (14.2%) | 5 (8.05%) | 0.409 |
Gastrointestinal Disorders | 10 (6.1%) | 14 (7.6%) | 5 (8.05%) | 0.831 |
Ageusia | 6 (3.7%) | 11 (6.0%) | 6 (9.7%) | 0.229 |
Days in hospital, mean (SD) | 7.8 (6.0) | 8.3 (9.1) | 8.0 (7.2) | 0.793 |
G/G (n = 324) | A/G (n = 78) | A/A (n = 6) | p-Value | |
---|---|---|---|---|
Age, mean (SD), years | 58.4 (14.0) | 60.0 (14.3) | 55.7 (6.5) | 0.580 |
Sex, female n (%) | 153 (47.2%) | 43 (55.1%) | 2 (33.3%) | 0.577 |
Weight, mean (SD), kg. | 79.5 (16.5) | 80.0 (18.0) | 101.2 (12.2) | 0.008 |
Height, mean (SD), cm. | 166.5 (9.5) | 166 (9.5) | 177.5 (14.7) | 0.02 |
Number of co-morbidities, mean (SD) | 1.25 (1.0) | 1.1 (1.0) | 1.5 (0.85) | 0.403 |
Medical co-morbidities, n (%) | ||||
Hypertension | 114 (35.1%) | 28 (35.9%) | 1 (16.7%) | 0.742 |
Obesity | 78 (24.1%) | 15 (19.25%) | 5 (83.3%) | 0.008 |
Diabetes | 35 (10.8%) | 7 (9.0%) | 1 (16.7%) | 0.812 |
Asthma | 32 (9.9%) | 5 (6.4%) | 1 (16.7%) | 0.558 |
Cardiovascular Diseases | 30 (9.25%) | 8 (10.25%) | 0 (0.0%) | 0.728 |
Chronic Obstructive Pulmonary Disease | 9 (2.8%) | 1 (1.3%) | 0 (0.0%) | 0.696 |
Rheumatological Diseases | 2 (0.65%) | 1 (1.3%) | 0 (0.0%) | 0.809 |
Number of post-COVID symptoms, mean (SD) | 3.0 (1.65) | 2.9 (1.8) | 3.8 (2.4) | 0.324 |
Post-COVID symptoms, n (%) | ||||
Fatigue | 228 (70.4%) | 50 (64.1%) | 5 (83.3%) | 0.768 |
Pain Symptoms | 136 (41.9%) | 28 (35.8%) | 2 (33.3%) | 0.819 |
Memory Loss | 88 (27.2%) | 22 (28.2%) | 2 (33.3%) | 0.950 |
Hair Loss | 81 (25.0%) | 23 (29.5%) | 1 (16.7%) | 0.709 |
Concentration Loss | 36 (11.1%) | 8 (10.25%) | 3 (50.0%) | 0.509 |
Cognitive Blunting—Brain Fog | 39 (12.1%) | 4 (5.1%) | 2 (33.3%) | 0.065 |
Dyspnoea | 60 (18.5%) | 19 (24.35%) | 1 (16.7%) | 0.571 |
Ocular Disorders | 36 (11.1%) | 7 (9.0%) | 2 (33.3%) | 0.224 |
Anosmia | 34 (10.5%) | 5 (6.4%) | 0 (0.0%) | 0.432 |
Skin Rashes | 48 (14.8%) | 8 (10.25%) | 0 (0.0%) | 0.409 |
Gastrointestinal Disorders | 20 (6.2%) | 8 (10.25%) | 1 (16.7%) | 0.323 |
Ageusia | 21 (6.5%) | 2 (2.5%) | 0 (0.0%) | 0.358 |
Days in hospital, mean (SD) | 8.25 (8.0) | 7.4 (6.3) | 6.2 (4.0) | 0.554 |
A/A (n = 345) | A/G (n = 58) | G/G (n = 5) | p-Value | |
---|---|---|---|---|
Age, mean (SD), years | 59.7 (13.7) | 53.5 (14.8) | 48.6 (11.9) | 0.002 |
Sex, female n (%) | 161 (46.7%) | 33 (56.9%) | 4 (80.0%) | 0.349 |
Weight, mean (SD), kg. | 79.5 (17.0) | 80.6 (15.7) | 96.8 (25.9) | 0.07 |
Height, mean (SD), cm. | 167 (9.5) | 166 (10.0) | 165.5 (9.5) | 0.202 |
Number of co-morbidities, mean (SD) | 1.2 (0.9) | 1.2 (1.0) | 2.0 (1.2) | 0.168 |
Medical co-morbidities, n (%) | ||||
Hypertension | 124 (35.9%) | 16 (27.6%) | 3 (60.0%) | 0.389 |
Obesity | 73 (21.2%) | 21 (36.2%) | 4 (80.0%) | 0.003 |
Diabetes | 38 (11.0%) | 5 (5.8%) | 0 (0.0%) | 0.669 |
Asthma | 33 (9.6%) | 5 (5.8%) | 0 (0.0%) | 0.771 |
Cardiovascular Diseases | 33 (9.6%) | 5 (5.8%) | 0 (0.0%) | 0.771 |
Chronic Obstructive Pulmonary Disease | 9 (2.6%) | 1 (1.7%) | 0 (0.0%) | 0.868 |
Rheumatological Diseases | 1 (0.3%) | 2 (3.45%) | 0 (0.0%) | 0.338 |
Number of post-COVID symptoms, mean (SD) | 2.9 (1.7) | 3.4 (1.7) | 3.2 (1.9) | 0.204 |
Post-COVID symptoms, n (%) | ||||
Fatigue | 234(67.8%) | 46 (79.3%) | 3 (60.0%) | 0.605 |
Pain Symptoms | 138 (40.0%) | 27 (46.5%) | 2 (40.0%) | 0.540 |
Memory Loss | 94 (27.2%) | 16 (27.6%) | 2 (40.0%) | 0.863 |
Hair Loss | 88 (25.5%) | 14 (24.1%) | 3 (60.0%) | 0.309 |
Concentration Loss | 41 (11.9%) | 6 (10.35%) | 0 (0.0%) | 0.709 |
Cognitive Blunting—Brain Fog | 39 (11.3%) | 6 (10.35%) | 0 (0.0%) | 0.740 |
Dyspnoea | 60 (17.4%) | 19 (32.8%) | 3 (60.0%) | 0.04 |
Ocular Disorders | 38 (11.0%) | 6 (10.35%) | 1 (20.0%) | 0.823 |
Anosmia | 31 (9.9%) | 8 (13.8%) | 0 (0.0%) | 0.430 |
Skin Rashes | 47 (13.6%) | 7 (12.1%) | 2 (40.0%) | 0.268 |
Gastrointestinal Disorders | 27 (7.8%) | 2 (3.5%) | 0 (0.0%) | 0.427 |
Ageusia | 17 (4.9%) | 6 (10.35%) | 0 (0.0%) | 0.238 |
Days in hospital, mean (SD) | 8.0 (7.7) | 8.4 (7.4) | 8.2 (8.7) | 0.941 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fernández-de-las-Peñas, C.; Díaz-Gil, G.; Gil-Crujera, A.; Gómez-Sánchez, S.M.; Ambite-Quesada, S.; Torres-Macho, J.; Ryan-Murua, P.; Franco-Moreno, A.I.; Pellicer-Valero, O.J.; Arendt-Nielsen, L.; et al. Inflammatory Polymorphisms (IL-6 rs1800796, IL-10 rs1800896, TNF-α rs1800629, and IFITM3 rs12252) Are Not Associated with Post-COVID Symptoms in Previously Hospitalized COVID-19 Survivors. Viruses 2024, 16, 275. https://doi.org/10.3390/v16020275
Fernández-de-las-Peñas C, Díaz-Gil G, Gil-Crujera A, Gómez-Sánchez SM, Ambite-Quesada S, Torres-Macho J, Ryan-Murua P, Franco-Moreno AI, Pellicer-Valero OJ, Arendt-Nielsen L, et al. Inflammatory Polymorphisms (IL-6 rs1800796, IL-10 rs1800896, TNF-α rs1800629, and IFITM3 rs12252) Are Not Associated with Post-COVID Symptoms in Previously Hospitalized COVID-19 Survivors. Viruses. 2024; 16(2):275. https://doi.org/10.3390/v16020275
Chicago/Turabian StyleFernández-de-las-Peñas, César, Gema Díaz-Gil, Antonio Gil-Crujera, Stella M. Gómez-Sánchez, Silvia Ambite-Quesada, Juan Torres-Macho, Pablo Ryan-Murua, Ana I. Franco-Moreno, Oscar J. Pellicer-Valero, Lars Arendt-Nielsen, and et al. 2024. "Inflammatory Polymorphisms (IL-6 rs1800796, IL-10 rs1800896, TNF-α rs1800629, and IFITM3 rs12252) Are Not Associated with Post-COVID Symptoms in Previously Hospitalized COVID-19 Survivors" Viruses 16, no. 2: 275. https://doi.org/10.3390/v16020275