Prevalence and VP1 Gene Evaluation Analysis of Porcine Sapelovirus in Yunnan Province, China, from 2024 to 2025
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction and RT-PCR Amplification
2.3. PSV VP1 Gene Amplification and Sequencing
2.4. VP1 Sequence Identity and Phylogenetic Analysis
2.5. Selection Pressure Analysis of the VP1 Gene of PSV
2.6. Predictions of the Structures and the B-Cell Epitopes of VP1 Protein of PSV
2.7. Statistical Analysis
3. Results
3.1. Positive Rate and Regional Distribution of PSV in Yunnan Province
3.2. Co-Infection Rate with Other Enteric Pathogens
3.3. VP1 Sequence Identity Analysis
3.4. VP1 Gene Phylogenetic Analysis
3.5. Selection Pressure Analysis of the VP1 Gene
3.6. Prediction of the Hydropath, B Cell Epitopes and Tertiary Structure of the PSV VP1 Protein
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abe, M.; Ito, N.; Sakai, K.; Kaku, Y.; Oba, M.; Nishimura, M.; Kurane, I.; Saijo, M.; Morikawa, S.; Sugiyama, M.; et al. A novel sapelovirus-like virus isolation from wild boar. Virus Genes 2011, 43, 243–248. [Google Scholar] [CrossRef] [PubMed]
- Son, K.Y.; Kim, D.S.; Kwon, J.; Choi, J.S.; Kang, M.I.; Belsham, G.J.; Cho, K.O. Full-length genomic analysis of Korean porcine Sapelovirus strains. PLoS ONE 2014, 9, e107860. [Google Scholar] [CrossRef] [PubMed]
- Harima, H.; Kajihara, M.; Simulundu, E.; Bwalya, E.; Qiu, Y.; Isono, M.; Okuya, K.; Gonzalez, G.; Yamagishi, J.; Hang’ombe, B.M.; et al. Genetic and Biological Diversity of Porcine Sapeloviruses Prevailing in Zambia. Viruses 2020, 12, 180. [Google Scholar] [CrossRef] [PubMed]
- Hao, C.; Ren, H.; Wu, X.; Shu, X.; Li, Z.; Hu, Y.; Zeng, Q.; Zhang, Y.; Zu, S.; Yuan, J.; et al. Preparation of monoclonal antibody and identification of two novel B cell epitopes to VP1 protein of porcine sapelovirus. Vet. Microbiol. 2022, 275, 109593. [Google Scholar] [CrossRef]
- Ibrahim, Y.M.; Zhang, W.; Werid, G.M.; Zhang, H.; Feng, Y.; Pan, Y.; Zhang, L.; Li, C.; Lin, H.; Chen, H.; et al. Isolation, Characterization, and Molecular Detection of Porcine Sapelovirus. Viruses 2022, 14, 349. [Google Scholar] [CrossRef]
- Yang, T.; Lu, Y.; Zhang, L. Proposed genotype definition of Porcine sapelovirus. Pol. J. Vet. Sci. 2021, 24, 307–312. [Google Scholar] [CrossRef]
- Boros, A.; Laszlo, Z.; Pankovics, P.; Marosi, A.; Albert, M.; Csagola, A.; Biro, H.; Fahsbender, E.; Delwart, E.; Reuter, G. High prevalence, genetic diversity and a potentially novel genotype of Sapelovirus A (Picornaviridae) in enteric and respiratory samples in Hungarian swine farms. J. Gen. Virol. 2020, 101, 609–621. [Google Scholar] [CrossRef]
- Yang, T.; Zhang, L.; Lu, Y.; Guo, M.; Zhang, Z.; Lin, A. Characterization of porcine sapelovirus prevalent in western Jiangxi, China. BMC Vet. Res. 2021, 17, 273. [Google Scholar] [CrossRef]
- Sunaga, F.; Masuda, T.; Ito, M.; Akagami, M.; Naoi, Y.; Sano, K.; Katayama, Y.; Omatsu, T.; Oba, M.; Sakaguchi, S.; et al. Complete genomic analysis and molecular characterization of Japanese porcine sapeloviruses. Virus Genes 2019, 55, 198–208. [Google Scholar] [CrossRef]
- Yang, T.; Yu, X.; Yan, M.; Luo, B.; Li, R.; Qu, T.; Luo, Z.; Ge, M.; Zhao, D. Molecular characterization of Porcine sapelovirus in Hunan, China. J. Gen. Virol. 2017, 98, 2738–2747. [Google Scholar] [CrossRef]
- Bak, G.Y.; Kang, M.I.; Son, K.Y.; Park, J.G.; Kim, D.S.; Seo, J.Y.; Kim, J.Y.; Alfajaro, M.M.; Soliman, M.; Baek, Y.B.; et al. Occurrence and molecular characterization of Sapelovirus A in diarrhea and non-diarrhea feces of different age group pigs in one Korean pig farm. J. Vet. Med. Sci. 2017, 78, 1911–1914. [Google Scholar] [CrossRef]
- Hulst, M.M.; Heres, L.; Hakze-van der Honing, R.W.; Pelser, M.; Fox, M.; van der Poel, W.H.M. Study on inactivation of porcine epidemic diarrhoea virus, porcine sapelovirus 1 and adenovirus in the production and storage of laboratory spray-dried porcine plasma. J. Appl. Microbiol. 2019, 126, 1931–1943. [Google Scholar] [CrossRef]
- Naide, T.; Ikeguchi, A.; Islam, A.; Katsuda, K.; Kawashima, K.; Nakakubo, R.; Miyazaki, A. Relationship between aerosol concentration and airborne microbe including porcine sapelovirus concentration in Japanese weaning swine houses. In Proceedings of the 10th International Livestock Environment Symposium, Omaha, NE, USA, 25–27 September 2018. [Google Scholar]
- Lamont, P.H.; Betts, A.O. Studies on Enteroviruses of the Pig—IV. Res. Vet. Sci. 1960, 1, 152–161. [Google Scholar] [CrossRef]
- Ray, P.K.; Desingu, P.A.; Kumari, S.; John, J.K.; Sethi, M.; Sharma, G.K.; Pattnaik, B.; Singh, R.K.; Saikumar, G. Porcine sapelovirus among diarrhoeic piglets in India. Transbound. Emerg. Dis. 2018, 65, 261–263. [Google Scholar] [CrossRef]
- Lang, D.L.; Ji, W.H.; Wang, C.S.; Sun, H.; Cheng, M.L.; Cui, L.; Dong, G.Z.; Hua, X.G. Molecular epidemiological investigation of porcine sapelovirus in some pig herds in East China. Prog. Vet. Med. 2012, 33, 116–121. [Google Scholar]
- Chen, J.W.; Zhou, Q.F.; Song, Y.H.; Zhang, X.B.; Xue, C.Y.; Cao, Y.C. Molecular epidemiological investigation of porcine sapelovirus in pig herds in some areas of South China from 2012 to 2013. In Proceedings of the 2014 Academic Annual Conference of the Chinese Society of Animal Science and Veterinary Medicine, Xiangtan, China, 18–20 October 2014. [Google Scholar]
- Krumbholz, A.; Wurm, R.; Scheck, O.; Birch-Hirschfeld, E.; Egerer, R.; Henke, A.; Wutzler, P.; Zell, R. Detection of porcine teschoviruses and enteroviruses by LightCycler real-time PCR. J. Virol. Methods 2003, 113, 51–63. [Google Scholar] [CrossRef]
- Ding, G.; Fu, Y.; Li, B.; Chen, J.; Wang, J.; Yin, B.; Sha, W.; Liu, G. Development of a multiplex RT-PCR for the detection of major diarrhoeal viruses in pig herds in China. Transbound. Emerg. Dis. 2020, 67, 678–685. [Google Scholar] [CrossRef]
- Katoh, K.; Asimenos, G.; Toh, H. Multiple alignment of DNA sequences with MAFFT. Methods Mol. Biol. 2009, 537, 39–64. [Google Scholar]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Tang, D.; Chen, M.; Huang, X.; Zhang, G.; Zeng, L.; Zhang, G.; Wu, S.; Wang, Y. SRplot: A free online platform for data visualization and graphing. PLoS ONE 2023, 18, e0294236. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
- Weaver, S.; Shank, S.D.; Spielman, S.J.; Li, M.; Muse, S.V.; Kosakovsky Pond, S.L. Datamonkey 2.0: A Modern Web Application for Characterizing Selective and Other Evolutionary Processes. Mol. Biol. Evol. 2018, 35, 773–777. [Google Scholar] [CrossRef]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
- Prodelalova, J. The survey of porcine teschoviruses, sapeloviruses and enteroviruses B infecting domestic pigs and wild boars in the Czech Republic between 2005 and 2011. Infect. Genet. Evol. 2012, 12, 1447–1451. [Google Scholar] [CrossRef]
- Li, L.; Shan, T.; Wang, C.; Cote, C.; Kolman, J.; Onions, D.; Gulland, F.M.; Delwart, E. The fecal viral flora of California sea lions. J. Virol. 2011, 85, 9909–9917. [Google Scholar] [CrossRef]
- Tseng, C.H.; Tsai, H.J. Sequence analysis of a duck picornavirus isolate indicates that it together with porcine enterovirus type 8 and simian picornavirus type 2 should be assigned to a new picornavirus genus. Virus Res. 2007, 129, 104–114. [Google Scholar] [CrossRef]
- Zhang, W.; Kataoka, M.; Doan, H.Y.; Ami, Y.; Suzaki, Y.; Takeda, N.; Muramatsu, M.; Li, T.C. Characterization of a Novel Simian Sapelovirus Isolated from a Cynomolgus Monkey using PLC/PRF/5 Cells. Sci. Rep. 2019, 9, 20221. [Google Scholar] [CrossRef]
- Li, B.Q.; Liu, H.L.; Liu, J.J.; Tao, J.; Cheng, Q.H.; Shi, Y.; Qiao, C.T.; Shen, X.H. Detection and genetic evolution analysis of swine Saperol virus in Shanghai Area. Acta Agric. Shanghai 2023, 39, 64–70. [Google Scholar]
- Fan, Z.L.; Lin, B.S.; Huang, S.; Lan, D.L. Investigation on the Infection of swine Saperol virus in pig Herds in Sichuan Region. Sichuan Anim. Vet. Sci. 2015, 42, 29–33. [Google Scholar]
- Li, Y.; Du, L.; Jin, T.; Cheng, Y.; Zhang, X.; Jiao, S.; Huang, T.; Zhang, Y.; Yan, Y.; Gu, J.; et al. Characterization and epidemiological survey of porcine sapelovirus in China. Vet. Microbiol. 2019, 232, 13–21. [Google Scholar] [CrossRef]
- Zhang, B.; Tang, C.; Yue, H.; Ren, Y.; Song, Z. Viral metagenomics analysis demonstrates the diversity of viral flora in piglet diarrhoeic faeces in China. J. Gen. Virol. 2014, 95, 1603–1611. [Google Scholar] [CrossRef] [PubMed]
- Ranjan, K.; Minakshi, P.; Prasad, G. Bluetongue: Indian perspective. Acta Virol. 2015, 59, 317–337. [Google Scholar] [CrossRef] [PubMed]
- Anthony, S.J.; Maan, S.; Maan, N.; Kgosana, L.; Bachanek-Bankowska, K.; Batten, C.; Darpel, K.E.; Sutton, G.; Attoui, H.; Mertens, P.P. Genetic and phylogenetic analysis of the outer-coat proteins VP2 and VP5 of epizootic haemorrhagic disease virus (EHDV): Comparison of genetic and serological data to characterise the EHDV serogroup. Virus Res. 2009, 145, 200–210. [Google Scholar] [CrossRef] [PubMed]
- Anisimova, M.; Yang, Z. Molecular evolution of the hepatitis delta virus antigen gene: Recombination or positive selection? J. Mol. Evol. 2004, 59, 815–826. [Google Scholar] [CrossRef][Green Version]
- Focosi, D.; Maggi, F.; Franchini, M.; McConnell, S.; Casadevall, A. Analysis of Immune Escape Variants from Antibody-Based Therapeutics against COVID-19: A Systematic Review. Int. J. Mol. Sci. 2021, 23, 29. [Google Scholar] [CrossRef]







| Prefecture | County | Town | Number of Pig Farm | Number of Sample | Numer of Pigs |
|---|---|---|---|---|---|
| Honghe | Mile | Pengpu, Xinshao, Hongxi, Zhuyuan, Xiyi, Xier, Xisan, Dongshan, Jiangbian, Wushan, Xunjiansi, Dongfeng | 44 | 957 | 1500–8000 |
| Geji | Datun | 30 | 276 | 500–6000 | |
| Yuanyang | Nansha, Ganiang | 7 | 82 | 50–200 | |
| Dehong | Ruili | Mengmao | 5 | 52 | / |
| Boshan | Tengchong | Beihai | 1 | 26 | / |
| Xishuangbannan | Jinghong | Jinghong | 1 | 29 | / |
| Nujiang | Lushui | Laowo | 1 | 40 | / |
| Kunming | Xundian | Jingsuo | 1 | 30 | / |
| Qujing | Zhanyi | Zhanyi | 1 | 50 | / |
| Yuxi | Jiangchuan | Jiangchuan | 1 | 20 | / |
| Chuxiong | Lufeng | Jingshan | 1 | 30 | / |
| Puer | Simao | Simao | 1 | 30 | / |
| Total | / | / | 91 | 1622 | / |
| Primer Name | Sequence (5′-3′) | Product Size (bp) | Purpose | Reference |
|---|---|---|---|---|
| pev-8g | ATGGCAGTAGCGTGGCGAGCTAT | 212 | Screening PSV infection | [18] |
| pev-8h | GTAATGCCAAGAGCATGCGCCA | |||
| VP1-F | ATTGCCTAYACACCACCTGG | 1324 | Amplificating VP1 gene | [16] |
| VP1-R | GCAGGTCTTCTCCCACAAAC |
| Variables | Category a | No. Tested b | No. Positive | Positivity Rate (%) (95% CI) | Heterogeneity (χ2/df/p) |
|---|---|---|---|---|---|
| Regions | Honghe | 1315 | 484 | 36.81 (34.20–39.42) | 58.842/9/<0.01 |
| Dehong | 52 | 17 | 32.69 (19.51–45.88) | ||
| Boshan | 26 | 15 | 57.69 (37.34–78.04) | ||
| Xishuangbannan | 29 | 17 | 58.62 (39.56–77.69) | ||
| Nujiang | 40 | 15 | 37.50 (21.82–53.18) | ||
| Kunming | 30 | 3 | 10.00 (0.00–21.39) | ||
| Qujing | 50 | 7 | 14.00 (4.04–23.96) | ||
| Yuxi | 20 | 9 | 45.00 (21.11–68.89) | ||
| Chuxiong | 30 | 3 | 10.00 (0.00–21.39) | ||
| Puer | 30 | 22 | 73.33 (56.54–90.13) | ||
| Fecal status c | Diarrhea | 201 | 95 | 47.26 (40.30–54.22) | 14.353/1/<0.01 |
| Normal | 447 | 142 | 31.77 (27.43–36.10) | ||
| Season | Spring | 59 | 20 | 33.90 (21.46–46.34) | 31.137/3/<0.01 |
| Summer | 100 | 19 | 19.00 (11.18–26.82) | ||
| Autumn | 30 | 22 | 73.33 (56.54–90.13) | ||
| Winter | 1433 | 531 | 37.06 (34.55–39.56) | ||
| Total | / | 1622 | 592 | 36.50 (34.15–38.84) | / |
| Region | Month | Season | Fecal Status | No. Tested | No. Positive | Positivity Rate (%) (95% CI) | Heterogeneity (χ2/df/p) |
|---|---|---|---|---|---|---|---|
| Honghe | 2024-12 | Winter | Diarrhea | 52 | 43 | 82.69 (72.05–93.33) | 44.247/1/<0.001 |
| Normal | 306 | 103 | 33.66 (28.34–38.99) | ||||
| Dehong | 2025-1 | Winter | Diarrhea | 32 | 13 | 40.63 (22.64–58.62) | 2.379/1/0.123 |
| Normal | 20 | 4 | 20.00 (7.93–39.21) | ||||
| Boshan | 2025-1 | Winter | Diarrhea | 15 | 9 | 60.00 (31.92–88.08) | 0.077/1/0.781 |
| Normal | 11 | 6 | 54.55 (19.46–89.63) | ||||
| Xishuang bannan | 2025-3 | Spring | Diarrhea | 19 | 12 | 63.16 (39.27–87.05) | 0.468/1/0.494 |
| Normal | 10 | 5 | 50.00 (12.30–87.70) | ||||
| Nujiang | 2025-1 | Winter | Diarrhea | 20 | 3 | 15.00 (0–32.15) | 8.640/1/0.03 |
| Normal | 20 | 12 | 60.00 (36.48–83.52) | ||||
| Kunming | 2024-4 | Spring | Diarrhea | 20 | 3 | 15.00 (0–32.15) | 1.667/1/0.197 |
| Normal | 10 | 0 | 0.00 (/) | ||||
| Qujing | 2024-7 | Summer | Diarrhea | 15 | 4 | 26.67 (1.32–52.02) | 2.856/1/0.091 |
| Normal | 35 | 3 | 8.57 (0–18.33) | ||||
| Yuxi | 2024-7 | Summer | Diarrhea | 10 | 6 | 60.00 (23.06–96.94) | 1.184/1/0.178 |
| Normal | 10 | 3 | 30.00 (4.56–64.56) | ||||
| Chuxiong | 2024-7 | Summer | Diarrhea | 15 | 3 | 20.00 (0–42.93) | 3.333/1/0.068 |
| Normal | 15 | 0 | 0.00 (/) | ||||
| Puer | 2024-9 | Autumn | Diarrhea | 20 | 16 | 80.00 (60.79–99.21) | 1.364/1/0.243 |
| Normal | 10 | 6 | 60.00 (23.06–96.94) |
| Position aa | Methods | |||||||
|---|---|---|---|---|---|---|---|---|
| FUBAR | FEL | SLAC | MEME | |||||
| dN/dS | Post. Pr | dN/dS | p-Value | dN/dS | p-Value | ω+ | p-Value | |
| 10 | - | - | - | - | - | - | 9.597 | 0.008 |
| 14 | - | - | - | - | - | - | 279.998 | 0.001 |
| 24 | - | - | - | - | - | - | 16.504 | 0.095 |
| 28 | - | - | - | - | - | - | 5.260 | 0.028 |
| 29 | - | - | - | - | - | - | 340.648 | 0.001 |
| 43 | - | - | - | - | - | - | 15.655 | 0.005 |
| 66 | - | - | - | - | - | - | 205.843 | 0.007 |
| 77 | - | - | - | - | - | - | 106.758 | 0.002 |
| 86 | - | - | - | - | 4.948 | 0.067 | - | - |
| 89 | - | - | - | - | - | - | 124.021 | 0 |
| 95 | 3.578 | 0.988 | - | - | - | - | 11.175 | 0 |
| 98 | - | - | - | - | - | - | 9.287 | 0.038 |
| 102 | - | - | - | - | - | - | 27.608 | 0.004 |
| 113 | - | - | - | - | - | - | 16.391 | 0.019 |
| 128 | - | - | - | - | - | - | 260.906 | 0.039 |
| 133 | - | - | - | - | - | - | 22.093 | 0.093 |
| 164 | - | - | - | - | - | - | 27.084 | 0.003 |
| 173 | - | - | - | - | - | - | 30.708 | 0.014 |
| 184 | - | - | - | - | - | - | 42.496 | 0.023 |
| 213 | - | - | - | - | - | - | 10.195 | 0.032 |
| 228 | - | - | - | - | - | - | 33.849 | 0 |
| 238 | - | - | - | - | - | - | 9.121 | 0.052 |
| 269 | - | - | - | - | Infinite | 0.095 | - | - |
| 290 | - | - | - | - | - | - | 122.086 | 0.004 |
| 291 | - | - | - | - | - | - | 36.941 | 0.042 |
| 292 | - | - | - | - | - | - | 26.788 | 0.007 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Tang, X.; Zhang, Z.; Zhu, P.; Li, Z.; Liu, P.; Yang, Q.; Meng, L.; Sun, X.; Yang, Z.; et al. Prevalence and VP1 Gene Evaluation Analysis of Porcine Sapelovirus in Yunnan Province, China, from 2024 to 2025. Viruses 2025, 17, 1336. https://doi.org/10.3390/v17101336
Li Z, Tang X, Zhang Z, Zhu P, Li Z, Liu P, Yang Q, Meng L, Sun X, Yang Z, et al. Prevalence and VP1 Gene Evaluation Analysis of Porcine Sapelovirus in Yunnan Province, China, from 2024 to 2025. Viruses. 2025; 17(10):1336. https://doi.org/10.3390/v17101336
Chicago/Turabian StyleLi, Zhanhong, Xuyu Tang, Zhenxing Zhang, Pei Zhu, Zhuoran Li, Peng Liu, Qi Yang, Li Meng, Xiutao Sun, Zhen Yang, and et al. 2025. "Prevalence and VP1 Gene Evaluation Analysis of Porcine Sapelovirus in Yunnan Province, China, from 2024 to 2025" Viruses 17, no. 10: 1336. https://doi.org/10.3390/v17101336
APA StyleLi, Z., Tang, X., Zhang, Z., Zhu, P., Li, Z., Liu, P., Yang, Q., Meng, L., Sun, X., Yang, Z., Yang, Q., Zhang, Y., & Song, J. (2025). Prevalence and VP1 Gene Evaluation Analysis of Porcine Sapelovirus in Yunnan Province, China, from 2024 to 2025. Viruses, 17(10), 1336. https://doi.org/10.3390/v17101336

