Utilizing Viral Metagenomics to Characterize Pathogenic and Commensal Viruses in Pediatric Patients with Febrile Neutropenia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Sample Processing and Illumina Sequencing
2.3. Bioinformatic Processing of the Raw Sequencing Data and Taxonomic Classification of Viral Reads
2.4. Analysis of the Viral Diversity
2.5. Direct Detection of Clinically Important Viruses in Individual Samples
2.6. hADV Confirmation by Ampicon Sequencing
2.7. Statistical Analysis
3. Results
3.1. Sequencing Results: Quantitative Results
3.2. Viral Diversity
3.3. Direct Confirmation and Molecular Characteristics of the Identified Viruses via mNGS
3.3.1. qPCR Detection of Herpesviruses
3.3.2. qPCR Detection of Polyomaviruses MW and WU
3.3.3. Nested PCR for Confirmation of hADV
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
FN | Febrile neutropenia |
ANC | Absolute neutrophil count |
AML | Acute myeloid leukemia |
ALL | Acute lymphoblastic leukemia |
EBV | Epstein–Barr virus |
HSV-1 | Herpes simplex virus 1 |
hADV | Human adenovirus |
SARS-CoV-2 | Severe acute respiratory syndrome coronavirus 2 |
RSV | Respiratory syncytial virus |
mNGS | Metagenomic next generation sequencing |
HC-FMRP | Hospital das Clínicas, Faculty of Medicine of Ribeirão Preto |
PCA | Principal component analysis |
CMV | Cytomegalovirus |
HHV | Human herpes virus |
MWPyV | Malawi polyomavirus |
WUPyV | Washington University polyomavirus |
Ct | Cycle threshold |
TTV | Torque teno virus |
TTMV | Torque teno mini virus |
TTMDV | Torque teno midi virus |
References
- de Naurois, J.; Novitzky-Basso, I.; Gill, M.J.; Marti, F.M.; Cullen, M.H.; Roila, F. Management of febrile neutropenia: ESMO Clinical Practice Guidelines. Ann. Oncol. 2010, 21, v252–v256. [Google Scholar] [CrossRef] [PubMed]
- Freifeld, A.G.; Bow, E.J.; Sepkowitz, K.A.; Boeckh, M.J.; Ito, J.I.; Mullen, C.A.; Raad, I.I.; Rolston, K.V.; Young, J.A.; Wingard, J.R.; et al. Clinical practice guideline for the use of antimicrobial agents in neutropenic patients with cancer: 2010 update by the infectious diseases society of America. Clin. Infect. Dis. 2011, 52, e56–e93. [Google Scholar] [CrossRef] [PubMed]
- Davis, K.; Wilson, S. Febrile neutropenia in paediatric oncology. Paediatr. Child Health 2020, 30, 93–97. [Google Scholar] [CrossRef] [PubMed]
- Punnapuzha, S.; Edemobi, P.K.; Elmoheen, A. Febrile Neutropenia; StatPearls Publishing: Tressure Island, FL, USA, 2023. [Google Scholar]
- Lyman, G.H.; Abella, E.; Pettengell, R. Risk factors for febrile neutropenia among patients with cancer receiving chemotherapy: A systematic review. Crit. Rev. Oncol. Hematol. 2014, 90, 190–199. [Google Scholar] [CrossRef] [PubMed]
- Guarana, M.; Nucci, M.; Nouér, S.A. Shock and early death in hematologic patients with febrile neutropenia. Antimicrob. Agents Chemother. 2019, 63, e01250-19. [Google Scholar] [CrossRef] [PubMed]
- Escrihuela-Vidal, F.; Laporte, J.; Albasanz-Puig, A.; Gudiol, C. Update on the management of febrile neutropenia in hematologic patients. Rev. Esp. Quimioter. 2019, 32, 55–58. [Google Scholar]
- Guo, F.; Kang, L.; Zhang, L. mNGS for identifying pathogens in febrile neutropenic children with hematological diseases. Int. J. Infect. Dis. 2022, 116, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, R.; Bansal, D.; Naru, J.; Salaria, M.; Rana, A.; Minz, R.W.; Trehan, A.; Marwaha, R.K. HSV-1 as well as HSV-2 is frequent in oral mucosal lesions of children on chemotherapy. Support. Care Cancer 2014, 22, 1773–1779. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, S.N.; Vu, L.T.; Vu, Q.V.; Tran, T.T.; Dinh, V.T.T. Clinical epidemiology characteristics and etiology of febrile neutropenia in children: Analysis of 421 cases. Hematol. Rep. 2022, 14, 245–252. [Google Scholar] [CrossRef]
- Söderman, M.; Rhedin, S.; Tolfvenstam, T.; Rotzén-Östlund, M.; Albert, J.; Broliden, K.; Lindblom, A. Frequent respiratory viral infections in children with febrile neutropenia—A prospective follow-up study. PLoS ONE 2016, 11, e0157398. [Google Scholar] [CrossRef]
- Edward, P.; Handel, A.S. Metagenomic next-generation sequencing for infectious disease diagnosis: A review of the literature with a focus on pediatrics. J. Pediatr. Infect. Dis. Soc. 2021, 10, S71–S77. [Google Scholar] [CrossRef]
- Cooksley, T.; Font, C.; Scotte, F.; Escalante, C.; Johnson, L.; Anderson, R.; Rapoport, B. Emerging challenges in the evaluation of fever in cancer patients at risk of febrile neutropenia in the era of COVID-19: A MASCC position paper. Support. Care Cancer 2021, 29, 1129–1138. [Google Scholar] [CrossRef]
- Meidani, M.; Mirmohammad Sadeghi, S.A. Respiratory viruses in febrile neutropenic patients with respiratory symptoms. Adv. Biomed. Res. 2018, 7, 5. [Google Scholar]
- Hakim, H.; Flynn, P.M.; Knapp, K.M.; Srivastava, D.K.; Gaur, A.H. Etiology and clinical course of febrile neutropenia in children with cancer. J. Pediatr. Hematol. Oncol. 2009, 31, 623–629. [Google Scholar] [CrossRef] [PubMed]
- Erbaş, İ.C.; Çakıl Güzin, A.; Özdem Alataş, Ş.; Karaoğlu Asrak, H.; Akans, İ.; Akyol, Ş.; Özlü, C.; Tüfekçi, Ö.; Yılmaz, Ş.; Ören, H.; et al. Etiology and factors affecting severe complications and mortality of febrile neutropenia in children with acute leukemia. Turk. J. Haematol. 2023, 40, 143–153. [Google Scholar] [CrossRef]
- Chiu, C.Y.; Miller, S.A. Clinical metagenomics. Nat. Rev. Genet. 2019, 20, 341–355. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 18 December 2024).
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with burrows-wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed]
- Wood, D.E.; Lu, J.; Langmead, B. Improved metagenomic analysis with Kraken 2. Genome Biol. 2019, 20, 257. [Google Scholar] [CrossRef] [PubMed]
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2009; Available online: https://ggplot2.tidyverse.org (accessed on 3 January 2025).
- Zhao, S.; Yin, L.; Guo, Y.; Sheng, Q.; Shyr, Y. heatmap3: An Improved Heatmap Package. Available online: https://CRAN.R-project.org/package=heatmap3 (accessed on 15 December 2024).
- Kassambara, A.; Mundt, F. factoextra: Extract and Visualize the Results of Multivariate Data Analyses. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 5 January 2025).
- Luciola Zanette, D.; Andrade Coelho, K.B.C.; de Carvalho, E.; Aoki, M.N.; Nardin, J.M.; Araújo Lalli, L.; Dos Santos Bezerra, R.; Giovanetti, M.; Simionatto Zucherato, V.; Montenegro de Campos, G.; et al. Metagenomic insights into the plasma virome of Brazilian patients with prostate cancer. Mol. Cell. Oncol. 2023, 10, 2188858. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Breitwieser, F.P.; Thielen, P.; Salzberg, S.L. Bracken: Estimating species abundance in metagenomics data. PeerJ Comput. Sci. 2017, 3, e104. [Google Scholar] [CrossRef]
- Liu, C.; Cui, Y.; Li, X.; Yao, M. microeco: An R package for data mining in microbial community ecology. FEMS Microbiol. Ecol. 2021, 97, fiaa255. [Google Scholar] [CrossRef] [PubMed]
- Allard, A.; Albinsson, B.; Wadell, G. Rapid typing of human adenoviruses by a general PCR combined with restriction endonuclease analysis. J. Clin. Microbiol. 2001, 39, 498–505. [Google Scholar] [CrossRef] [PubMed]
- Kessler, H.H.; Mühlbauer, G.; Rinner, B.; Stelzl, E.; Berger, A.; Dörr, H.W.; Santner, B.; Marth, E.; Rabenau, H. Detection of Herpes simplex virus DNA by real-time PCR. J. Clin. Microbiol. 2000, 38, 2638–2642. [Google Scholar] [CrossRef] [PubMed]
- Slavov, S.N.; Otaguiri, K.K.; de Figueiredo, G.G.; Yamamoto, A.Y.; Mussi-Pinhata, M.M.; Kashima, S.; Covas, D.T. Development and optimization of a sensitive TaqMan® real-time PCR with synthetic homologous extrinsic control for quantitation of Human cytomegalovirus viral load. J. Med. Virol. 2016, 88, 1604–1612. [Google Scholar] [CrossRef] [PubMed]
- Watzinger, F.; Suda, M.; Preuner, S.; Baumgartinger, R.; Ebner, K.; Baskova, L.; Niesters, H.G.; Lawitschka, A.; Lion, T. Real-time quantitative PCR assays for detection and monitoring of pathogenic human viruses in immunosuppressed pediatric patients. J. Clin. Microbiol. 2004, 42, 5189–5198. [Google Scholar] [CrossRef] [PubMed]
- Wada, K.; Mizoguchi, S.; Ito, Y.; Kawada, J.; Yamauchi, Y.; Morishima, T.; Nishiyama, Y.; Kimura, H. Multiplex real-time PCR for the simultaneous detection of herpes simplex virus, human herpesvirus 6, and human herpesvirus 7. Microbiol. Immunol. 2009, 53, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Siebrasse, E.A.; Reyes, A.; Lim, E.S.; Zhao, G.; Mkakosya, R.S.; Manary, M.J.; Gordon, J.I.; Wang, D. Identification of MW polyomavirus, a novel polyomavirus in human stool. J. Virol. 2012, 86, 10321–10326. [Google Scholar] [CrossRef]
- Neske, F.; Blessing, K.; Pröttel, A.; Ullrich, F.; Kreth, H.W.; Weissbrich, B. Detection of WU polyomavirus DNA by real-time PCR in nasopharyngeal aspirates, serum, and stool samples. J. Clin. Virol. 2009, 44, 115–118. [Google Scholar] [CrossRef] [PubMed]
- Biasolo, M.A.; Calistri, A.; Cesaro, S.; Gentile, G.; Mengoli, C.; Palù, G. Case report: Kinetics of Epstein-Barr virus load in a bone marrow transplant patient with no sign of lymphoproliferative disease. J. Med. Virol. 2003, 69, 220–224. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
- Wylie, K.M.; Mihindukulasuriya, K.A.; Sodergren, E.; Weinstock, G.M.; Storch, G.A. Sequence analysis of the human virome in febrile and afebrile children. PLoS ONE 2012, 7, e27735. [Google Scholar] [CrossRef]
- Meena, J.P.; Brijwal, M.; Seth, R.; Gupta, A.K.; Jethani, J.; Kapil, A.; Jat, K.R.; Choudhary, A.; Kabra, S.K.; Dwivedi, S.N.; et al. Prevalence and clinical outcome of respiratory viral infections among children with cancer and febrile neutropenia. Pediatr. Hematol. Oncol. 2019, 36, 330–343. [Google Scholar] [CrossRef]
- Sourvinos, G.; Mammas, I.N.; Spandidos, D.A. Merkel cell polyomavirus infection in childhood: Current advances and perspectives. Arch. Virol. 2015, 160, 887–892. [Google Scholar] [CrossRef] [PubMed]
- Pinto, M.; Dobson, S. BK and JC virus: A review. J. Infect. 2014, 68, S2–S8. [Google Scholar] [CrossRef] [PubMed]
- Prezioso, C.; Moens, U.; Oliveto, G.; Brazzini, G.; Piacentini, F.; Frasca, F.; Viscido, A.; Scordio, M.; Guerrizio, G.; Rodio, D.M.; et al. KI and WU Polyomavirus in Respiratory Samples of SARS-CoV-2 Infected Patients. Microorganisms 2021, 9, 1259. [Google Scholar] [CrossRef]
- Ariza-Heredia, E.J.; Nesher, L.; Chemaly, R.F. Cytomegalovirus diseases after hematopoietic stem cell transplantation: A mini-review. Cancer Lett. 2014, 342, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Port, A.D.; Orlin, A.; Kiss, S.; Patel, S.; D’Amico, D.J.; Gupta, M.P. Cytomegalovirus retinitis: A review. J. Ocul. Pharmacol. Ther. 2017, 33, 224–234. [Google Scholar] [CrossRef]
- Teranishi, H.; Ohzono, N.; Miyata, I.; Wakabayashi, S.; Kono, M.; Ono, S.; Kato, A.; Saito, A.; Kondo, E.; Tanaka, Y.; et al. Incidence of viremia with DNA viruses in oncology patients with febrile neutropenia. J. Pediatr. Hematol. Oncol. 2018, 40, 605–608. [Google Scholar] [CrossRef]
- Zhang, J.; Kamoi, K.; Zong, Y.; Yang, M.; Ohno-Matsui, K. Cytomegalovirus Anterior Uveitis: Clinical Manifestations, Diagnosis, Treatment, and Immunological Mechanisms. Viruses 2023, 15, 185. [Google Scholar] [CrossRef] [PubMed]
- Simoons-Smit, A.M.; Kraan, E.M.; Beishuizen, A.; Strack van Schijndel, R.J.; Vandenbroucke-Grauls, C.M. Herpes simplex virus type 1 and respiratory disease in critically ill patients: Real pathogen or innocent bystander? Clin. Microbiol. Infect. 2006, 12, 1050–1059. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Zhu, K.; Wang, X.; Yang, Q.; Yu, S.; Zhang, Y.; Fu, Z.; Wang, H.; Zhao, Y.; Lin, K.; et al. Utility of clinical metagenomics in diagnosing malignancies in a cohort of patients with Epstein-Barr virus positivity. Front. Cell Infect. Microbiol. 2023, 13, 1211732. [Google Scholar] [CrossRef] [PubMed]
- Ebell, M.H. Epstein-Barr virus infectious mononucleosis. Am. Fam. Physician 2004, 70, 1279–1287. [Google Scholar]
- Womack, J.; Jimenez, M. Common questions about infectious mononucleosis. Am. Fam. Physician 2015, 91, 372–376. [Google Scholar] [PubMed]
- Rozenberg, F. Acute viral encephalitis. In Handbook of Clinical Neurology; Elsevier: Amsterdam, The Netherlands, 2013; Volume 112, pp. 1171–1181. [Google Scholar]
- Stahl, J.P.; Mailles, A. Herpes simplex virus encephalitis update. Curr. Opin. Infect. Dis. 2019, 32, 239–243. [Google Scholar] [CrossRef] [PubMed]
- Frey, J.W.; Cherabie, J.N.; Assi, M.A. Human herpesvirus-6 encephalitis following chemotherapy induction for acute myelogenous leukemia. Transpl. Infect. Dis. 2017, 19, e12780. [Google Scholar] [CrossRef] [PubMed]
- Täger, F.M.; Zolezzi, R.P.; Folatre, B.I.; Navarrete, C.M.; Rojas, P.J. Infecciones por virus respiratorios en niños con leucemia linfoblástica aguda y neutropenia febril: Estudio prospectivo [Respiratory virus infections in children with acute lymphoblastic leukemia and febrile neutropenia: A prospective study]. Rev. Chil. Infectol. 2006, 23, 118–123. [Google Scholar] [CrossRef]
- Aldemir-Kocabaş, B.; Çiftçi, E.; Yavuz, G.; Uysal, Z.; İnce, E.; Dolapçı, I.; Karahan, Z.C.; Pekpak, E.; Karbuz, A.; İnce, E. Effects of respiratory viruses on febrile neutropenia attacks in children. Turk. J. Pediatr. 2017, 59, 511–519. [Google Scholar] [CrossRef] [PubMed]
- Turhan, A.B.; Us, T.; Dinleyici, E.C.; Yildirim, G.K.; Kasifoglu, N.; Ozdemir, Z.C.; Bor, O. Assessment of respiratory tract viruses in febrile neutropenic etiology in children and comparison with healthy children with upper/lower respiratory tract infection. North Clin. Istanb. 2021, 8, 249–254. [Google Scholar] [PubMed]
- Schulz, E.; Grumaz, S.; Hatzl, S.; Gornicec, M.; Valentin, T.; Huber-Kraßnitzer, B.; Kriegl, L.; Uhl, B.; Deutsch, A.; Greinix, H.; et al. Pathogen detection by metagenomic next-generation sequencing during neutropenic fever in patients with hematological malignancies. Open Forum Infect. Dis. 2022, 9, ofac393. [Google Scholar] [CrossRef]
- Barnbrock, A.; Berger, A.; Lauten, M.; Demmert, M.; Klusmann, J.H.; Ciesek, S.; Bochennek, K.; Lehrnbecher, T. Frequency and clinical impact of viraemia in paediatric patients undergoing therapy for cancer. Sci. Rep. 2024, 14, 14867. [Google Scholar] [CrossRef]
- Ghebremedhin, B. Human adenovirus: Viral pathogen with increasing importance. Eur. J. Microbiol. Immunol. 2014, 4, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Webb, B.; Rakibuzzaman, A.G.M.; Ramamoorthy, S. Torque teno viruses in health and disease. Virus Res. 2020, 285, 198013. [Google Scholar] [CrossRef] [PubMed]
- Thijssen, M.; Devos, T.; Meyfroidt, G.; Van Ranst, M.; Pourkarim, M.R. Exploring the relationship between anellovirus load and clinical variables in hospitalized COVID-19 patients: Implications for immune activation and inflammation. IJID Reg. 2023, 9, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Gore, E.J.; Gard, L.; Niesters, H.G.M.; Van Leer Buter, C.C. Understanding torquetenovirus (TTV) as an immune marker. Front. Med. 2023, 10, 1168400. [Google Scholar] [CrossRef] [PubMed]
- Karavanaki, K.; Kossiva, L.; Sklavou, R.; Polychronopoulou, S.; Haliotis, F.; Papadatos, J. Infections in children with cancer: The role of the presence or absence of neutropenia. Pediatr. Emerg. Care 2021, 37, 148–153. [Google Scholar] [CrossRef] [PubMed]
- Leung, K.K.Y.; Ho, P.L.; Wong, S.C.Y.; Chan, W.Y.K.; Hon, K.L.E. Prevalence and outcomes of infections in critically-ill paediatric oncology patients: A retrospective observation study. Curr. Pediatr. Rev. 2024, 21, 174–185. [Google Scholar] [CrossRef] [PubMed]
- Boeriu, E.; Borda, A.; Vulcanescu, D.D.; Sarbu, V.; Arghirescu, S.T.; Ciorica, O.; Bratosin, F.; Marincu, I.; Horhat, F.G. Diagnosis and Management of Febrile Neutropenia in Pediatric Oncology Patients—A Systematic Review. Diagnostics 2022, 12, 1800. [Google Scholar] [CrossRef] [PubMed]
Group | Sample ID | Age (Years) | Clinical Diagnosis | Sex |
---|---|---|---|---|
Patients with febrile neutropenia | FN1 | 3 | ALL * B, CNS ** relapse | M ****** |
FN2 | 0.9 | ALL B, CNS infiltration, IKZ deletion | M | |
FN3 | 3 | ALL B | M | |
FN4 | 7 | Hodgkin’s lymphoma | M | |
FN5 | 2 | ALL B | M | |
FN6 | 4 | ALL B | M | |
FN7 | 8 | ALL | M | |
FN8 | 9 | Anaplastic large cell NHL *** | M | |
FN9 | 10 | Adrenal carcinoma | F ******* | |
FN10 | 11 | AML **** | F | |
FN11 | 4 | Langerhans cell histiocytosis | M | |
FN12 | 4 | Wilms tumor | F | |
FN13 | 1 | Infantile leukemia | M | |
FN14 | 13 | Congenital Dyskeratosis | M | |
FN16 | 4 | ALL B | M | |
Control group patients | FNC1 | 4 | Metastatic alveolar rhabdomyosarcoma | M |
FNC4 | 10 | Wilms tumor relapse | F | |
FNC5 | 15 | ITP ***** | F | |
FNC7 | 10 | ALL B | F | |
FNC8 | 4 | Ganglioneuroblastoma | F | |
FNC9 | 17 | Germ cell tumor | F | |
FNC10 | 7 | T-cell lymphoblastic lymphoma | M | |
FNC11 | 4 | Burkitt lymphoma | M | |
FNC12 | 15 | Osteosarcoma | M | |
FNC13 | 3 | Wilms tumor | M | |
FNC14 | 3 | Retinoblastoma | M | |
FNC15 | 12 | Ewing’s sarcoma | M | |
FNC17 | 7 | Hodgkin’s lymphoma | M | |
FNC19 | 8 | ALL | M | |
FNC21 | 2 | Right eye retinoblastoma, E group | M |
Virus | Primers and Probes | Sequence (5′-3′) | Concentration | Reference |
---|---|---|---|---|
Human Adenovirus | Forward primer (nested PCR, reaction 01) | GCCSCARTGGKCWTACATGCACATC | 500 nM | [28] |
Reverse primer (nested PCR, reaction 01) | GCCSCARTGGKCWTACATGCACATC | 500 nM | ||
Forward primer (nested PCR, reaction 02) | GCCCGYGCMACIGAIACSTACTTC | 500 nM | ||
Reverse primer (nested PCR, reaction 02) | CCYACRGCCAGIGTRWAICGMRCYTTGTA | 500 nM | ||
Herpes Simplex Virus 1 | Forward primer | CATCACCGACCCGGAGAGGGAC | 500 nM | [29] |
Reverse primer | GGGCCAGGCGCTTGTTGGTGTA | 500 nM | ||
Probe | FAM-CCGCCGAACTGAGCAGACACCCGCGC-TAMRA | 185 nM | ||
Human Cytomegalovirus | Forward primer | ACCGTCTGCGCGAATGTTA | 400 nM | [30] |
Reverse primer | TCGCAGATGAGCAGCTTCTG | 400 nM | ||
Probe | FAM-CACCCTGCTTTCCGAC-MGB | 200 nM | ||
Human Herpes Virus 6 | Forward primer | GAAGCAGCAATCGCAACACA | 400 nM | [31] |
Reverse primer | ACAACATGTAACTCGGTG-TACGGT | 400 nM | ||
Probe | FAM-AACCCGTGCGCCGCTCCC-TAMRA | 200 nM | ||
Human Herpes Virus 7 | Forward primer | CGGAAGTCACTGGAGTAATGACAA | 200 nM | [32] |
Reverse primer | ATGCTTTAAACATCCTTTCTTTCGG | 200 nM | ||
Probe | FAM-CTCGCAGATTGCTTGTTGGCCATG-TAMRA | 100 nM | ||
Malawi Polyomavirus | Forward primer | TGAGAAGGCCCCGGTTCT | 400 nM | [33] |
Reverse primer | GAGGATGGGATGAAGATTTAAGTTG | 400 nM | ||
Probe | FAM-CCTCATCACTGGGAGC-TAMRA | 200 nM | ||
Washington University Polyomavirus | Forward primer | CCTGTTAGTGATTTTCACCCATGTA | 400 nM | [34] |
Reverse primer | TGTCAGCAAATTCAGTAAGGCCTATATAT | 400 nM | ||
Probe | FAM-AAAGTTGTGTATTGGAAAGAACTGTTAGACA-TAMRA | 100 nM | ||
Epstein–Barr virus | Forward primer | TCAACCTCTTCCATGTCACTGAGA | 400 nM | [35] |
Reverse primer | TGGGTGAGCGGAGGTTAGTAA | 400 nM | ||
Probe | TCAGCCCCTCCACCAGTGACAATTC | 200 nM |
Total Sequences | Sequences After Trimming | Classified Sequences | Viral Sequences | Non-Classified Sequences | ||
---|---|---|---|---|---|---|
Patients with febrile neutropenia | Plasma | 522,460,676 | 410,262,663 | 182,791,640 | 11,622,377 (6.36%) | 13,662,778 |
Swab | 467,728,618 | 312,924,626 | 52,164,628 | 1,659,562 (0.53%) | 34,145,426 | |
Control patients | Plasma | 481,186,762 | 351,167,898 | 11,270,347 | 10,344,987 (2.95%) | 2,084,891 |
Swab | 524,541,576 | 346,599,742 | 54,706,463 | 12,425,412 (3.58%) | 49,774,976 | |
Total | 1,995,917,632 | 1,420,954,929 | 300,933,078 | 36,052,338 (11.98%) | 99,668,071 |
ID | Sample Type | Detected Virus * | Cycle Threshold | Raw Read Number |
---|---|---|---|---|
FN1 | Swab | Human herpesvirus 7 | 35.9 | 28 |
FN2 | Swab | Epstein–Barr virus | 33.4 | 27 |
FN5 | Plasma | Human cytomegalovirus | 36.99 | 7 |
Swab | Epstein–Barr virus | 31.81 | 2356 | |
Plasma | Epstein–Barr virus | 37.15 | 2 | |
Swab | Malawi polyomavirus | 25.98 | 3 | |
FN7 | Plasma | Cytomegalovirus | 34.64 | 296 |
FN10 | Swab | Human herpesvirus 6 | 36.95 | 7 |
Swab | Human herpesvirus 7 | 36.96 | 72 | |
FN12 | Swab | Human herpesvirus 7 | 36.02 | 6 |
FN13 | Swab | Human herpesvirus 6 | 34.38 | 2 |
FN14 | Swab | Epstein–Barr virus | 24.75 | 1,161,775 |
FN16 | Swab | Human herpesvirus 6 | 35.57 | 83 |
Swab | Human herpesvirus 7 | 34.68 | 1486 | |
Swab | Washington (WU) polyomavirus | 34 | 17 | |
FNC10 | Swab | Human herpesvirus 6 | 35.81 | 2 |
Swab | Human herpesvirus 7 | 33.61 | 9453 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sarana da Silva, A.; de Campos, G.M.; Altizani, G.M.; de Carvalho, E.; Barros, A.C.; Cella, E.; Kashima, S.; Sampaio, S.C.; Elias, M.C.; Giovanetti, M.; et al. Utilizing Viral Metagenomics to Characterize Pathogenic and Commensal Viruses in Pediatric Patients with Febrile Neutropenia. Viruses 2025, 17, 345. https://doi.org/10.3390/v17030345
Sarana da Silva A, de Campos GM, Altizani GM, de Carvalho E, Barros AC, Cella E, Kashima S, Sampaio SC, Elias MC, Giovanetti M, et al. Utilizing Viral Metagenomics to Characterize Pathogenic and Commensal Viruses in Pediatric Patients with Febrile Neutropenia. Viruses. 2025; 17(3):345. https://doi.org/10.3390/v17030345
Chicago/Turabian StyleSarana da Silva, Anielly, Gabriel Montenegro de Campos, Gabriela Marengone Altizani, Enéas de Carvalho, Alice Chagas Barros, Eleonora Cella, Simone Kashima, Sandra Coccuzzo Sampaio, Maria Carolina Elias, Marta Giovanetti, and et al. 2025. "Utilizing Viral Metagenomics to Characterize Pathogenic and Commensal Viruses in Pediatric Patients with Febrile Neutropenia" Viruses 17, no. 3: 345. https://doi.org/10.3390/v17030345
APA StyleSarana da Silva, A., de Campos, G. M., Altizani, G. M., de Carvalho, E., Barros, A. C., Cella, E., Kashima, S., Sampaio, S. C., Elias, M. C., Giovanetti, M., Scrideli, C. A., & Slavov, S. N. (2025). Utilizing Viral Metagenomics to Characterize Pathogenic and Commensal Viruses in Pediatric Patients with Febrile Neutropenia. Viruses, 17(3), 345. https://doi.org/10.3390/v17030345