Next Article in Journal
CCR5 Targeted Cell Therapy for HIV and Prevention of Viral Escape
Previous Article in Journal
Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 7
Issue 8
10.3390/v7082815
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

BnSGS3 Has Differential Effects on the Accumulation of CMV, ORMV and TuMV in Oilseed Rape

by
Quan Chen
1,2,
Jie Wang
1,
Mingsheng Hou
1,
Shengyi Liu
3,
Junyan Huang
3 and
Li Cai
1,*
1
College of Plant Science and Technology of Huazhong Agricultural University, Wuhan 430070, China
2
Xiaozhou Agricultural Service Center in Wanzhou District, Chongqing 404089, China
3
Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Key Laboratory of Biologyand Genetic Breeding of Oil Crops, the Ministry of Agriculture, Wuhan 430062, China
*
Author to whom correspondence should be addressed.
Viruses 2015, 7(8), 4169-4185; https://doi.org/10.3390/v7082815
Submission received: 26 April 2015 / Revised: 7 July 2015 / Accepted: 17 July 2015 / Published: 27 July 2015
(This article belongs to the Section Viruses of Plants, Fungi and Protozoa)
Browse Figures
Versions Notes

Abstract

:
Virus diseases greatly affect oilseed rape (Brassica napus) production. Investigating antiviral genes may lead to the development of disease-resistant varieties of oilseed rape. In this study, we examined the effects of the suppressor of gene silencing 3 in Brassica napus (BnSGS3, a putative antiviral gene) with different genus viruses by constructing BnSGS3-overexpressing (BnSGS3-Ov) and BnSGS3-silenced (BnSGS3-Si) oilseed rape (cv. Zhongshuang No. 6) plants. These three viruses are Oilseed rape mosaic virus (ORMV), Turnip mosaic virus (TuMV) and Cucumber mosaic virus (CMV). The native BnSGS3 expressed in all examined tissues with the highest expression in siliques. All three viruses induced BnSGS3 expression, but ORMV induced a dramatic increase in the BnSGS3-Ov plants, followed by TuMV and CMV. Upon inoculation with three different viruses, transcript abundance of BnSGS3 gene follows: BnSGS3-Ov > non-transgenic plants > BnSGS3-Si. The accumulation quantities of ORMV and TuMV exhibited a similar trend. However, CMV accumulation showed an opposite trend where virus accumulations were negatively correlated with BnSGS3 expression. The results suggest that BnSGS3 selectively inhibits CMV accumulation but promotes ORMV and TuMV accumulation. BnSGS3 should be used in different ways (up- and down-regulation) for breeding virus-resistant oilseed rape varieties.

1. Introduction

Virus disease, next to white mold caused by Sclerotinia sclerotiorum, is one of the most important yield-limiting diseases of oilseed rape production in China [1]. Turnip mosaic virus (TuMV, genus Potyvirus, family Potyviridae), Cucumber mosaic virus (CMV, genus Cucumovirus, family Bromoviridae) and Oilseed rape mosaic virus (ORMV, genus Tobamovirus, family Tobamoviridae) are the main viruses that infect oilseed rape in China [2]. However, to date, no oilseed rape varieties have been bred that are highly resistant to these virus diseases.
RNA silencing, including posttranscriptional gene silencing (PTGS), is an important mechanism of antiviral defense in plants [3,4,5]. In recent years, many studies in the mechanism and relevant antiviral plant genes are reported to search for new methods and resources in disease resistance breeding [4,6,7,8,9,10,11,12]. Suppressor of gene silencing 3 (SGS3) has antiviral activity [4,13,14] and specifically exists in plant functioning as a RNA-binding protein [15]. It has been showed in Arabidopsis that SGS3 is required for PTGS and natural virus resistance [4]. In the cytoplasm of plant cells, SGS3 stabilizes and recruits the viral single-stranded RNAs (ssRNAs) transcripts to RNA-dependent RNA polymerase 6 (RDR6) and RDR6 converts ssRNAs into double-stranded RNAs (dsRNAs) in SGS3/RDR6 bodies [16]. Next, Dicer-like 4 (DCL4) digests the dsRNAs into 21–24 nt primary small interfering RNAs (siRNAs) assisted by double-stranded-RNA-binding protein 4 (DRB4) and part of the dsRNAs are processed into secondary siRNAs by DCL2. These two classes of siRNAs are protected from degradation aided by HUA ENHANCER 1 (HEN1) and then are combined onto the Argonaute 1/2 (AGO1/AGO2) protein and RNA-induced silencing complexes (RISCs) to silence the complementary viral RNAs [3,4,5,9,15,17,18,19]. Furthermore, SGS3 can also function in controlling other kinds of RNA silencing such as those induced by sense transgenes (S-PTGS) [20] or DNA virus-induced gene silencing (VIGS) [21].
CMV, TuMV and Turnip vein-cleaning virus (TVCV) have different degrees of inhibitory effects on PTGS [4]. CMV can only partially inhibit PTGS and produces only a little amount of CMV virus RNA in Arabidopsis L1 plants, which is significantly lower than that in sgs3 mutants. On the contrary, TuMV and TVCV completely inhibit PTGS. As a result, these two viruses accumulated to equally high levels in the sgs3 mutants and L1 plants [4]. These results indicate that the PTGS-mediated resistance efficiency on virus infection is related to the inhibitory capability of virus to PTGS.
SGS3 is an essential component of PTGS and closely associated with plant virus resistance. So far, however, the function of SGS3 in oilseed rape has not been reported. Little is known about the expression of SGS3 in oilseed rape or the interaction between major viruses of oilseed rape and SGS3. In this study, we investigated the expression pattern of the suppressor of gene silencing 3 in Brassica napus (designated BnSGS3, accession number KP292910) in various oilseed rape tissues. Furthermore, we generated transgenic oilseed rape plants with overexpressed (BnSGS3-Ov) and silenced (BnSGS3-Si) levels of BnSGS3. Using these transgenic plants upon inoculation with three different viruses (ORMV, TuMV and CMV), our results reveal that CMV accumulation was negatively correlated with expression levels of BnSGS3, whereas accumulations of both TuMV and ORMV were positively correlated with expression levels of BnSGS3, suggesting that BnSGS3 selectively inhibits CMV accumulation, but promotes TuMV and ORMV accumulation.

2. Results

2.1. Sequence Comparison and Phylogenetic Analysis of SGS3 Genes in Different Hosts

According to report, SGS3 contains three conservative functional domains: The zinc finger (ZF) domain, the rice gene X and SGS3 (XS) domain and the coiled-coil (CC) domain [16,22,23,24]. The XS domain is a single-stranded RNA-binding domain [22], while the CC domain is related to homodimer formation and the movement of SGS3/RDR6-bodies [16,24]. The N-terminal ZF domain of potato SGS3 was recently shown to control SGS3 location and be the main determinant of the interaction with the viral genome-linked protein (VPg) of Potato virus A (PVA) [13]. In this study, a cDNA encoding a homolog of AtSGS3 was cloned from Brassica. napus cv. Zhongshuang No.6. The entire open reading frame (ORF) of the cloned cDNA encodes a protein of 607 amino acid residues that exhibit 72.6% identity with AtSGS3 (AF239719). Similar to AtSGS3, the protein sequence contains three conserved domains: ZF domain, XS domain and CC domain, which shared, respectively, 93.3%, 78.3% and 73.3% identity with these domains of AtSGS3. Thus, the cloned cDNA was designated as BnSGS3 (GenBank accession no. KP292910).
Analysis of phylogenetic relationships would help provide initial insights into degree of structural and functional conservation. Several plant SGS3 genes, initiated from Arabidopsis thaliana (AtSGS3) [4], Solanum lycopersicum (SlSGS3) [25], Oryza sativa (OsSGS3) [26], and Nicotiana tabacum (NtSGS3) [27] were implicated in plant viral resistance. Based on alignments, neighbor-joining tree of SGS3 nucleotide sequences was generated (Figure 1). Results showed that there were three distinct clusters of these SGS3 genes. The homology was 55.1%–81.0% between BnSGS3 and other SGS3 genes. BnSGS3 was more closely related to AtSGS3 but distantly to those of N. tabacum, S. lycopersicum and O. sativa. BnSGS3 and AtSGS3 belonged to one cluster and they shared the highest homology of 81.0%. The difference between them might relate to the potentially resistance to different viruses.
Viruses 07 02815 g001 1024
Figure 1. Phylogenetic analysis of the suppressor of gene silencing 3 in Brassica napus (BnSGS3) and other published SGS3 genes involved in plant viral resistance based on the entire open reading frame (ORF) nucleotide sequence. The neighbor-joining tree was generated with the DNAMAN 6.0.4 and Mega 5.0. The significance of the branching order was assessed by bootstrap resampling of 1000 replicates. Values are indicated at the forks. The scale bar corresponds to a 5% difference.
Figure 1. Phylogenetic analysis of the suppressor of gene silencing 3 in Brassica napus (BnSGS3) and other published SGS3 genes involved in plant viral resistance based on the entire open reading frame (ORF) nucleotide sequence. The neighbor-joining tree was generated with the DNAMAN 6.0.4 and Mega 5.0. The significance of the branching order was assessed by bootstrap resampling of 1000 replicates. Values are indicated at the forks. The scale bar corresponds to a 5% difference.
Viruses 07 02815 g001

2.2. BnSGS3 Expression in Transgenic and Non-Transgenic Plants of Oilseed Rape

Quantitative RT-PCR (qRT-PCR) was used to detect the expression levels of endogenous BnSGS3 in different tissues of oilseed rape (B. napus cv. Zhongshuang No. 6). When the expression level of BnSGS3 in roots was designated to be 1, the relative expression level in each tissue from high to low followed: Siliques (2.81), flowers (2.05), leaves (1.68), stems (1.64) and roots. The relative expression of BnSGS3 in roots was only 35% of that in siliques (Figure 2).
Viruses 07 02815 g002 1024
Figure 2. Relative expression levels of BnSGS3 in different tissues of oilseed rape.
Figure 2. Relative expression levels of BnSGS3 in different tissues of oilseed rape.
Viruses 07 02815 g002
To further functionally characterize BnSGS3, we produced transgenic oilseed plants. BnSGS3 overexpression vector (BnSGS3-Ov) containing a Cauliflower mosaic virus (CaMV) 35S enhancer, double CaMV 35S promoters, an Ω sequence (to improve protein translation), the BnSGS3 cDNA, and a CaMV Nos terminator within the T-DNA region (Supplementary Figure S1A). BnSGS3 silenced vector (BnSGS3-Si) containing the CaMV 35S promoter, BnSGS3 sense and antisense repetitive sequences, a Pdk intron and an OCS terminator (Supplementary Figure S1B). These two vectors, each with the pSoup helper plasmid were transformed into the Agrobacterium tumefaciens GV3101, which was in turn used to transform oilseed rape cv. Zhongshuang No.6.
A total of 58 transgenic oilseed rape plants were confirmed by PCR, including 33 BnSGS3-Ov and 25 BnSGS3-Si transgenic plants. The relative transcript levels of BnSGS3 in randomly selected 22 plants were determined by qRT-PCR. The results showed that the relative transcript levels of BnSGS3 among transgenic BnSGS3-Ov and BnSGS3-Si plants were 144%–581% and 13%–71% of the non-transgenic plants, respectively, indicating that BnSGS3 expression increased in the BnSGS3-Ov plants but was suppressed in the BnSGS3-Si plants (Figure 3).
Viruses 07 02815 g003 1024
Figure 3. Relative expression levels of BnSGS3 in single BnSGS3-overexpressing (BnSGS3-Ov) oilseed rape plants (1–11), non-transgenic oilseed rape plant (12) and single BnSGS3-silenced (BnSGS3-Si) oilseed rape plants (13–23).
Figure 3. Relative expression levels of BnSGS3 in single BnSGS3-overexpressing (BnSGS3-Ov) oilseed rape plants (1–11), non-transgenic oilseed rape plant (12) and single BnSGS3-silenced (BnSGS3-Si) oilseed rape plants (13–23).
Viruses 07 02815 g003

2.3. Dynamics of BnSGS3 Expression in T0 Generation Transgenic and Non-Transgenic Plants of Oilseed Rape after Viral Infection

To test the effects of BnSGS3 expression and the accumulation of viruses, each 50 ng of purified ORMV (Tobamovirus, subgroup III strain), TuMV (Potyvirus, MB cluster strain) and CMV (Cucumovirus, subgroup I strain) viruses were, respectively, inoculated onto five T0 generation transgenic and non-transgenic plants at the four-leaf-stage. Analyses of the changes in expression of BnSGS3 after inoculation showed that all three viruses induced the expression of BnSGS3 in both transgenic and non-transgenic oilseed rape. Generally, the expression of BnSGS3 first increased and then dropped (Figure 4). In all three viruses’ inoculation treatments, transcript levels of BnSGS3 in overexpressing T0 generation plants were significantly greater than those in the non-transgenic and BnSGS3 silenced plants while expression in the non-transgenic plants was slightly higher than that in the silenced plants. In BnSGS3-overexpressing plants upon virus inoculation, three viruses showed different induction on BnSGS3 expression, most efficiently by ORMV followed by TuMV and CMV, while the inductive effect of CMV on BnSGS3 expression was slightly stronger than those by ORMV and TuMV in BnSGS3-Si transgenic and non-transgenic plants. These results suggest that in both transgenic and non-transgenic plants of oilseed rape, all three viruses ORMV, TuMV and CMV were able to induce expression of BnSGS3, but induction capability is different.
Viruses 07 02815 g004 1024
Figure 4. Dynamic expression of BnSGS3 induced by (A) Oilseed rape mosaic virus (ORMV); (B) Turnip mosaic virus (TuMV) and (C) Cucumber mosaic virus (CMV) in the transgenic and non-transgenic plants. The expression level of BnSGS3 in non-transgenic plants uninoculated was designated to be 1.
Figure 4. Dynamic expression of BnSGS3 induced by (A) Oilseed rape mosaic virus (ORMV); (B) Turnip mosaic virus (TuMV) and (C) Cucumber mosaic virus (CMV) in the transgenic and non-transgenic plants. The expression level of BnSGS3 in non-transgenic plants uninoculated was designated to be 1.
Viruses 07 02815 g004

2.4. Effect of BnSGS3 on the Accumulation of ORMV, TuMV and CMV

A diluted concentration gradient of the plasmid containing viral CP gene fragments was subjected to qRT-PCR amplification. The Ct values of a gradient of viral plasmid concentrations were used for the Y-axis, and logarithm (log10) values of the copy number (copies/μL) were used for the X-axis to construct a standard curve (Supplementary Figure S2). The results showed that the amplification efficiency (E) of ORMV, TuMV, and CMV viral plasmids was 86.2%, 88.7% and 84.9%, respectively, and R2 was greater than 0.99, indicating that there was a good linear relationship between Ct values and the logarithm of the copy numbers and the standard curves were appropriate for calculation of virus quantity.
To investigate whether the BnSGS3 expression effect the viral accumulation, five T0 generation transgenic and non-transgenic plants were inoculated with 50 ng of the purified ORMV, TuMV and CMV particles at the four-leaf-stage. The viral accumulation was measured in 0–24 days of post-inoculation (dpi) at intervals of three days. After inoculation of BnSGS3-Ov, oilseed rape plants with ORMV and TuMV, virus levels first increased and then decreased, reaching peak values of 8.05 × 104 copies and 4.47 × 104 copies at 12 dpi, respectively. In non-transgenic oilseed rape, the virus levels initially increased, reaching peak values of 3.52 × 104 copies and 2.77 × 104 copies at 15 and 12 dpi, respectively, followed by a decrease. However, in BnSGS3-Si oilseed rape inoculated with ORMV and TuMV, the virus levels reached peak values of 1.82 × 104 copies and 1.14 × 104 copies at 18 and 15 dpi, respectively. These results demonstrate that the quantities of ORMV and TuMV exhibited a trend: BnSGS3-Ov plants > non-transgenic plants > BnSGS3-Si plants (Figure 5A,B), consistent with BnSGS3 expression levels in these type plants.
The replication rate of CMV in BnSGS3-Ov plants was small and its accumulation levels were low, reaching a peak of 1.50 × 103 copies at 24 dpi, and the amplitude of variation of qRT-PCR throughout the entire test time course was small. In inoculated non-transgenic and BnSGS3-Si plants, increase of CMV levels was relatively quick, reaching a peak of 1.48 × 104 copies and 2.34 × 104 copies at 3 dpi, respectively. The levels fluctuated a bit, but the changes were small (Figure 5C). In non-transgenic oilseed rape, CMV levels were much higher with 1.5 × 104 copies than that of ORMV at 3 dpi and afterwards virus quantities were ORMV > TuMV > CMV. The general trend of CMV accumulation was the BnSGS3-Si > non-transgenic plants > BnSGS3-Ov, in contrary to both the induction expression trend of BnSGS3 and the accumulation trends of ORMV and TuMV. Furthermore, virus accumulation of ORMV and TuMV in the BnSGS3-Ov are drastically higher than that of CMV at 6 dpi and afterwards.
Viruses 07 02815 g005a 1024Viruses 07 02815 g005b 1024
Figure 5. Accumulation of ORMV (A); TuMV (B) and CMV (C) in the transgenic and non-transgenic oilseed rape plants.
Figure 5. Accumulation of ORMV (A); TuMV (B) and CMV (C) in the transgenic and non-transgenic oilseed rape plants.
Viruses 07 02815 g005aViruses 07 02815 g005b

2.5. Correlation between BnSGS3 Expression and Virus Accumulation

SPSS17.0 statistical software was used to analyze the relationship between virus accumulation and BnSGS3 expression levels in transgenic and non-transgenic oilseed rape. There was a positive and significant (p < 0.01 or 0.05) linear correlation between the accumulation of ORMV and TuMV (in transgenic and non-transgenic plants) and BnSGS3 expression (Figure 6A–F). However, the relationship between CMV accumulation and BnSGS3 expression in transgenic and non-transgenic oilseed rape exhibited a negative and significant (p < 0.01 or 0.05) linear correlation (Figure 6G–I). These results indicated that the expression of BnSGS3 promoted the accumulation of ORMV and TuMV but suppressed CMV accumulation.
Viruses 07 02815 g006a 1024Viruses 07 02815 g006b 1024
Figure 6. Relationship between the accumulation level of ORMV (A–C), TuMV (D–F) or CMV (G–I) and the expression quantity of BnSGS3 in BnSGS3-Ov (A,D,G), non-transgenic (B,E,H) and BnSGS3-Si (C,F,I) plants.
Figure 6. Relationship between the accumulation level of ORMV (A–C), TuMV (D–F) or CMV (G–I) and the expression quantity of BnSGS3 in BnSGS3-Ov (A,D,G), non-transgenic (B,E,H) and BnSGS3-Si (C,F,I) plants.
Viruses 07 02815 g006aViruses 07 02815 g006b

3. Discussion

In this study, we first reported the oilseed rape SGS3 gene (BnSGS3) and determined the relationship between the BnSGS3 expression and the virus accumulation of ORMV, TuMV and CMV, which are the main viruses that infect oilseed rape. For ORMV and TuMV, after inoculation of transgenic and non-transgenic oilseed rape plants, differences in the induced expression of BnSGS3 were significant. The higher the level of BnSGS3 expression was, the higher the corresponding accumulation of ORMV and TuMV was. Furthermore, in BnSGS3-Si plants, the expression of BnSGS3 was low, and the virus accumulation was also low. Correlation analysis showed that there was a positive linear correlation between the two (Figure 6A–F). Similar phenomenon was observed in PVA and Soybean mosaic virus (SMV). A study of the interaction between PVA VPg protein and potato SGS3 (StSGS3) revealed that the accumulation of PVA in StSGS3-overexpressing plants was higher than in StSGS3-silenced plants [13]. Likewise, there is a lower level of SMV strain G7 RNA in the Glycine max SGS3 (GmSGS3)-silenced soybean than non-silenced plants. The resulting severity of lethal systemic hypersensitive response (LSHR) in GmSGS3-silenced soybean was also alleviated [14].
In our research, we found that the accumulation of ORMV and TuMV increased accompanied by the up-regulated expression of BnSGS3, suggesting that these two viruses can successfully inhibit RNA silencing in plants [28]. So far, many viruses have been reported to have this function [29,30,31,32,33], which may be relevant to the virus suppressors of RNA silencing (VSRs). Among these VSRs, HC-Pro protein encoded by potyviruses (TuMV also encodes this HC-Pro) is a highly effective VSR that not only inhibits silencing but can also reverse an already established RNA silencing [34,35]. The expression of HC-Pro does not inhibit the production of a systemic silencing signal but prevents the accumulation of the siRNAs [36]. In Tobamovirus (ORMV is included in this category), both P126 of Tobacco mosaic virus (TMV) [5] and 130k of Tomato mosaic virus (ToMV) [37] can function as VSRs to prevent RNA silencing. Therefore, BnSGS3 may have a role in ORMV and TuMV accumulation effect through closely linked to VSRs. Since SGS3 stabilizes the viral ssRNA transcripts toRDR6 [16], it is possible that these two viruses’ VSRs directly or indirectly interact with BnSGS3 and recruit BnSGS3 to protect viral RNA from degradation [13,15,21,25,26,38]. Alternatively, the VSRs prevent BnSGS3 from binding and accessing their common substrate RNAs, which lead to inhibition of RNA silencing [15]. Another possibility is that the accumulation differences may be induced by interference in the amplification step of RNA silencing via a yet-unidentified mechanism [13]. Many studies have reported that sense-mediated RNA silencing may interlink with other RNA quality control systems [11,16,39]. Therefore, it is possible that TuMV and ORMV encoding VSRs interact with BnSGS3 in both RNA silencing and other interlinked RNA quality control systems, which also need BnSGS3 to inhibit RNA silencing.
By contrast, the accumulation level of CMV in different oilseed rape plants was differed from ORMV and TuMV. The peak value of CMV accumulation in various plants exhibited the trend BnSGS3-Si (2.34 × 104) > non-transgenic oilseed rape (1.48 × 104) > BnSGS3-Ov (1.50 × 103; Figure 5C). The opposite trend was observed for CMV-induced BnSGS3 expression. Therefore, the higher the level of BnSGS3 expression was, the lower the level of CMV was. Correlation analysis revealed a negative linear correlation between the two factors (Figure 6G–I). Previous studies also showed 5-fold over accumulation of CMV RNA in sgs3 mutant [4] and CMV 2b deficient mutant failed to infect wild-type Arabidopsis but was highly virulent in sgs3 mutant [40], which suggested that the CMV 2b protein did not target the silencing mechanism in the same way with HC-Pro [30,31]. During infection, CMV 2b directly interacted with AGO1 and specifically inhibited its slicing activity [41,42,43,44]. Since AGO1 was dispensable for RDR-dependent production of CMV secondary siRNAs, which revealed that the antiviral pathway might differ from the trans-acting siRNAs (tasiRNAs) pathway [5]. Thinking of our results, excepting BnSGS3, there may also be one or more RNA silencing genes, such as RDR6 or AGO1, essential for silencing amplification, contribute to the biosynthesis of CMV secondary siRNAs. In a word, the CMV accumulation effect suggests that there is a work way differs from TuMV and ORMV, and the CMV accumulation strategy has some intimate relationships with BnSGS3, RDR6 and AGO1, but the exact mechanism needs to be further studied.
In summary, the effects of BnSGS3 expression on the accumulation of ORMV, TuMV and CMV in oilseed rape are different. BnSGS3 may promote ORMV and TuMV accumulation, but inhibit CMV accumulation, suggesting different strategies for use of SGS3 (up- and down-regulation) for breeding resistant oilseed rape against various viral diseases.

4. Materials and Methods

4.1. Plant Materials

Oilseed rape (Brassica napus) cv. Zhongshuang No. 6, which is low susceptible to the viruses, was used for virus inoculation and for the analysis of BnSGS3 expression in this study. Oilseed rape seedlings were grown in the greenhouse with a light/dark cycle of 14/10 h at 22 °C (D)–24 °C (L). The humidity in the greenhouse was 50%–70%.

4.2. Sequence Analysis of BnSGS3 and Vector Construction

The primers used in this study are shown in Table 1. For BnSGS3 cDNA amplification, total RNA of B. napus leaves was extracted by using total RNA kit I (OMEGA, Norcross, GA, USA), and 1 μg RNA was reverse transcribed to cDNA (RevertAid First Strand cDNA Synthesis Kit, Thermo, Waltham, MA, USA). A 1974 bp cDNA containing the entire open reading frame (ORF) of BnSGS3 was PCR amplified from its cDNA with primers Bn-F1 and Bn-R1. Software DNAMAN6.0.4 and Mega5.0 were used for sequence alignments and generated a neighbor-joining tree.
To construct a vector for constitutive expression of BnSGS3, the vector pG4A was generated by inserting a fragment from pTΩ4A containing a CaMV 35S enhancer, double CaMV 35S promoters, and a CaMV Nos terminator into the KpnI-NotI site of pGreen0229 containing a bar gene within the T-DNA region for selecting transgenic plants. A 1848 bp fragment containing the entire ORF segment of BnSGS3 was PCR amplified from its cDNA clone with primers Bn-F2 and Bn-R2, and inserted into the multiple cloning sites (XhoI) of pG4A, creating a BnSGS3 overexpressing vector BnSGS3-Ov (Figure S1A).
Vectors pGreen0229 and pKANNIBAL were used as primary and intermediate vectors to construct the BnSGS3 silenced vector. A 404-bp BnSGS3 sense (amplified by BnRI-C and BnRI-KC, containing XhoI and EcoRI sites) and antisense (amplified by BnRI-A and BnRI-E, containing XbaI and HindIII sites) fragments were inserted into both ends of pKANNIBAL Pdk introns. Then, Not I was used to extract the product containing the CaMV 35S promoter, BnSGS3 sense and antisense repetitive sequence, Pdk intron and OCS terminator from pKANNIBAL, and inserted into the Not I site of pGreen0229, creating a BnSGS3 silenced vector BnSGS3-Si (Figure S1B).
All the inserted sequences were confirmed by enzyme digestion and sequencing. The resulting BnSGS3-Ov and BnSGS3-Si vectors together with the pSoup helper plasmid [45,46] were transformed into the Agrobacterium tumefaciens GV3101 by electroporation for plant transformation.
Table
Table 1. List of primers.
Table 1. List of primers.
PrimerSequence (5′-3′)Tm (°C)Product (bp)
BnSGS3 cDNA amplification
Bn-F1TGAGGTTCTGGACAGGGATC551974
Bn-R1GCCGTCTTACTGAAAATGGA
Vector construction
Bn-F2GTACTCGAGGTTTGCTCTCTGTTTGGTT551848
Bn-R2CGTCTCGAGGCTAGTAGTCTTCTGTGTC
BnRI-CTATACTCGAGCAGTGGAAGGGTTTGGGTG54404
BnRI-KCGCCCGAATTCTCCCTACTTGACAGTGTTG
BnRI-ACGAATCTAGACAGTGGAAGGGTTTGGGTG54404
BnRI-EGCCGAAGCTTTCCCTACTTGACAGTGTTG
Detection of expression quantity
Bn-FTGGAAGGGTTTGGGTGAGGAG62181
Bn-RGTGGACCATAGGAGTGGCGTG
Actin-FCTGGAATTGCTGACCGTATGAG62145
Actin-RATCTGTTGGAAAGTGCTGAGGG
Bar-FTGCCAGAAACCCACGTCAT55485
Bar-RCTGCACCATCGTCAACCACTA
Detection of virus accumulation
CMV-FCCTCACCGGTACTGGTTTATC62107
CMV-RCTTTCGCATGTCGCCAATATC
TuMV-FGGAAGTAAACGCTGGAACCT6296
TuMV-RGCCACTCTTTGCTCGTATCT
ORMV-FCTGTGGCCATTAGGAGTCAA62108
ORMV-RGCGCAGTAGTCCAAGGTAATA

4.3. Production of BnSGS3-Ov and BnSGS3-Si Brassica napus Transformants

Brassica napus cv. Zhongshuang No. 6 was transformed using an improved transformation method based on the method of Liu et al. [47]. Rapeseeds were soaked in 5% sodium hypochlorite for 3–5 min and plated onto M0 medium (1/2MS). After 6 days of cultivation in the dark, the hypocotyledonary axis of each seedling was co-cultured with A. tumefaciens liquid culture containing the BnSGS3-Ov or BnSGS3-Si plasmids for 30 min. The hypocotyledonary axes were then transferred to M1 medium (MS + 30 g/L sucrose + 18 g/L mannitol + 1 mg/L 2,4-D + 0.3 mg/L kinetin + 100 μM acetosyringone + 8.5 g/L agarose, pH 5.8) and cultured in the dark at 24 °C for 2–3 days, followed by culture on M2 medium (MS + 30 g/L sucrose + 18 g/L mannitol + 1 mg/L 2,4-D + 0.3 mg/L kinetin + 20 mg/L AgNO3 + 8.5 g/L agarose + 25 mg/L kanamycin + 250 mg/L carbenicillin, pH 5.8) at 24 °C for 3 weeks. Hypocotyl callus was then transferred to M3 medium (MS + 10 g/L glucose + 0.25 g/L xylose + 0.6 g/L MES hydrate + 2 mg/L zeatin + 0.1 mg/L indole-3-acetic acid + 8.5 g/L agarose + 25 mg/L kanamycin + 250 mg/L carbenicillin, pH 5.8) and subcultured once every 3 weeks until the emergence of green shoots, which were cultured on M4 medium (MS + 10 g/L sucrose + 10 g/L agar, pH 5.8) for 3–4 weeks for rooting.
Primers Bar-F and Bar-R (see Table 1) were utilized to identify transgenic plants. Each transgenic plant was used to produce at least three plants, which were used as materials in independent repeated trials. The plants were transplanted into pots at the 3-leaf-stage and grown in the greenhouse as described above.

4.4. Virus Purification and Inoculation

ORMV (Tobamovirus, subgroup III strain), TuMV (Potyvirus, MB cluster strain) and CMV (Cucumovirus, subgroup I strain) were originally isolated from systemically infected oilseed rape (B. napus L. var. oleifera) in Hubei Province, China. Chinese cabbage (Brassica rapa) was used to grow and multiply these viruses by mechanical inoculation [48]. Three to four weeks post-inoculation, young emerging leaves of infected plants were harvested. Virus purification was performed as described by Aguilar et al. [49]. About 50 ng of the purified ORMV, TuMV or CMV particles were mechanically inoculated [48] onto the leaves of transgenic T0 generation and non-transgenic oilseed rape plants at the 4-leaf-stage. Each virus was inoculated onto five plants of each type, with two independent biological replications. Thirty plants were inoculated per BnSGS3-Ov, BnSGS3-Si and non-transgenic oilseed rape plants.

4.5. Sample Collection and RNA Extraction

To detect differences in BnSGS3 expression in different tissues of oilseed rape and in each transgenic T0 generation plant, the tender roots, stems, leaves, flowers and siliques of oilseed rape and the tender leaves of each transgenic plant were collected at the same time. After inoculation with one of three types of virus, 0, 3, 6, 9, 12, 15, 18, 21 and 24 days post-inoculation (dpi, as well as the uninoculated control), tender leaves from the upper parts of plants were used to detect virus-induced BnSGS3 expression and the amount of virus accumulation. Total RNA was extracted from the above samples (E.Z.N.A. Total RNA Kit I, OMEGA, Norcross, GA, USA), and 1 μg RNA was reverse transcribed to cDNA (RevertAid First Strand cDNA Synthesis Kit, Thermo, Waltham, MA, USA).

4.6. Quantitative RT-PCR

Quantitative RT-PCR (qRT-PCR) was performed to detect the expression levels of BnSGS3 in different tissues of non-transgenic oilseed rape plants, single transgenic plants and the virus-inoculated plants. Primers Actin-F and Actin-R were used to amplify the reference β-Actin gene (AF111812), and primers Bn-F and Bn-R were used to amplify BnSGS3 (all primers are listed in Table 1). The relative transcript levels of BnSGS3 2−ΔΔCt were obtained by calculating ΔCt values [∆Ct = Ct(BnSGS3)-Ct(Actin)].
qRT-PCR was also used to detect the accumulation of three viruses (by copy number) in the samples. Primers ORMV-F/R, CMV-F/R and TuMV-F/R were used to amplify CP gene fragments of the three viruses via PCR. The PCR products were ligated to pMD-18T, which was transformed into E. coli DH5α, and plasmid DNA was subsequently extracted (TIANprep Mini Plasmid Kit, TIANGEN). The molecular weights of the ORMV, TuMV and CMV plasmids were 1,730,750.4 Da, 1,730,135 Da and 1,723,338.6 Da, respectively. The copy number of 1 μL plasmids was calculated according to Avogadro’s formula “6.022 × 1023 molecules/moL”, and the plasmids were diluted to 1.0 × 109–1.0 × 103 copies/μL concentration gradient, with three repeats per gradient, which were simultaneously subjected to qRT-PCR [50,51]. The copy numbers of the three viruses in different samples were automatically calculated based on the sample Ct values and the standard curve.
Two independent biological replicates and three technical replicates were carried out for the inoculation experiment for each virus, taking the average value of two sets of data. qRT-PCR was performed on the BioRad CFX96 Real-Time System (C1000 Thermal Cycler). The reaction system included 10 μL SYBR Green PCR Master Mix, 0.5 μL of each upstream and downstream primer (10 μmol/L), 1 μL cDNA and 8 μL ddH2O. The reaction conditions were as follows: 95 °C for 3 min, 95 °C for 10 s, 62 °C for 30 s, 72 °C for 15 s (40 cycles), and 65 °C for 5 s.

4.7. Correlation Analysis of Virus Accumulation vs. BnSGS3 Expression

SPSS17.0 statistical software and Pearson’s two-sided test were used to analyze whether there was a correlation between the accumulation of three types of viruses and BnSGS3 expression levels, as well as the level of significance.

Supplementary Files

Supplementary File 1

Acknowledgments

This work was supported by the National Natural Science Foundation of China (grant numbers 31201500 and 31471536) and the Special Fund for Agro-scientific Research in the Public Interest (grant number 201303028). We thank the Department of Genomics, Oil Crops Research Institute, Chinese Academy of Agricultural Sciences for kindly providing pGreen0229, pSoup helper plasmid, pTΩ4A and pKANNIBAL plasmids.

Author Contributions

L.C., M.H. and S.L. conceived and designed the experiments; Q.C., J.H. and J.W. performed the experiments; and Q.C. and L.C. analyzed the data and wrote the paper. All authors have read and approved the final manuscript.

Conflict of Interests

The authors declare no conflict of interest.

References

  1. Music, M.S.; Nguyen, H.D.; Cerni, S.; Mamula, E.; Ohshima, K.; Skoric, D. Multilocus sequence analysis of “Candidatus Phytoplasma asteris” strain and the genome analysis of turnip mosaic virus co-infecting oilseed rape. J. Appl. Microbiol. 2014, 117, 774–785. [Google Scholar]
  2. Cai, L.; Chen, K.R.; Zhang, X.J.; Yan, L.Y.; Hou, M.S.; Xu, Z.Y. Biological and molecular characterization of a crucifer tobamovirus infecting oilseed rape. Biochem. Genet. 2009, 47, 451–461. [Google Scholar]
  3. Vaucheret, H.; Béclin, C.; Fagard, M. Post-transcriptional gene silencing in plants. J. Cell Sci. 2001, 114, 3083–3091. [Google Scholar]
  4. Mourrain, P.; Béclin, C.; Elmayan, T.; Feuerbach, F.; Godon, C.; Morel, J.B.; Jouette, D.; Lacombe, A.M.; Nikic, S.; Picault, N.; et al. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 2000, 101, 533–542. [Google Scholar]
  5. Pumplin, N.; Voinnet, O. RNA silencing suppression by plant pathogens: Defence, counter-defence and counter-counter-defence. Nat. Rev. Microbiol. 2013, 11, 745–760. [Google Scholar]
  6. Masson, I.L.; Jauvion, V.; Bouteiller, N.; Rivard, M.; Elmayan, T.; Vaucheret, H. Mutations in the Arabidopsis H3K4me 2/3 demethylase JMJ14 suppress posttranscriptional gene silencing by decreasing transgene transcription. Plant Cell 2012, 24, 3603–3612. [Google Scholar]
  7. Butaye, K.M.; Goderis, I.J.; Wouters, P.F.; Pues, J.M.; Delaure, S.L.; Broekaert, W.F.; Depicker, A.; Cammue, B.P.; de Bolle, M.F. Stable high-level transgene expression in Arabidopsis thaliana using gene silencing mutants and matrix attachment regions. Plant J. 2004, 39, 440–449. [Google Scholar]
  8. Zheng, Z.M.; Xing, Y.; He, X.J.; Li, W.B.; Hu, Y.L.; Yadav, S.K.; Oh, J.E.; Zhu, J.K. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis. Plant J. 2010, 62, 92–99. [Google Scholar] [PubMed]
  9. Vance, V.; Vaucheret, H. RNA silencing in plants-defense and counterdefense. Science 2001, 292, 2277–2280. [Google Scholar] [PubMed]
  10. Morel, J.B.; Godon, C.; Mourrain, P.; Béclin, C.; Boutet, S.; Feuerbach, F.; Proux, F.; Vaucheret, H. Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in post-transcriptional gene silencing and virus resistance. Plant Cell 2002, 14, 629–639. [Google Scholar] [PubMed]
  11. Moreno, A.B.; Alba, A.E.M.; Bardou, F.; Crespi, M.D.; Vaucheret, H.; Maizel, A.; Mallory, A.C. Cytoplasmic and nuclear quality control and turnover of single-stranded RNA modulate post-transcriptional gene silencing in plants. Nucleic Acids Res. 2013, 10, 1–10. [Google Scholar]
  12. Maine, E.M. A conserved mechanism for post-transcriptional gene silencing? Genome Biol. 2000, 3, 1–4. [Google Scholar]
  13. Rajamäki, M.L.; Streng, J.; Valkonen, J.P.T. Silencing suppressor protein VPg of a potyvirus interacts with the plant silencing-related protein SGS3. Mol. Plant Microbe. Interact. 2014, 27, 1199–1210. [Google Scholar] [PubMed]
  14. Chen, H.; Zhang, L.R.; Yu, K.F.; Wang, A. Pathogenesis of Soybean mosaic virus in soybean carrying Rsv1 gene is associated with miRNA and siRNA pathways, and breakdown of AGO1 homeostasis. Virology 2015, 476, 395–404. [Google Scholar] [PubMed]
  15. Fukunaga, R.; Doudna, J.A. dsRNA with 5′overhangs contrebutes to endogenous and antiviral RNA silencing pathways in plants. EMBO J. 2009, 28, 545–555. [Google Scholar] [CrossRef] [PubMed]
  16. Kumakura, N.; Takeda, A.; Fujioka, Y.; Motose, H.; Takano, R.; Watanabe, Y. SGS3 and RDR6 interact and colocalize in cytoplasmic SGS3/RDR6-bodies. FEBS Lett. 2009, 583, 1261–1266. [Google Scholar] [CrossRef] [PubMed]
  17. Hamilton, A.; Voinnet, O.; Chappell, L.; Baulcombe, D. Two classes of short interfering RNA in RNA silencing. EMBO J. 2002, 21, 4671–4679. [Google Scholar] [CrossRef] [PubMed]
  18. Boutet, S.; Vazquez, F.; Liu, J.; Béclin, C.; Fagard, M.; Gratias, A.; Morel, J.B.; Crete, P.; Chen, X.M.; Vaucheret, H. Arabidopsis HEN1: A genetic link between endogenous miRNA controlling development and siRNA controlling transgene silencing and virus resistance. Curr. Biol. 2003, 13, 843–848. [Google Scholar] [CrossRef] [PubMed]
  19. Yu, B.; Yang, Z.Y.; Li, J.J.; Minakhina, S.; Yang, M.C.; Padgett, R.W.; Steward, R.; Chen, X.M. Methylation as a crucial step in plant microRNA biogenesis. Science 2005, 307, 932–935. [Google Scholar] [CrossRef] [PubMed]
  20. Béclin, C.; Waterhouse, P.; Boutet, S.; Vaucheret, H. A branched pathway for transgene-induced RNA silencing in plants. Curr. Biol. 2002, 12, 684–688. [Google Scholar] [CrossRef] [PubMed]
  21. Muangsan, N.; Béclin, C.; Vaucheret, H.; Robertson, D. Geminivirus VIGs of endogenous genes requires SGS2/SDE1 pathway for silencing in plants. Plant J. 2004, 38, 1004–1014. [Google Scholar] [CrossRef] [PubMed]
  22. Zhang, D.; Trudeau, V.L. The XS domain of a plant specific SGS3 protein adopts a unique RNA recognition motif (RRM) fold. Cell Cycle 2008, 7, 2268–2270. [Google Scholar] [CrossRef] [PubMed]
  23. Bateman, A. The SGS3 protein involved in PTGS finds a family. BMC Bioinform. 2002, 3, e21. [Google Scholar] [CrossRef] [Green Version]
  24. Elmayan, T.; Adenot, X.; Gissot, L.; Lauressergues, D.; Gy, I.; Vaucheret, H. A neomorphic sgs3 allele stabilizing miRNA cleavage products reveals that SGS3 acts as a homodimer. FEBS J. 2009, 276, 835–844. [Google Scholar] [CrossRef] [PubMed]
  25. Glick, E.; Zrachya, A.; Levy, Y.; Mett, A.; Gidoni, D.; Belausov, E.; Citovsky, V.; Gafni, Y. Interaction with host SGS3 is required for suppression of RNA silencing by tomato yellow leaf curl virus V2 protein. Proc. Natl. Acad. Sci. USA 2007, 105, 157–161. [Google Scholar] [CrossRef] [PubMed]
  26. Du, Z.G.; Xiao, D.L.; Wu, J.G.; Jia, D.S.; Yuan, Z.J.; Liu, Y.; Hu, L.Y.; Han, Z.; Wei, T.Y.; Lin, Q.Y.; et al. p2 of Rice stripe virus (RSV) interacts with OsSGS3 and is a silencing suppressor. Mol. Plant Pathol. 2011, 12, 808–814. [Google Scholar] [CrossRef] [PubMed]
  27. Yoshikawa, M.; Iki, T.; Tsutsui, Y.; Miyashita, K.; Poethig, R.S.; Habu, Y.; Ishikawa, M. 3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3. Proc. Natl. Acad. Sci. USA 2013, 110, 4117–4122. [Google Scholar] [CrossRef] [PubMed]
  28. Dalmay, T.; Hamilton, A.; Rudd, S.; Angell, S.; Baulcombe, D.C. An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 2000, 101, 543–553. [Google Scholar] [CrossRef] [PubMed]
  29. Anandalakshmi, R.; Pruss, G.J.; Ge, X.; Marathe, R.; Mallory, A.C.; Smith, T.H.; Vance, V.B. A viral suppressor of gene silencing in plants. Proc. Natl. Acad. Sci. USA 1998, 95, 13079–13084. [Google Scholar] [CrossRef] [PubMed]
  30. Béclin, C.; Berthome, R.; Palauqui, J.C.; Tepfer, M.; Vaucheret, H. Infection of tobacco or Arabidopsis plants by CMV counteracts systemic post-transcriptional silencing of nonviral (trans)genes. Virology 1998, 252, 313–317. [Google Scholar] [CrossRef] [PubMed]
  31. Brigneti, G.; Voinnet, O.; Li, W.X.; Ji, L.H.; Ding, S.W.; Baulcombe, D.C. Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J. 1998, 17, 6739–6746. [Google Scholar] [CrossRef] [PubMed]
  32. Kasschau, K.D.; Carrington, J.C. A counterdefensive strategy of plant viruses: Suppression of posttranscriptional gene silencing. Cell 1998, 95, 461–470. [Google Scholar] [CrossRef]
  33. Voinnet, O.; Pinto, Y.M.; Baulcombe, D.C. Suppression of gene silencing: A general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl. Acad. Sci. USA 1999, 96, 14147–14152. [Google Scholar] [CrossRef] [PubMed]
  34. Roth, B.M.; Pruss, G.J.; Vance, V.B. Plant viral suppressors of RNA silencing. Virus Res. 2004, 102, 97–108. [Google Scholar] [CrossRef] [PubMed]
  35. Qu, F.; Morris, T.J. Suppressors of RNA silencing encoded by plant viruses and their role in viral infections. FEBS Lett. 2005, 579, 5958–5964. [Google Scholar] [CrossRef] [PubMed]
  36. Mallory, A.C.; Ely, L.; Smith, T.H.; Marathe, R.; Anandalakshmi, R.; Fagard, M.; Vaucheret, H.; Pruss, G.; Bowman, L.; Vancea, V.B. HC-Pro suppression of transgene silencing eliminates the small RNAs but not transgene methylation or the mobile signal. Plant Cell 2011, 13, 571–583. [Google Scholar] [CrossRef]
  37. Kubota, K.; Tsuda, S.; Tamai, A.; Meshi, T. Tomato mosaic virus replication protein suppresses virus-targeted posttranscriptional gene silencing. J. Virol. 2003, 77, 11016–11026. [Google Scholar] [CrossRef] [PubMed]
  38. Morel, J.B.; Mourrain, P.; Béclin, C.; Vaucheret, H. DNA methylation and chromatin structure affect transcriptional and post-transcriptional transgene silencing in Arabidopsis. Curr. Biol. 2000, 10, 1591–1594. [Google Scholar] [PubMed]
  39. Voinnet, O. Use, tolerance and avoidance of amplified RNA silencing by plants. Trends Plant Sci. 2008, 13, 1360–1385. [Google Scholar] [CrossRef] [PubMed]
  40. Wang, X.B.; Jovel, J.; Udomporn, P.; Wang, Y.; Wu, Q.F.; Li, W.X.; Gasciolli, V.; Vaucheret, H.; Ding, S.W. The 21-nucleotide, but not 22-nucleotide, viral secondary small interfering RNAs direct potent antiviral defense by two cooperative argonautes in Arabidopsis thaliana. Plant Cell 2011, 23, 1625–1638. [Google Scholar] [CrossRef] [PubMed]
  41. Guo, H.S.; Ding, S.W. A viral protein inhibits the long range signaling activity of the gene silencing signal. EMBO J. 2002, 21, 398–407. [Google Scholar] [CrossRef] [PubMed]
  42. Liao, Q.; Zhu, L.; Du, Z.; Zeng, R.; Feng, J.; Chen, J. Satellite RNA-mediated reduction of cucumber mosaic virus genomic RNAs accumulation in Nicotiana tabacum. Acta Biochim. Biophys. Sin. 2007, 39, 217–223. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, X.R.; Yuan, Y.R.; Pei, Y.; Lin, S.S.; Tuschl, T.; Patel, D.J.; Chua, N.H. Cucumber mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity to counter plant defense. Gene Dev. 2006, 20, 3255–3268. [Google Scholar] [CrossRef] [PubMed]
  44. González, I.; Martínez, L.; Rakitina, D.V.; Lewsey, M.G.; Atencio, F.A.; Llave, C.; Kalinina, N.O.; Carr, J.P.; Palukaitis, P.; Canto, T. Cucumber mosaic virus 2b protein subcellular targets and interactions: Their significance to RNA silencing suppressor activity. Mol. Plant-Microbe Interact. 2010, 23, 294–303. [Google Scholar] [CrossRef] [PubMed]
  45. Vain, P.; Afolabi, A.S.; Worland, B.; Snape, J.W. Transgene behaviour in populations of rice plants transformed using a new dual binary vector system: PGreen/pSoup. Theor. Appl. Genet. 2003, 107, 210–217. [Google Scholar] [CrossRef] [PubMed]
  46. Hellens, R.P.; Edwards, E.A.; Leyland, N.R.; Bean, S.; Mullineaux, P.M. pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 2000, 42, 819–832. [Google Scholar]
  47. Liu, F.; Xiong, X.J.; Wu, L.; Fu, D.H.; Hayward, A.; Zeng, X.H.; Cao, Y.L.; Wu, Y.H.; Li, Y.J.; Wu, G. BraLTP1, a lipid transfer protein gene involved in epicuticular wax deposition, cell proliferation and flower development in Brassica napus. PLoS ONE 2014, 9, e110272. [Google Scholar] [CrossRef] [PubMed]
  48. Jenner, C.E.; Walsh, J.A. Pathotypic variation in turnip mosaic virus with special reference to European isolates. Plant Pathol. 1996, 45, 848–856. [Google Scholar] [CrossRef]
  49. Aguilar, I.; Sánchez, F.; Martín, A.M.; Martínez-Herrera, D.; Ponz, F. Nucleotide sequence of Chinese rape mosaic virus (oilseed rape mosaic virus), a crucifer tobamovirus infectious on Arabidopsis thaliana. Plant Mol. Biol. 1996, 30, 191–197. [Google Scholar] [CrossRef] [PubMed]
  50. Lin, H.; Chen, C.W.; Doddapaneni, H.; Duan, Y.P.; Civerolo, E.L.; Bai, X.J.; Zhao, X.L. A new diagnostic system for ultra-sensitive and specific detection and quantification of Candidatus Liberibacter asiaticus, the bacterium associated with citrus Huanglongbing. J. Microbiol. Methods 2010, 81, 17–25. [Google Scholar] [CrossRef] [PubMed]
  51. Mason, G.; Provero, P.; Vaira, A.M.; Accotto, G.P. Estimating the number of integrations in transformed plants by quantitative real-time PCR. BMC Biotechnol. 2002, 2, e20. [Google Scholar] [CrossRef] [Green Version]

Share and Cite

MDPI and ACS Style

Chen, Q.; Wang, J.; Hou, M.; Liu, S.; Huang, J.; Cai, L. BnSGS3 Has Differential Effects on the Accumulation of CMV, ORMV and TuMV in Oilseed Rape. Viruses 2015, 7, 4169-4185. https://doi.org/10.3390/v7082815

AMA Style

Chen Q, Wang J, Hou M, Liu S, Huang J, Cai L. BnSGS3 Has Differential Effects on the Accumulation of CMV, ORMV and TuMV in Oilseed Rape. Viruses. 2015; 7(8):4169-4185. https://doi.org/10.3390/v7082815

Chicago/Turabian Style

Chen, Quan, Jie Wang, Mingsheng Hou, Shengyi Liu, Junyan Huang, and Li Cai. 2015. "BnSGS3 Has Differential Effects on the Accumulation of CMV, ORMV and TuMV in Oilseed Rape" Viruses 7, no. 8: 4169-4185. https://doi.org/10.3390/v7082815

Article Metrics

Back to TopTop