In Vitro and in Vivo Evaluation of Mutations in the NS Region of Lineage 2 West Nile Virus Associated with Neuroinvasiveness in a Mammalian Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. RNA Extraction and cDNA Synthesis
2.3. Sequence Analysis
2.4. Plasmids and Bacteria Strains
2.5. Generation of the Full-Length Clone of WNV-578/10
2.6. Generation of Mutant Full-Length WNV Clones
2.7. Transfection and Recovery of the Recombinant Viruses from the cDNA Clones
2.8. Multiplication Curves in Cell Culture
2.9. Quantitation of Viral RNA Titres
2.10. Mouse Virulence Studies
2.11. Statistical Analysis
3. Results
3.1. Comparison of the Genome Sequences of WNV Lineage 1 (NY99) and Lineage 2 (578/10) Strains
3.2. Rescue of Recombinant Viruses
3.3. Full Genome Sequence Analysis of Recombinant Virus Stocks
3.4. Multiplication Kinetics of the Recombinant Wild Type (WT) and Mutant WNVs in Cell Culture
3.5. Quantification of Positive and Negative Strand RNA for WT and NS1 Mutant in Vitro
3.6. Mouse Neuroinvasiveness of the Different Mutant WNV Strains
3.7. Sequencing of Recombinant WNV in Organs of Euthanized and Survivor Mice
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Mackenzie, J.S.; Williams, D.T. The zoonotic flaviviruses of southern, south-eastern and eastern Asia, and Australasia: the potential for emergent viruses. Zoonoses Public Health 2009, 56, 338–356. [Google Scholar] [CrossRef]
- Pachler, K.; Lebl, K.; Berer, D.; Rudolf, I.; Hubalek, Z.; Nowotny, N. Putative new West Nile virus lineage in Uranotaenia unguiculata mosquitoes, Austria, 2013. Emerg. Infect. Dis. 2014, 20, 2119–2122. [Google Scholar] [CrossRef] [PubMed]
- Kemenesi, G.; Dallos, B.; Oldal, M.; Kutas, A.; Foldes, F.; Nemeth, V.; Reiter, P.; Bakonyi, T.; Banyai, K.; Jakab, F. Putative novel lineage of West Nile virus in Uranotaenia unguiculata mosquito, Hungary. Virusdisease 2014, 25, 500–503. [Google Scholar] [CrossRef] [PubMed]
- Smithburn, K.C.; Hughes, T.P.; Burke, A.W.; Paul, J.H. A neurotropic virus isolated from the blood of a native of Uganda. Am. J. Trop. Med. Hyg. 1940, 20, 471–492. [Google Scholar]
- Jupp, P.G. The ecology of West Nile virus in South Africa and the occurrence of outbreaks in humans. Ann. N. Y. Acad. Sci. 2001, 951, 143–152. [Google Scholar] [CrossRef]
- Sotelo, E.; Fernandez-Pinero, J.; Llorente, F.; Vazquez, A.; Moreno, A.; Aguero, M.; Cordioli, P.; Tenorio, A.; Jimenez-Clavero, M.A. Phylogenetic relationships of Western Mediterranean West Nile virus strains (1996-2010) using full-length genome sequences: single or multiple introductions? J. Gen. Virol. 2011, 92, (Pt 11). 2512–2522. [Google Scholar] [CrossRef] [PubMed]
- Hayes, C.G. West Nile virus: Uganda, 1937, to New York City, 1999. Ann. N. Y. Acad. Sci. 2001, 951, 25–37. [Google Scholar] [CrossRef]
- Zeller, H.G.; Schuffenecker, I. West Nile virus: an overview of its spread in Europe and the Mediterranean basin in contrast to its spread in the Americas. Eur. J. Clin. Microbiol. Infect. Dis. 2004, 23, 147–156. [Google Scholar] [CrossRef] [PubMed]
- Calistri, P.; Giovannini, A.; Hubalek, Z.; Ionescu, A.; Monaco, F.; Savini, G.; Lelli, R. Epidemiology of west nile in europe and in the mediterranean basin. Open Virol. J. 2010, 4, 29–37. [Google Scholar] [CrossRef]
- Petersen, L.R.; Roehrig, J.T. West Nile virus: a reemerging global pathogen. Emerg. Infect. Dis. 2001, 7, 611–614. [Google Scholar] [CrossRef]
- Bakonyi, T.; Ivanics, E.; Erdelyi, K.; Ursu, K.; Ferenczi, E.; Weissenbock, H.; Nowotny, N. Lineage 1 and 2 strains of encephalitic West Nile virus, central Europe. Emerg. Infect. Dis. 2006, 12, 618–623. [Google Scholar] [CrossRef] [PubMed]
- Erdelyi, K.; Ursu, K.; Ferenczi, E.; Szeredi, L.; Ratz, F.; Skare, J.; Bakonyi, T. Clinical and pathologic features of lineage 2 West Nile virus infections in birds of prey in Hungary. Vector Borne Zoonotic Dis. 2007, 7, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Krisztalovics, K.; Ferenczi, E.; Molnar, Z.; Csohan, A.; Ban, E.; Zoldi, V.; Kaszas, K. West Nile virus infections in Hungary, August-September 2008. Euro. Surveill. 2008, 13, pii: 19030. [Google Scholar] [PubMed]
- Wodak, E.; Richter, S.; Bago, Z.; Revilla-Fernandez, S.; Weissenbock, H.; Nowotny, N.; Winter, P. Detection and molecular analysis of West Nile virus infections in birds of prey in the eastern part of Austria in 2008 and 2009. Vet. Microbiol. 2011, 149, 358–366. [Google Scholar] [CrossRef] [PubMed]
- Bakonyi, T.; Ferenczi, E.; Erdelyi, K.; Kutasi, O.; Csorgo, T.; Seidel, B.; Weissenbock, H.; Brugger, K.; Ban, E.; Nowotny, N. Explosive spread of a neuroinvasive lineage 2 West Nile virus in Central Europe, 2008/2009. Vet. Microbiol. 2013, 165, 61–70. [Google Scholar] [CrossRef]
- Ciccozzi, M.; Peletto, S.; Cella, E.; Giovanetti, M.; Lai, A.; Gabanelli, E.; Acutis, P.L.; Modesto, P.; Rezza, G.; Platonov, A.E.; Lo Presti, A.; Zehender, G. Epidemiological history and phylogeography of West Nile virus lineage 2. Infect. Genet. Evol. 2013, 17, 46–50. [Google Scholar] [CrossRef] [PubMed]
- Chaskopoulou, A.; Dovas, C.I.; Chaintoutis, S.C.; Kashefi, J.; Koehler, P.; Papanastassopoulou, M. Detection and early warning of West Nile Virus circulation in Central Macedonia, Greece, using sentinel chickens and mosquitoes. Vector Borne Zoonotic Dis. 2013, 13, 723–732. [Google Scholar] [CrossRef] [PubMed]
- Papa, A.; Bakonyi, T.; Xanthopoulou, K.; Vazquez, A.; Tenorio, A.; Nowotny, N. Genetic characterization of West Nile virus lineage 2, Greece, 2010. Emerg. Infect. Dis. 2011, 17, 920–922. [Google Scholar] [CrossRef] [PubMed]
- Bagnarelli, P.; Marinelli, K.; Trotta, D.; Monachetti, A.; Tavio, M.; Del Gobbo, R.; Capobianchi, M.; Menzo, S.; Nicoletti, L.; Magurano, F.; et al. Human case of autochthonous West Nile virus lineage 2 infection in Italy, September 2011. Euro. Surveill. 2011, 16. [Google Scholar]
- Savini, G.; Capelli, G.; Monaco, F.; Polci, A.; Russo, F.; Di Gennaro, A.; Marini, V.; Teodori, L.; Montarsi, F.; Pinoni, C.; et al. Evidence of West Nile virus lineage 2 circulation in Northern Italy. Vet. Microbiol. 2012, 158, 267–273. [Google Scholar] [CrossRef]
- Platonov, A.E.; Fedorova, M.V.; Karan, L.S.; Shopenskaya, T.A.; Platonova, O.V.; Zhuravlev, V.I. Epidemiology of West Nile infection in Volgograd, Russia, in relation to climate change and mosquito (Diptera: Culicidae) bionomics. Parasitol. Res. 2008, 103 Suppl. 1, S45–S53. [Google Scholar] [CrossRef] [PubMed]
- Platonov, A.E.; Karan, L.S.; Shopenskaia, T.A.; Fedorova, M.V.; Koliasnikova, N.M.; Rusakova, N.M.; Shishkina, L.V.; Arshba, T.E.; Zhuravlev, V.I.; Govorukhina, M.V.; et al. [Genotyping of West Nile fever virus strains circulating in southern Russia as an epidemiological investigation method: principles and results]. Zh. Mikrobiol. Epidemiol. Immunobiol. 2011, 29–37. [Google Scholar]
- Sirbu, A.; Ceianu, C.S.; Panculescu-Gatej, R.I.; Vazquez, A.; Tenorio, A.; Rebreanu, R.; Niedrig, M.; Nicolescu, G.; Pistol, A. Outbreak of West Nile virus infection in humans, Romania, July to October 2010. Euro. Surveill. 2011, 16. [Google Scholar]
- Liu, W.J.; Wang, X.J.; Clark, D.C.; Lobigs, M.; Hall, R.A.; Khromykh, A.A. A single amino acid substitution in the West Nile virus nonstructural protein NS2A disables its ability to inhibit alpha/beta interferon induction and attenuates virus virulence in mice. J. Virol. 2006, 80, 2396–2404. [Google Scholar] [CrossRef] [PubMed]
- Rossi, S.L.; Fayzulin, R.; Dewsbury, N.; Bourne, N.; Mason, P.W. Mutations in West Nile virus nonstructural proteins that facilitate replicon persistence in vitro attenuate virus replication in vitro and in vivo. Virology 2007, 364, 184–195. [Google Scholar] [CrossRef] [PubMed]
- Audsley, M.; Edmonds, J.; Liu, W.; Mokhonov, V.; Mokhonova, E.; Melian, E.B.; Prow, N.; Hall, R.A.; Khromykh, A.A. Virulence determinants between New York 99 and Kunjin strains of West Nile virus. Virology 2011, 414, 63–73. [Google Scholar] [CrossRef] [PubMed]
- Donadieu, E.; Bahuon, C.; Lowenski, S.; Zientara, S.; Coulpier, M.; Lecollinet, S. Differential virulence and pathogenesis of West Nile viruses. Viruses 2013, 5, 2856–2880. [Google Scholar] [CrossRef] [PubMed]
- Chambers, T.J.; Droll, D.A.; Walton, A.H.; Schwartz, J.; Wold, W.S.; Nickells, J. West Nile 25A virus infection of B-cell-deficient ((micro)MT) mice: characterization of neuroinvasiveness and pseudoreversion of the viral envelope protein. J. Gen. Virol. 2008, 89, (Pt 3). 627–635. [Google Scholar] [CrossRef] [PubMed]
- Wicker, J.A.; Whiteman, M.C.; Beasley, D.W.; Davis, C.T.; Zhang, S.; Schneider, B.S.; Higgs, S.; Kinney, R.M.; Barrett, A.D. A single amino acid substitution in the central portion of the West Nile virus NS4B protein confers a highly attenuated phenotype in mice. Virology 2006, 349, 245–253. [Google Scholar] [CrossRef] [PubMed]
- Puig-Basagoiti, F.; Tilgner, M.; Bennett, C.J.; Zhou, Y.; Munoz-Jordan, J.L.; Garcia-Sastre, A.; Bernard, K.A.; Shi, P.Y. A mouse cell-adapted NS4B mutation attenuates West Nile virus RNA synthesis. Virology 2007, 361, 229–241. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.J.; Chen, H.B.; Khromykh, A.A. Molecular and functional analyses of Kunjin virus infectious cDNA clones demonstrate the essential roles for NS2A in virus assembly and for a nonconservative residue in NS3 in RNA replication. J. Virol. 2003, 77, 7804–7813. [Google Scholar] [CrossRef]
- Leung, J.Y.; Pijlman, G.P.; Kondratieva, N.; Hyde, J.; Mackenzie, J.M.; Khromykh, A.A. Role of nonstructural protein NS2A in flavivirus assembly. J. Virol. 2008, 82, 4731–4741. [Google Scholar] [CrossRef] [PubMed]
- Brault, A.C.; Huang, C.Y.; Langevin, S.A.; Kinney, R.M.; Bowen, R.A.; Ramey, W.N.; Panella, N.A.; Holmes, E.C.; Powers, A.M.; Miller, B.R. A single positively selected West Nile viral mutation confers increased virogenesis in American crows. Nat. Genet. 2007, 39, 1162–1166. [Google Scholar] [CrossRef] [PubMed]
- Davis, C.T.; Galbraith, S.E.; Zhang, S.; Whiteman, M.C.; Li, L.; Kinney, R.M.; Barrett, A.D. A combination of naturally occurring mutations in North American West Nile virus nonstructural protein genes and in the 3' untranslated region alters virus phenotype. J. Virol. 2007, 81, 6111–6116. [Google Scholar] [CrossRef] [PubMed]
- Welte, T.; Xie, G.; Wicker, J.A.; Whiteman, M.C.; Li, L.; Rachamallu, A.; Barrett, A.; Wang, T. Immune responses to an attenuated West Nile virus NS4B-P38G mutant strain. Vaccine 2011, 29, 4853–4861. [Google Scholar] [CrossRef]
- Wicker, J.A.; Whiteman, M.C.; Beasley, D.W.; Davis, C.T.; McGee, C.E.; Lee, J.C.; Higgs, S.; Kinney, R.M.; Huang, C.Y.; Barrett, A.D. Mutational analysis of the West Nile virus NS4B protein. Virology 2012, 426, 22–33. [Google Scholar] [CrossRef] [PubMed]
- Botha, E.M.; Markotter, W.; Wolfaardt, M.; Paweska, J.T.; Swanepoel, R.; Palacios, G.; Nel, L.H.; Venter, M. Genetic determinants of virulence in pathogenic lineage 2 West Nile virus strains. Emerg. Infect. Dis. 2008, 14, 222–230. [Google Scholar] [CrossRef] [PubMed]
- McMullen, A.R.; Albayrak, H.; May, F.J.; Davis, C.T.; Beasley, D.W.; Barrett, A.D. Molecular evolution of lineage 2 West Nile virus. J. Gen. Virol. 2013, 94, (Pt 2). 318–325. [Google Scholar] [CrossRef] [PubMed]
- Bakonyi, T.; Gould, E.A.; Kolodziejek, J.; Weissenbock, H.; Nowotny, N. Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001: comparison with the South African strain SAAR-1776 and other flaviviruses. Virology 2004, 328, 301–310. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Boysen, C.; Shizuya, H.; Simon, M.I.; Hood, L. Complete nucleotide sequence of two generations of a bacterial artificial chromosome cloning vector. Biotechniques 1997, 23, 992–994. [Google Scholar]
- Balint, A.; Farsang, A.; Zadori, Z.; Hornyak, A.; Dencso, L.; Almazan, F.; Enjuanes, L.; Belak, S. Molecular characterization of feline infectious peritonitis virus strain DF-2 and studies of the role of ORF3abc in viral cell tropism. J. Virol. 2012, 86, 6258–6267. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Russell, D.W.; Fritsch, E.F.; Maniatis, T. Molecular cloning: a laboratory manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y, 2001. [Google Scholar]
- Spearman, C. The method of 'right and wrong cases' ('constant stimuli') without Gauss's formulae. Brit. J. Psychol. 1908, 2, 227–242. [Google Scholar] [CrossRef]
- Kärber, G. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Archiv fur Experimentelle Pathologie und Pharmakologie 1931, 162, 480–483. [Google Scholar] [CrossRef]
- Lim, S.M.; Koraka, P.; Osterhaus, A.D.; Martina, B.E. Development of a strand-specific real-time qRT-PCR for the accurate detection and quantitation of West Nile virus RNA. J. Virol. Methods 2013, 194, 146–153. [Google Scholar] [CrossRef]
- Davis, B.S.; Chang, G.J.; Cropp, B.; Roehrig, J.T.; Martin, D.A.; Mitchell, C.J.; Bowen, R.; Bunning, M.L. West Nile virus recombinant DNA vaccine protects mouse and horse from virus challenge and expresses in vitro a noninfectious recombinant antigen that can be used in enzyme-linked immunosorbent assays. J. Virol. 2001, 75, 4040–4047. [Google Scholar] [CrossRef] [PubMed]
- Scholle, F.; Girard, Y.A.; Zhao, Q.; Higgs, S.; Mason, P.W. trans-Packaged West Nile virus-like particles: infectious properties in vitro and in infected mosquito vectors. J. Virol. 2004, 78, 11605–11614. [Google Scholar] [CrossRef] [PubMed]
- Rossi, S.L.; Zhao, Q.; O'Donnell, V.K.; Mason, P.W. Adaptation of West Nile virus replicons to cells in culture and use of replicon-bearing cells to probe antiviral action. Virology 2005, 331, 457–470. [Google Scholar] [CrossRef] [PubMed]
- Yamshchikov, V.F.; Wengler, G.; Perelygin, A.A.; Brinton, M.A.; Compans, R.W. An infectious clone of the West Nile flavivirus. Virology 2001, 281, 294–304. [Google Scholar] [CrossRef] [PubMed]
- Shi, P.Y.; Tilgner, M.; Lo, M.K.; Kent, K.A.; Bernard, K.A. Infectious cDNA clone of the epidemic west nile virus from New York City. J. Virol. 2002, 76, 5847–5856. [Google Scholar] [CrossRef]
- Maeda, J.; Takagi, H.; Hashimoto, S.; Kurane, I.; Maeda, A. A PCR-based protocol for generating West Nile virus replicons. J. Virol. Methods 2008, 148, 244–252. [Google Scholar] [CrossRef]
- McGee, C.E.; Shustov, A.V.; Tsetsarkin, K.; Frolov, I.V.; Mason, P.W.; Vanlandingham, D.L.; Higgs, S. Infection, dissemination, and transmission of a West Nile virus green fluorescent protein infectious clone by Culex pipiens quinquefasciatus mosquitoes. Vector Borne Zoonotic Dis. 2010, 10, 267–274. [Google Scholar] [CrossRef] [PubMed]
- Campbell, M.S.; Pletnev, A.G. Infectious cDNA clones of Langat tick-borne flavivirus that differ from their parent in peripheral neurovirulence. Virology 2000, 269, 225–237. [Google Scholar] [CrossRef] [PubMed]
- Montigny, C.; Penin, F.; Lethias, C.; Falson, P. Overcoming the toxicity of membrane peptide expression in bacteria by upstream insertion of Asp-Pro sequence. Biochim. Biophys. Acta. 2004, 1660, 53–65. [Google Scholar] [CrossRef] [PubMed]
- Ulper, L.; Sarand, I.; Rausalu, K.; Merits, A. Construction, properties, and potential application of infectious plasmids containing Semliki Forest virus full-length cDNA with an inserted intron. J. Virol. Methods 2008, 148, 265–270. [Google Scholar] [CrossRef]
- Maeda, A.; Murata, R.; Akiyama, M.; Takashima, I.; Kariwa, H.; Watanabe, T.; Kurane, I.; Maeda, J. A PCR-based protocol for the generation of a recombinant West Nile virus. Virus. Res. 2009, 144, 35–43. [Google Scholar] [CrossRef]
- Almazan, F.; Gonzalez, J.M.; Penzes, Z.; Izeta, A.; Calvo, E.; Plana-Duran, J.; Enjuanes, L. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA 2000, 97, 5516–5521. [Google Scholar] [CrossRef]
- Venter, M.; Swanepoel, R. West Nile virus lineage 2 as a cause of zoonotic neurological disease in humans and horses in southern Africa. Vector Borne Zoonotic Dis. 2010, 10, 659–664. [Google Scholar] [CrossRef] [PubMed]
- Kaufusi, P.H.; Kelley, J.F.; Yanagihara, R.; Nerurkar, V.R. Induction of endoplasmic reticulum-derived replication-competent membrane structures by West Nile virus non-structural protein 4B. PLoS ONE 2014, 9, e84040. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.J.; Wang, X.J.; Mokhonov, V.V.; Shi, P.Y.; Randall, R.; Khromykh, A.A. Inhibition of interferon signaling by the New York 99 strain and Kunjin subtype of West Nile virus involves blockage of STAT1 and STAT2 activation by nonstructural proteins. J. Virol. 2005, 79, 1934–1942. [Google Scholar] [CrossRef] [PubMed]
- Munoz-Jordan, J.L.; Laurent-Rolle, M.; Ashour, J.; Martinez-Sobrido, L.; Ashok, M.; Lipkin, W.I.; Garcia-Sastre, A. Inhibition of alpha/beta interferon signaling by the NS4B protein of flaviviruses. J. Virol. 2005, 79, 8004–8013. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.D.; Seeger, C. Differential effects of mutations in NS4B on West Nile virus replication and inhibition of interferon signaling. J. Virol. 2007, 81, 11809–11816. [Google Scholar] [CrossRef] [PubMed]
- Laurent-Rolle, M.; Boer, E.F.; Lubick, K.J.; Wolfinbarger, J.B.; Carmody, A.B.; Rockx, B.; Liu, W.; Ashour, J.; Shupert, W.L.; Holbrook, M.R.; et al. The NS5 protein of the virulent West Nile virus NY99 strain is a potent antagonist of type I interferon-mediated JAK-STAT signaling. J. Virol. 2010, 84, 3503–3515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samuel, M.A.; Diamond, M.S. Alpha/beta interferon protects against lethal West Nile virus infection by restricting cellular tropism and enhancing neuronal survival. J. Virol. 2005, 79, 13350–13361. [Google Scholar] [CrossRef] [PubMed]
- Keller, B.C.; Fredericksen, B.L.; Samuel, M.A.; Mock, R.E.; Mason, P.W.; Diamond, M.S.; Gale, M., Jr. Resistance to alpha/beta interferon is a determinant of West Nile virus replication fitness and virulence. J. Virol. 2006, 80, 9424–9434. [Google Scholar] [CrossRef] [PubMed]
- Suthar, M.S.; Brassil, M.M.; Blahnik, G.; Gale, M., Jr. Infectious clones of novel lineage 1 and lineage 2 West Nile virus strains WNV-TX02 and WNV-Madagascar. J. Virol. 2012, 86, 7704–7709. [Google Scholar] [CrossRef] [PubMed]
- Winkler, G.; Randolph, V.B.; Cleaves, G.R.; Ryan, T.E.; Stollar, V. Evidence that the mature form of the flavivirus nonstructural protein NS1 is a dimer. Virology 1988, 162, 187–196. [Google Scholar] [CrossRef]
- Winkler, G.; Maxwell, S.E.; Ruemmler, C.; Stollar, V. Newly synthesized dengue-2 virus nonstructural protein NS1 is a soluble protein but becomes partially hydrophobic and membrane-associated after dimerization. Virology 1989, 171, 302–305. [Google Scholar] [CrossRef]
- Chung, K.M.; Liszewski, M.K.; Nybakken, G.; Davis, A.E.; Townsend, R.R.; Fremont, D.H.; Atkinson, J.P.; Diamond, M.S. West Nile virus nonstructural protein NS1 inhibits complement activation by binding the regulatory protein factor H. Proc. Natl. Acad. Sci. USA 2006, 103, 19111–19116. [Google Scholar] [CrossRef] [PubMed]
- Schlesinger, J.J. Flavivirus nonstructural protein NS1: complementary surprises. Proc. Natl. Acad. Sci. USA 2006, 103, 18879–18880. [Google Scholar] [CrossRef] [PubMed]
- Crooks, A.J.; Lee, J.M.; Easterbrook, L.M.; Timofeev, A.V.; Stephenson, J.R. The NS1 protein of tick-borne encephalitis virus forms multimeric species upon secretion from the host cell. J. Gen. Virol. 1994, 75, (Pt 12). 3453–3460. [Google Scholar] [CrossRef] [PubMed]
- Flamand, M.; Megret, F.; Mathieu, M.; Lepault, J.; Rey, F.A.; Deubel, V. Dengue virus type 1 nonstructural glycoprotein NS1 is secreted from mammalian cells as a soluble hexamer in a glycosylation-dependent fashion. J. Virol. 1999, 73, 6104–6110. [Google Scholar]
- Hall, R.A.; Khromykh, A.A.; Mackenzie, J.M.; Scherret, J.H.; Khromykh, T.I.; Mackenzie, J.S. Loss of dimerisation of the nonstructural protein NS1 of Kunjin virus delays viral replication and reduces virulence in mice, but still allows secretion of NS1. Virology 1999, 264, 66–75. [Google Scholar] [CrossRef] [PubMed]
- Youn, S.; Ambrose, R.L.; Mackenzie, J.M.; Diamond, M.S. Non-structural protein-1 is required for West Nile virus replication complex formation and viral RNA synthesis. Virol. J. 2013, 10, 339. [Google Scholar] [CrossRef] [PubMed]
- Lindenbach, B.D.; Murray, C.L.; Thiel, H.-J.; Rice, C.M. Flaviviridae: The viruses and their replication. In Fields Virology, 6th ed.; Knipe, D.M., Howley, P.M., Griffin, D.E., Hartin, M.A., Lamb, R.A., Roizman, B., Straus, S.E., Eds.; Lippincott Williams & Wilkins: New York, NY, 2013. [Google Scholar]
- Liu, W.J.; Chen, H.B.; Wang, X.J.; Huang, H.; Khromykh, A.A. Analysis of adaptive mutations in Kunjin virus replicon RNA reveals a novel role for the flavivirus nonstructural protein NS2A in inhibition of beta interferon promoter-driven transcription. J. Virol. 2004, 78, 12225–12235. [Google Scholar] [CrossRef] [PubMed]
- Wengler, G.; Wengler, G. The carboxy-terminal part of the NS 3 protein of the West Nile flavivirus can be isolated as a soluble protein after proteolytic cleavage and represents an RNA-stimulated NTPase. Virology 1991, 184, 707–715. [Google Scholar] [CrossRef]
- Padmanabhan, R.; Mueller, N.; Reichert, E.; Yon, C.; Teramoto, T.; Kono, Y.; Takhampunya, R.; Ubol, S.; Pattabiraman, N.; Falgout, B.; et al. Multiple enzyme activities of flavivirus proteins. Novartis Found. Symp. 2006, 277, 74–84; discussion 84–86, 251–253. [Google Scholar] [PubMed]
- Kummerer, B.M.; Rice, C.M. Mutations in the yellow fever virus nonstructural protein NS2A selectively block production of infectious particles. J. Virol. 2002, 76, 4773–4784. [Google Scholar] [CrossRef]
- Langevin, S.A.; Bowen, R.A.; Reisen, W.K.; Andrade, C.C.; Ramey, W.N.; Maharaj, P.D.; Anishchenko, M.; Kenney, J.L.; Duggal, N.K.; Romo, H.; et al. Host competence and helicase activity differences exhibited by West Nile viral variants expressing NS3-249 amino acid polymorphisms. PLoS ONE 2014, 9, e100802. [Google Scholar] [CrossRef] [PubMed]
- Davis, C.T.; Beasley, D.W.; Guzman, H.; Siirin, M.; Parsons, R.E.; Tesh, R.B.; Barrett, A.D. Emergence of attenuated West Nile virus variants in Texas, 2003. Virology 2004, 330, 342–350. [Google Scholar] [CrossRef] [PubMed]
- Lanciotti, R.S.; Ebel, G.D.; Deubel, V.; Kerst, A.J.; Murri, S.; Meyer, R.; Bowen, M.; McKinney, N.; Morrill, W.E.; Crabtree, M.B.; et al. Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology 2002, 298, 96–105. [Google Scholar] [CrossRef]
- Kolodziejek, J.; Marinov, M.; Kiss, B.J.; Alexe, V.; Nowotny, N. The complete sequence of a West Nile virus lineage 2 strain detected in a Hyalomma marginatum marginatum tick collected from a song thrush (Turdus philomelos) in eastern Romania in 2013 revealed closest genetic relationship to strain Volgograd 2007. PLoS ONE 2014, 9, e109905. [Google Scholar] [CrossRef] [PubMed]
Primer code | Nucleotide sequence (5’→3’) | Nucleotide position (5’) * |
---|---|---|
1F† | GAGCTCGTTTAGTGAACCGTAGTAGTTCGCCTGTGTGAGC | 1 |
1FRC† | GCTCACACAGGCGAACTACTACGGTTCACTAAACGAGCTC | 20 |
4750F | CACACACTATGGCACACCACTAAGG | 4750 |
5426R | GACATCAGCCTGTGTGTGAGAGTGG | 5426 |
8190F | AGACTGGCTGCACAGAGGACCTAAG | 8190 |
9175R | GGTCTTCATTGAGGAATCCGAGAGC | 9175 |
3’XbaSacIIR‡ | ATCCGCGGTCTAGAGATCCTGTGTTCTAGCACCACAG | 11026 |
Primer code | Nucleotide sequence (5’→3’) | Nucleotide Position (5’)* |
---|---|---|
NS1F | CATCACCTTGGCAGGACTCAGAAGCAATCATAACAGGAGACC | 3201 |
NS1R | GGTCTCCTGTTATGATTGCTTCTGAGTCCTGCCAAGGTGATG | 3201 |
NS2AF | TTCGCAAGAGGTGGACGCCCAAGATCAGCATTCCAGCTATCA | 3596 |
NS2AR | TGATAGCTGGAATGCTGATCTTGGGCGTCCACCTCTTGCGAA | 3596 |
NS3F | GGTACCAAACCTCAGCAGTGCACAGAGAGCACAGTGGAAATGA | 5336 |
NS3R | TCATTTCCACTGTGCTCTCTGTGCACTGCTGAGGTTTGGTACC | 5336 |
38NS4BF | TTCTTGCTTGATCTGCGGGGGGCTACAGCATGGTCTCTCTAT | 7012 |
38NS4BR | ATAGAGAGACCATGCTGTAGCCCCCCGCAGATCAAGCAAGAA | 7012 |
102NS4BF | TCAGCTCTCTTGCTGGCGGCCGGGTCCTGGGGCCAAGTGACCCTG ACTGTGACT | 7198 |
102NS4BR | AGTCACAGTCAGGGTCACTTGGCCCCAGGACCCGGCCGCCAGCAAGAGAGCTGA | 7198 |
249NS4BF | GGACTCTCATCAAAAACATGGGGAAACCAGGCCTCAAGAG | 7643 |
249NS4BR | CTCTTGAGGCCTGGTTTCCCCATGTTTTTGATGAGAGTCC | 7643 |
Virus | Dose (TCID50) | Total mortality | Mortality (%) | Median day |
---|---|---|---|---|
WT | 10^5 | 8/8 | 100 | 10.5 |
WT | 10^1 | 6/8 | 75 | 11 |
NS1 | 10^4 | 0/8 | 0 | NA |
NS1 | 10^1 | 0/8 | 0 | NA |
NS2a | 10^5.5 | 7/8 | 88 | 9 |
NS2a | 10^1 | 6/8 | 75 | 11.5 |
NS3 | 10^3 | 6/8 | 75 | 10.5 |
NS3 | 10^0 | 3/8 | 38 | 11 |
NS4B38 | 10^4 | 8/8 | 100 | 11 |
NS4B38 | 10^0 | 5/8 | 63 | 11 |
NS4B249 | 10^4 | 5/8 | 63 | 9 |
NS4B249 | 10^1 | 4/8 | 50 | 11.5 |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szentpáli-Gavallér, K.; Lim, S.M.; Dencső, L.; Bányai, K.; Koraka, P.; Osterhaus, A.D.M.E.; Martina, B.E.E.; Bakonyi, T.; Bálint, Á. In Vitro and in Vivo Evaluation of Mutations in the NS Region of Lineage 2 West Nile Virus Associated with Neuroinvasiveness in a Mammalian Model. Viruses 2016, 8, 49. https://doi.org/10.3390/v8020049
Szentpáli-Gavallér K, Lim SM, Dencső L, Bányai K, Koraka P, Osterhaus ADME, Martina BEE, Bakonyi T, Bálint Á. In Vitro and in Vivo Evaluation of Mutations in the NS Region of Lineage 2 West Nile Virus Associated with Neuroinvasiveness in a Mammalian Model. Viruses. 2016; 8(2):49. https://doi.org/10.3390/v8020049
Chicago/Turabian StyleSzentpáli-Gavallér, Katalin, Stephanie M. Lim, László Dencső, Krisztián Bányai, Penelope Koraka, Albert D.M.E. Osterhaus, Byron E.E. Martina, Tamás Bakonyi, and Ádám Bálint. 2016. "In Vitro and in Vivo Evaluation of Mutations in the NS Region of Lineage 2 West Nile Virus Associated with Neuroinvasiveness in a Mammalian Model" Viruses 8, no. 2: 49. https://doi.org/10.3390/v8020049