Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis
Abstract
:1. Introduction
2. Results
2.1. Inhibitory Effect of Cinnamaldehyde on the Growth and Ochratoxin A Production by A. ochraceus with Fumigation
2.2. Effect of Cinnamaldehyde on the Morphology of A. ochraceus by SEM
2.3. Effect of Cinnamaldehyde on the Ultrastructure of A. ochraceus by TEM
2.4. Effect of Cinnamaldehyde on Ochratoxin A Biosynthetic and Regulatory Genes Expression
3. Discussion
4. Materials and Methods
4.1. Cinnamaldehyde and Ochratoxin A Standards
4.2. Fungal Strain and Culture Conditions
4.3. Effect of Cinnamaldehyde on Fungal Growth and Ochratoxin A Production
4.4. The Extraction and Determination of Ochratoxin A
4.5. Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM)
4.6. Real-Time PCR Analysis of OTA Biosynthetic and Regulatory genes
4.7. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Valero, A.; Farré, J.R.; Sanchis, V.; Ramos, A.J.; Marín, S. Effects of fungal interaction on ochratoxin A production by A. carbonarius at different temperatures and aw. Int. J. Food Microbiol. 2006, 110, 160–164. [Google Scholar] [CrossRef] [PubMed]
- Jørgensen, K. Survey of pork, poultry, coffee, beer and pulses for ochratoxin A. Food Addit. Contam. 1998, 15, 550–554. [Google Scholar] [CrossRef] [PubMed]
- Magnoli, C.; Astoreca, A.; Ponsone, L.; Combina, M.; Palacio, G.; Rosa, C.A.R.; Dalcero, A.M. Survey of mycoflora and ochratoxin A in dried vine fruits from Argentina markets. Lett. Appl. Microbiol. 2004, 39, 326–331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Magnoli, C.; Hallak, C.; Astoreca, A.; Ponsone, L.; Chiacchiera, S.M.; Palacio, G.; Dalcero, A. Surveillance of toxigenic fungi and ochratoxin A in feedstuffs from Córdoba Province, Argentina. Vet. Res. Commun. 2005, 29, 409–420. [Google Scholar] [CrossRef] [PubMed]
- Magnoli, C.; Astoreca, A.; Ponsone, M.L.; Fernández-Juri, M.G.; Barberis, C.; Dalcero, A.M. Ochratoxin A and Aspergillus section Nigri in peanut seeds at different months of storage in Córdoba, Argentina. Int. J. Food Microbiol. 2007, 119, 213–218. [Google Scholar] [CrossRef] [PubMed]
- Denli, M.; Perez, J.F. Ochratoxins in feed, a risk for animal and human health: Control strategies. Toxins 2010, 2, 1065–1077. [Google Scholar] [CrossRef] [PubMed]
- Pfohlleszkowicz, A. Ochratoxin A and aristolochic acid involvement in nephropathies and associated urothelial tract tumours. Arch. Ind. Hyg. Toxicol. 2009, 60, 465–482. [Google Scholar]
- Ringot, D.; Chango, A.; Schneider, Y.J.; Larondelle, Y. Toxicokinetics and toxicodynamics of ochratoxin A, an update. Chem.-Biol. Interact. 2006, 159, 18–46. [Google Scholar] [CrossRef] [PubMed]
- Hua, H.; Xing, F.; Selvaraj, J.N.; Wang, Y.; Zhao, Y.; Zhou, L. Inhibitory effect of essential oils on Aspergillus ochraceus growth and ochratoxin A production. PLoS ONE 2014, 9, e108285. [Google Scholar] [CrossRef] [PubMed]
- Harnden, D.G. Iarc monographs on the evaluation of carcinogenic risk of chemicals to man. Vol. 10: Some naturally occurring substances. IARC Monogr. Eval. Carcinog. Risks Chem. Hum. 1977, 35, 125. [Google Scholar] [CrossRef]
- Commission of the European Communities. Commission regulation (EU) No 165/2010 of 26 February 2010 amending, Regulation (EC) No 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards aflatoxins. Off. J. Eur. Union L50 2010, 8–12. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?qid=1534863759388&uri=CELEX:32010R0165 (accessed on 26 February 2010).
- China National Food Safety Standard (GB 2761-2017), Maximum Limit of Mycotoxins in Food. 2017. Available online: http://www.nhfpc.gov.cn/sps/s7891/201704/b83ad058ff544ee39dea811264878981.shtml (accessed on 14 April 2017). (In Chinese)
- Sokolić-Mihalak, D.; Frece, J.; Slavica, A.; Delaš, F.; Pavlović, H.; Markov, K. The effect of wild thyme (Thymus Serpyllum L.) essential oil components against ochratoxin-producing Aspergilli. Arch. Ind. Hyg. Toxicol. 2012, 63, 457–462. [Google Scholar]
- Čvek, D.; Markov, K.; Frece, J.; Dragičević, T.; Majica, M.; Delaš, F. Growth inhibition of Aspergillus ochraceus ZMPBF 318 and Penicillium expansum ZMPBF 565 by four essential oils. Arch. Ind. Hyg. Toxicol. 2010, 61, 191–195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reddy, K.R.N.; Salleh, B.; Saad, B.; Abbas, H.K.; Abel, C.A.; Shier, W.T. An overview of mycotoxin contamination in foods and its implications for human health. Toxin Rev. 2010, 29, 3–26. [Google Scholar] [CrossRef]
- Al-Omair, A.; Helaleh, M.I.H. Selected-Ion storage GC–MS analysis of polycyclic aromatic hydrocarbons in palm dates and tuna fish. Chromatographia 2004, 59, 715–719. [Google Scholar] [CrossRef]
- Chen, P.J.; Moore, T.; Nesnow, S. Cytotoxic effects of propiconazole and its metabolites in mouse and human hepatoma cells and primary mouse hepatocytes. Toxicol. In Vitro 2008, 22, 1476–1483. [Google Scholar] [CrossRef] [PubMed]
- Chilvers, M.I.; Hay, F.S.; Hills, J.; Dennis, J.J.C.; Wilson, C.R. Influence of benzimidazole fungicides on incidence of Botrytis allii infection of onion leaves and subsequent incidence of onion neck rot in storage in Tasmania, Australia. Aust. J. Exp. Agric. 2006, 46, 1661–1664. [Google Scholar] [CrossRef]
- Isaac, S. What is the mode of action of fungicide and how do fungi develop resistance? Mycologist 1999, 13, 38–39. [Google Scholar] [CrossRef]
- López, A.G.; Theumer, M.G.; Zygadlo, J.A.; Rubinstein, H.R. Aromatic plants essential oils activity on Fusarium verticillioides Fumonisin B1 production in corn grain. Mycopathologia 2004, 158, 343–349. [Google Scholar] [CrossRef] [PubMed]
- Rasooli, I.; Rezaei, M.B.; Allameh, A. Growth inhibition and morphological alterations of Aspergillus niger by essential oils from Thymus eriocalyx and Thymus x-porlock. Food Control 2006, 17, 359–364. [Google Scholar] [CrossRef]
- Gallo, A.; Bruno, K.S.; Bruno, K.S.; Solfrizzo, M.; Perrone, G.; Mulè, G. New insight into the ochratoxin A biosynthetic pathway through deletion of a nonribosomal peptide synthetase gene in Aspergillus carbonarius. Appl. Environ. Microbiol. 2012, 78, 8208–8218. [Google Scholar] [CrossRef] [PubMed]
- Harris, J.P.; Mantle, P.G. Biosynthesis of ochratoxins by Aspergillus ochraceus. Phytochemistry 2001, 58, 709–716. [Google Scholar] [CrossRef]
- Huff, W.; Hamilton, P. Mycotoxins-their biosynthesis in fungi: Ochratoxins-metabolites of combined pathways. J. Food Prot. 1979, 42, 815–820. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, L.; Wu, F.; Liu, F.; Wang, Q.; Zhang, X.; Selvaraj, J.N.; Zhao, Y.; Xing, F.; Yin, W.-B.; et al. A consensus ochratoxin A biosynthetic pathway: Insights from the genome sequence of Aspergillus ochraceus and a comparative genomic analysis. Appl. Environ. Microbiol. 2018. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, Y.; Wang, Q.; Liu, F.; Selvaraj, J.N.; Liu, L. Functional characterization of new polyketide synthase genes involved in ochratoxin A biosynthesis in Aspergillus ochraceus fc-1. Toxins 2015, 7, 2723–2738. [Google Scholar] [CrossRef] [PubMed]
- Crespo-Sempere, A.; Marín, S.; Sanchis, V.; Ramos, A.J. VeA and LaeA transcriptional factors regulate ochratoxin A biosynthesis in Aspergillus carbonarius. Int. J. Food Microbiol. 2013, 166, 479–486. [Google Scholar] [CrossRef] [PubMed]
- Xing, F.; Hua, H.; Selvaraj, J.N.; Zhao, Y.; Zhou, L.; Liu, X.; Liu, Y. Growth inhibition and morphological alterations of Fusarium verticillioides by cinnamon oil and cinnamaldehyde. Food Control 2014, 46, 343–350. [Google Scholar] [CrossRef]
- Chao, S.C.; Young, D.G.; Oberg, C.J. Screening for inhibitory activity of essential oils on selected bacteria, fungi and viruses. J. Essent. Oil Res. 2000, 12, 639–649. [Google Scholar] [CrossRef]
- Yamamoto-Ribeiro, M.M.G.; Crespan, R.; Kohiyama, C.Y.; Ferreira, F.D.; Mossini, S.A.G.; Silva, E.L. Effect of Zingiber officinale essential oil on Fusarium verticillioides and fumonisin production. Food Chem. 2013, 141, 3147–3152. [Google Scholar] [CrossRef] [PubMed]
- Molania, T.; Moghadamnia, A.A.; Pouramir, M.; Aghel, S.; Moslemi, D.; Ghassemi, L.; Motallebnejad, M. The effect of cinnamaldehyde on mucositis and salivary antioxidant capacity in gamma-irradiated rats (a preliminary study). DARU J. Pharm. Sci. 2012, 20, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Taquchi, Y.; Hayama, K.; Okada, M.; Sagawa, T.; Arai, R.; Abe, S. Therapeutic effects of cinnamaldehyde and potentiation of its efficacy in combination with methylcellulose on murine oral candidiasis. Med. Mycol. J. 2011, 52, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Taguchi, Y.; Hasumi, Y.; Abe, S.; Nishhiyama, Y. The effect of cinnamaldehyde on the growth and the morphology of Candida albicans. Med. Mol. Morphol. 2013, 46, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Hong, D.; Han, M. Crystal structure of catena-bis (µ3-5-methoxyisophthalato)-bis(µ2-1,6-bis (imidazol-1-yl)-hexane) nickel (II), [Ni-2(CH3OC8H3O4)2(C12H18N4)2], C42H48N8Ni2O10. Z. Krist-New Cryst. St. 2013, 228, 434–436. [Google Scholar]
- Visvalingam, J.; Holley, R.A. Temperature-dependent effect of sublethal levels of cinnamaldehyde on viability and morphology of Escherichia coli. J. Appl. Microbiol. 2012, 113, 591–600. [Google Scholar] [CrossRef] [PubMed]
- Tyagi, A.K.; Malik, A. Liquid and vapour-phase antifungal activities of selected essential oils against Candida albicans: Microscopic observations and chemical characterization of Cymbopogon citratus. BMC Complement. Altern. Med. 2009, 10, 65. [Google Scholar] [CrossRef] [PubMed]
- De Billerbeck, V.G.; Roques, C.G.; Bessiére, J.M.; Fonvieille, J.L.; Dargent, R. Effects of Cymbopogon nardus (L.) W. Watson essential oil on the growth and morphogenesis of Aspergillus niger. Can. J. Micro Biol. 2001, 47, 9–17. [Google Scholar] [CrossRef]
- Khan, M.S.A.; Ahmad, I. In vitro antifungal, anti-elastase and anti-keratinase activity of essential oils of Cinnamomum-, Syzygium- and Cymbopogon-species against Aspergillus fumigatus and Trichophyton rubrum. Phytomedicine 2011, 19, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Bang, K.H.; Lee, D.W.; Park, H.M. Inhibition of fungal cell wall synthesizing enzymes by trans-cinnamaldehyde. Biosci. Biotech. Biochem. 2000, 64, 1061–1063. [Google Scholar] [CrossRef]
- Ka, H.; Park, H.J.; Jung, H.J.; Choi, J.W.; Cho, K.S.; Ha, J. Cinnamaldehyde induces apoptosis by ROS-mediated mitochondrial permeability transition in human promyelocytic leukemia HL-60 cells. Cancer Lett. 2003, 196, 143–152. [Google Scholar] [CrossRef]
- Jahanshiri, Z.; Shams-Ghahfarokhi, M.; Allameh, A.; Razzaghi-Abyaneh, M. Effect of curcumin on Aspergillus parasiticus growth and expression of major genes involved in the early and late stages of aflatoxin biosynthesis. Iran. J. Public Health 2012, 41, 72–79. [Google Scholar] [PubMed]
- Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Zhou, L.; Zhao, Y.; Wang, Y.; Liu, Y. Inhibitory effect of cinnamaldehyde, citral and eugenol on aflatoxin biosynthetic gene expression and aflatoxin B1 biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, M2917–M2924. [Google Scholar] [CrossRef] [PubMed]
- Hua, S.S.T.; Beck, J.J.; Sarreal, S.B.L.; Gee, W. The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus. Mycotoxin Res. 2014, 30, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Yahyaraeyat, R.; Khosravi, A.R.; Shahbazzadeh, D.; Khalaj, V. The potential effects of Zataria multiflora Boiss essential oil on growth, aflatoxin production and transcription of aflatoxin biosynthesis pathway genes of toxigenic Aspergillus parasiticus. Braz. J. Microbiol. 2013, 44, 643–649. [Google Scholar] [CrossRef] [PubMed]
- Caceres, I.; Khoury, R.E.; Bailly, S.; Oswald, I.P.; Puel, O.; Bailly, J.-D. Piperine inhibits aflatoxin B1 production in Aspergillus flavus by modulating fungal oxidative stress response. Fungal Genet. Biol. 2017, 107, 77–85. [Google Scholar] [CrossRef] [PubMed]
- Lv, C.; Wang, P.; Ma, L.; Zheng, M.; Liu, Y.; Xing, F. Large-scale comparative analysis of eugenol-induced/repressed genes expression in Aspergillus flavus using RNA-seq. Front. Microbiol. 2018, 9, 1116. [Google Scholar] [CrossRef] [PubMed]
- Gerin, D.; De Miccolis Angelini, R.M.; Pollastro, S.; Faretra, F. RNA-Seq reveals OTA-related gene transcriptional changes in Aspergillus carbonarius. PLoS ONE 2016, 11, e0147089. [Google Scholar] [CrossRef] [PubMed]
- Gil-Serna, J.; García-Díaz, M.; González-Jaén, M.T.; Vázquez, C.; Patiño, B. Description of an orthologous cluster of ochratoxin A biosynthetic genes in Aspergillus and Penicillium species. A comparative analysis. Int. J. Food Microbiol. 2018, 268, 35–43. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Ni, M.; Jeong, K.C.; Kim, Y.H.; Yu, J.H. The role, interaction and regulation of the velvet regulator VelB in Aspergillus nidulans. PLoS ONE 2012, 7, e45935. [Google Scholar] [CrossRef] [PubMed]
- Soliman, K.M.; Badeaa, R.I. Effect of oil extracted from some medicinal plants on different mycotoxigenic fungi. Food Chem. Toxicol. 2002, 40, 1669–1675. [Google Scholar] [CrossRef]
- Leong, S.L.L.; Hocking, A.D.; Scott, E.S. Effect of temperature and water activity on growth and ochratoxin A production by Australian Aspergillus carbonarius and A. niger isolates on a simulated grape juice medium. Int. J. Food Microbiol. 2006, 110, 209–216. [Google Scholar] [CrossRef] [PubMed]
- Copetti, M.V.; Iamanaka, B.T.; Mororó, R.C.; Pereira, J.L.; Frisvad, J.C.; Taniwaki, M.H. The effect of cocoa fermentation and weak organic acids on growth and ochratoxin A production by Aspergillus species. Int. J. Food Microbiol. 2012, 155, 158–164. [Google Scholar] [CrossRef] [PubMed]
- Scudamore, K.A.; Macdonald, S.J. A collaborative study of an HPLC method for determination of ochratoxin A in wheat using immunoaflinity column clean-up. Food Addit. Contam. 1998, 15, 401–410. [Google Scholar] [CrossRef] [PubMed]
- Bray, D. Critical point drying of biological specimens for scanning electron microscopy. In Supercritical Fluid Methods and Protocols; Williams, J.R., Clifford, A.A., Eds.; Humana Press: New York, NY, USA, 2000; Volume 13, pp. 235–243. [Google Scholar]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinf. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Xing, F.; Wang, L.; Liu, X.; Selvaraj, J.N.; Wang, Y.; Zhao, Y.; Liu, Y. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus. Int. J. Food Microbiol. 2017, 256, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, F.; Wang, L.; Wang, Q.; Selvaraj, J.N.; Zhao, Y.; Wang, Y.; Xing, F.; Liu, Y. pH-signaling transcription factor AopacC regulators ochratoxin A biosynthesis in Aspergillus ochraceus. J. Agric. Food Chem. 2018, 66, 4394–4401. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Concentration of Cinnamaldehyde (mmol/L) | OTA Production (ng/mm2 colony) | Inhibition Ratio (%) |
---|---|---|
0 | 1.90 ± 0.45 a | - |
0.4 | 0.34 ± 0.14 b | 82.0 |
1.0 | 0.03 ± 0.03 c | 98.7 |
1.6 | 0.00 ± 0.00 d | 100.0 |
Gene | Primer Name | Primers (5′ to 3′) | Product Length (bp) |
---|---|---|---|
GADPH | G-F G-R | CGCTCAGAACATCATCCCCA ATGTCCTCGTAGGTGACGGA | 142 |
pks | P-F P-R | CGCCTCATCATCAATCCTT CAACTCGGTCAAGCAGAT | 144 |
nrps | N-F N-R | TGTGGACATCTGGAAGCA GTGAACGAGGTGAATTGGA | 136 |
veA | VA-F VA-R | ACCAACATCAGCCGTGTCAT GTACGAGTCAGGCGTGGAAA | 159 |
laeA | L-F L-R | GCCCAATAGCCCACAACTCT TGTACCACCGAGCAACCTTC | 141 |
velB | VB-F VB-R | TACTATTCGGGAGGCGGTCA TTGTTGTCGGGATCGGTCAG | 143 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Jin, J.; Liu, X.; Wang, Y.; Liu, Y.; Zhao, Y.; Xing, F. Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis. Toxins 2018, 10, 340. https://doi.org/10.3390/toxins10090340
Wang L, Jin J, Liu X, Wang Y, Liu Y, Zhao Y, Xing F. Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis. Toxins. 2018; 10(9):340. https://doi.org/10.3390/toxins10090340
Chicago/Turabian StyleWang, Limin, Jing Jin, Xiao Liu, Yan Wang, Yang Liu, Yueju Zhao, and Fuguo Xing. 2018. "Effect of Cinnamaldehyde on Morphological Alterations of Aspergillus ochraceus and Expression of Key Genes Involved in Ochratoxin A Biosynthesis" Toxins 10, no. 9: 340. https://doi.org/10.3390/toxins10090340