The Relationship Analysis on Corn Stalk Rot and Ear Rot According to Fusarium Species and Fumonisin Contamination in Kernels
by
,
Lina Li
1,†, 
Qing Qu
1,†,
Zhiyan Cao
1,*,
Zhengyu Guo
2,
Hui Jia
1,
Ning Liu
1,
Yanhui Wang
1,* and
Jingao Dong
1,* 1
Plant Pathogenic Mycotoxin and Molecular Plant Pathology Laboratory of Hebei Agricultural University, Hebei Key Laboratory of Plant Physiology and Molecular Pathology, Hebei Agricultural University, Baoding 071001, China
2
Maize Research Institute to Shanxi Academy of Agriculture Sciences, Xinzhou 034000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Toxins 2019, 11(6), 320; https://doi.org/10.3390/toxins11060320
Submission received: 12 April 2019
/
Revised: 28 May 2019
/
Accepted: 4 June 2019
/
Published: 5 June 2019
(This article belongs to the Special Issue Fungal Infestations in Humans, Animals, Crops)
Abstract
:Fusarium diseases, including corn root rot, sheath rot, stalk rot, and ear rot are frequently occurring in maize producing areas of China. Fusarium stalk rot and ear rot are the most serious diseases and often occur at the same time, but it is unclear whether there is a correlation between Fusarium composition and disease occurrence. This study was conducted to clarify the relationship between the two diseases. A total of 49 corn stalk rot samples were collected from 15 regions of eight provinces in China from 2016 to 2018. The pathogens were isolated and identified separately from stalks, ear stems, and kernels. The contents of the fumonisins (FB1 and FB2) were detected in kernels. The results showed that the main Fusarium species were found in corn kernels, ear stems and stalks at the same time. The results showed that 1201 strains of Fusarium verticillioides, 668 strains of Fusarium oxysporum, 574 strains of Fusarium graminearum species complex (FGSC), 318 strains of Fusarium equiseti, 95 strains of Fusarium proliferatum, and 40 strains of Fusarium subglutinans were isolated from 1470 corn kernels, 245 ear stems, and 1225 stalks randomly selected from 49 samples. The contamination rate of fumonisins in the 49 samples was 57.1% with an average content of 1.9 μg/g, of which four samples exhibited higher levels as set by the European Commission (4.0 μg/g). These results provide a certain association between stalk rot and ear rot and lay a foundation to study the relationships among Fusarium maize diseases.
Key Contribution: The relationship of pathogen composition from stalks, ear stems, and kernels of corn stalk rot samples was clarified in 15 regions of eight provinces in China from 2016 to 2018. Fumonisin contamination was determined in kernels.
1. Introduction
Maize is an important grain and feed crop. The global requirement for maize continues to grow with the increase in feed and industrial processing demands. In recent years, maize planting has often been threatened by Fusarium spp. and Fusarium diseases frequently occur in maize-producing areas in China. The major Fusarium diseases include corn root rot, sheath rot, stalk rot, and ear rot. Fusarium stalk rot and ear rot are the most serious diseases, as they not only reduce maize yield but the toxins produced by Fusarium also seriously endanger human and animal health. The Fusarium diseases often occur simultaneously.
Corn stalk rot is one of the most destructive corn diseases worldwide, which causes maize lodging and reduces grain weight and yield. Stalk rot typically reduces maize output by 10.0% [1] and may increase to 30.0% to 50.0% in serious cases [2]. The disease was first reported abroad at the beginning of the last century. In the United States and Ontario Canada, it caused yield losses of 349.2 million bushels in 2014 [3]. In China, the disease was widespread in the Northeast region from 2013 to 2015 [4]. In 2014 and 2017, epidemics broke out in the Huang-Huai-Hai region [5,6], and it was serious in 2016 from northern Shanxi Province to western Gansu Province [7]. Stalk rot is caused by many species of Fusarium and Pythium. F. verticillioides, F. subglutinans, and F. proliferatum are important fungi that have caused significant losses of maize in the USA [8,9,10,11]. It was reported that corn stalk rot is mainly caused by F. moniliforme in Hebei, Hubei, and Guangxi Provinces of China [12], while F. graminearum is the main pathogen in Shaanxi, Jilin, and Henan Provinces of China [13]. Pathogen composition is affected by the local environment, and climate conditions and different pathogenic compositions of stalk rot occur in different years in the same area.
Maize ear rot is one of the most prevalent diseases, and the main pathogen is Fusarium spp., including F. verticillioides, F. graminearum species complex (FGSC), F. oxysporum, F. equiseti, and F. subglutinans [14,15,16,17]. Damage from maize ear rot has been on the rise in all maize producing areas in China in recent years. A survey of 10 counties and cities in five provinces of the Huang-Huai-Hai region of China in 2004 showed that the average incidence of ear rot was 42.9% [18]. In 2009, ear rot was serious in all maize growing areas of Gansu Province, with an average ear rate of 63.6% [19]. The occurrence of maize ear rot has also been reported in other countries, among which ear rot in Mexico and Argentina has caused serious losses [20,21]. Fusarium spp. produce mycotoxins that are synthesized directly and accumulate in grains; thus, seriously threatening the health of humans and livestock [22,23,24]. The most common Fusarium toxins are the fumonisins (FBs), which are mainly produced by F. verticillioides. Fumonisin B1 (FB1) and fumonisin B2 (FB2) are major secondary metabolites of FBs [25]. It has been reported that 50.0% of ear samples are contaminated with FBs in Hebei, Inner Mongolia, Yunnan, Guizhou, Heilongjiang, Liaoning, and Ningxia Provinces [26]. The fumonisins are carcinogenic in humans and livestock and even cause equine leukoencephalomalacia, rat hepatocarcinoma, and porcine pulmonary edema [27,28]. The European Commission (EC) has declared a maximum limit of 4.0 µg/g for unprocessed maize and the US Food and Drug Administration (FDA) has set a maximum level of 2.0 µg/g for maize and maize-based products intended for human consumption [29,30].
Few studies have been conducted on the pathogenic composition between maize ear rot and stalk rot. In this study, the relationship between corn stalk rot and ear rot was analyzed by isolating and identifying Fusarium species from stalks, ear stems, and kernels of stalk rot samples. Thus, the present study aimed to provide insight into the relationship between corn stalk rot and ear rot. The study will provide a new perspective for studies on the occurrence pattern of Fusarium spp.
2. Results
2.1. Frequency of Fusarium spp. in Samples
The pathogens were isolated and identified from stalks, ear stems, and corn kernels of 20 samples in 2016 (Table S1). In stalks, the isolation frequencies of F. equiseti, F. verticillioides, F. oxysporum, FGSC, F. subglutinans, and F. proliferatum were 29.2% (136), 27.1% (126), 21.5% (100), 18.3% (85), 1.9% (9), and 1.1% (5), respectively. F. equiseti, F. verticillioides, F. oxysporum, FGSC, and F. proliferatum were isolated from ear stems, with frequencies of 33.3% (31), 28.0% (26), 17.2% (16), 14.0% (13), and 5.4% (5), respectively. In corn kernels, F. verticillioides, F. oxysporum, F. equiseti, FGSC, F. subglutinans, and F. proliferatum were isolated, with frequencies of 38.0% (228), 36.8% (221), 19.3% (116), 17.8% (107), 3.8% (23), and 0.7% (4), respectively. The main pathogens isolated from stalk, ear stems, and kernels and their isolation frequencies were similar.
Thirteen corn stalk rot samples were collected and the pathogens were identified in 2017. In stalks, F. verticillioides, F. oxysporum, F. proliferatum, FGSC, and F. equiseti were isolated, with frequencies of 64.1% (205), 59.7% (191), 8.8% (28), 2.2% (7), and 1.9% (6), respectively. In ear stems, F. verticillioides, F. oxysporum, F. equiseti, FGSC, and F. proliferatum were isolated, with frequencies of 69.2% (45), 53.8% (35), 15.4% (10), 10.8% (7), and 6.2% (4), respectively. In corn kernels, F. verticillioides, F. oxysporum, FGSC, and F. proliferatum were isolated, with frequencies of 65.9% (257), 33.9% (87), 18.7% (73), and 10.5% (41), respectively. These results show that the composition of the pathogens isolated from different parts of maize is highly consistent.
The pathogens from 16 samples were isolated and identified in 2018. In stalks, FGSC, F. verticillioides, and F. equiseti were isolated, with frequencies of 49.5% (193), 24.4% (95), and 2.3% (9), respectively. In ear stems, FGSC, F. verticillioides, F. oxysporum, F. equiseti, F. proliferatum, and F. subglutinans were isolated, with frequencies of 41.3% (33), 38.8% (31), 10.0% (8), 8.8% (7), 5.0% (4), and 5.0% (4), respectively. In corn kernels, F. verticillioides, FGSC, F. oxysporum, F. equiseti, F. proliferatum, and F. subglutinans were isolated, with frequencies 38.1% (183), 12.5% (60), 2.1% (10), 1.5% (7), 0.8% (4), and 0.8% (4), respectively. The main pathogens isolated were the same, and F. verticillioides was the most important pathogen of kernels.
2.2. Fusarium Species in Stems and Ears from Corn Stalk Rot Samples
Based on morphological and molecular identification, a total of 2896 Fusarium isolates and six Fusarium species were obtained and identified. All specimens were collected from 15 regions in eight provinces from 2016 to 2018. The pathogens isolated from corn kernels, ear stems, and stalks included F. verticillioides, F. oxysporum, FGSC, F. equiseti, F. proliferatum, and F. subglutinans, with the number of strains isolated of Fusarium from different parts were different. The number of isolates of F. verticillioides was the highest in all parts (Table 1).
2.3. Frequency of Fusarium spp. in Different Parts of Corn
The Fusarium species and their isolation frequency from corn stalks, ear stems, and kernels were consistent from 2016 to 2018. The Fusarium species and their isolation frequency in corn stalks, ear stems, and kernels differed in the eight regions in 2016 (Figure 1). All Fusarium isolated from corn kernels and ear stems were isolated from stalks in Changzhi, Wuwei, Changwu, Yulin, Yongning, and Tongxin. The main Fusarium species from corn kernels and ear stems were isolated from stalks in Xinzhou and Pingliang.
In 2017, F. verticillioides and F. oxysporum were isolated from kernels, ear stems, and stalks in Tongxin, Harbin, Shenyang, Tieling, and Tongliao; FGSC was isolated from stalks in Changzhi; and F. verticillioides was isolated from stalks in Panjin and Tonghua. In Changwu, the main Fusarium isolates from corn kernels and ear stems were isolated from stalks at the same time (Figure 2).
The same results were observed in Changzhi, Xinzhou, Zhenyuan, Changwu, Yulin, and Tongxin in 2018 (Figure 3). This observation indicates that there is a correlation between stem rot and ear rot.
2.4. Fusarium Species in the Different Regions
F. verticillioides, F. oxysporum, F. equiseti, and FGSC were the main pathogens, but there were different isolation frequencies of Fusarium spp. in 49 samples in 2016, 2017, and 2018 (Table 2, Table 3 and Table 4). F. verticillioides was the main pathogen in samples collected from Pingliang (42.1%), Xinzhou (39.2%), Tongxin (61.7%) in 2016, Harbin (60.8%), Tieling (88.3%), Shenyang (67.5%), Tongxin (85.8%), Panjin (48.3%), Tonghua (75.0%), and Tongliao (80.0%) in 2017, Xinzhou (45.7%), Yulin (41.7%), Changwu (41.7%) in 2018. F. oxysporum had a relatively high isolation frequency in the samples from Wuwei (40.3%), Yongning (15.0%) in 2016. FGSC also had a high frequency of isolation from Changzhi (49.4%), Yulin (38.3%) in 2016, Changwu (58.3%), Changzhi (61.7%) in 2017, Zhenyuan (30.0%), Changzhi (38.3%), Tongxin (51.7%) in 2018.
2.5. Analysis of Fusarium spp. in Different Maize Varieties
The infection degree and Fusarium species of maize varieties are different, it mainly related to geographical location and maize varieties. Zhengdan 958 and Xianyu 335 are the main maize varieties cultured in China. The Fusarium contamination rate of Zhengdan 958 was higher in stalks than that of Xianyu 335 in Changzhi, Wuwei, Shenyang, Tongxin, Xinzhou, and Zhenyuan from 2016 to 2018 (Figure 4, Figure 5 and Figure 6). The Fusarium infection rate of Zhengdan 958 was the same as that of Xianyu 335 in Xinzhou and Changwu in 2016, while the isolation rate from Zhengdan 958 was lower than that of Xianyu 335 in Pingliang in 2016 and in Tieling in 2017.
The isolation rate of Fusarium from ear stems of Zhengdan 958 was higher than that of Xianyu 335 in Wuwei, Shenyang, and Tongxin in 2016 and 2017. The isolation rate of Zhengdan 958 was the same as that of Xianyu 335 in other regions in 2016 and 2017. In 2018, the Fusarium contamination rate of Xianyu 335 was higher than that of Zhengdan 958 in Changzhi, Zhenyuan, Xinzhou, and Tongxin.
No Fusarium contamination was detected in kernels of either variety from Pingliang or Changwu in 2016. The same isolation rate of Fusarium was detected in Zhengdan 958 and Xianyu 335 in Changzhi in 2016, 2018 and Shenyang in 2017. The Fusarium infection rate of Zhengdan 958 was lower than that of Xianyu 335 only in Xinzhou and Wuwei in 2016. The proportion of Zhengdan 958 contaminated by Fusarium in the remaining five areas (Tieling, Tongxin in 2017; Xinzhou, Zhenyuan, and Tongxin in 2018) was higher than that of Xianyu 335. From the above results, about 67% of the stalks from maize variety Zhengdan 958 were infected by Fusarium, which was higher than 16.7% of Xianyu 335.
2.6. Analysis of FBs in Kernels
The incidence and levels of fumonisins in maize kernel samples of different regions were tested in 2016, 2017, and 2018 (Table 5, Table 6 and Table 7). A total of 57.1% of all maize samples from 49 samples in 15 regions were contaminated with fumonisins. FBs production in samples was from undetectable (nd) to 5.4 μg/g, 1.1 μg/g, 10.1 μg/g in 2016, 2017, and 2018, respectively. The average concentration of FBs in 2016, 2017, and 2018 were lower than the maximum level (4.0 μg/g) set by the EC. However, some individual samples had higher contamination. The most seriously contaminated area was Yulin (FB1 + FB2, 10.1 μg/g), followed by Xinzhou (FB1 + FB2, 6.5 μg/g), Changwu (FB1 + FB2, 5.4 μg/g), and the main pathogen in these areas was F. verticillioides, with an isolation frequency of 100.0%.
As shown in Figure 7, different regions had diverse incidences and contamination levels of FBs. About 8.2% of all maize samples were contaminated by more than 4.0 μg/g, as set by the EC, whereas 20.4% of all maize samples were contaminated by more than 2.0 μg/g, as set by the FDA. Yulin (33.3%), Changwu (20.0%), Changzhi (14.3%), and Xinzhou (14.3%) had higher FBs levels than those recommended by the EC. None of the samples from the other 11 regions contained FBs levels above 4.0 μg/g, and 42.9% of all maize samples had nd levels in Changzhi (28.6%), Xinzhou (42.9%), Wuwei (40.0%), Changwu (20.0%), Tongxin (60.0%), Pingliang (50.0%), Yulin (three samples, 33.3%), Harbin (100.0%), Shenyang (100.0%), Tieling (50.0%), Yongning (100.0%), and Panjin (100.0%).
3. Discussion
Fusarium spp. is a significant pathogen that causes ear rot and stalk rot in maize. F. verticillioides and F. graminearum are the predominant species causing maize kernel rot in Huang-Huai-Hai and Northeast China [31]. Many studies have focused on the ear rot seed pathogens, but few have reported on the pathogens of ear rot from corn stalk rot samples. Our results indicated that F. verticillioides, F. oxysporum, and FGSC were the predominant pathogens of maize stalk rot in Northwest China. There were differences in the Fusarium species isolated from samples collected from the different regions, mainly related to geographic location and climatic factors during the growing season, such as precipitation, relative humidity, and temperature (Table S2). A relationship has been between the etiology of the Fusarium that produces stalk rot and ear rot [32,33,34]. The same kind of Fusarium from both diseases can cross-infect. Maize stalk rot aggravates the occurrence of ear rot.
Contamination of kernels with mycotoxin in the field is heavily influenced by multiple factors, such as the pathogen, environmental conditions (temperature, humidity, pH, and light), and host resistance. The production of FBs is closely related to the species of Fusarium and the environmental conditions under which it grows. The Fusarium species and ability of FBs to affect the host produced by different species varies [35,36]. From 2016 to 2018, 28 of the 49 samples were contaminated with FBs, with a contamination rate of 57.1%. Two maize samples were contaminated by more than 4.0 μg/g, as set by the EC, whereas 10 maize samples were contaminated by more than 2.0 μg/g, as set by the FDA. Areas with a high isolation frequency of F. verticillioides do not necessarily have a high level of FBs pollution. In addition to climatic conditions and the ability of strains to produce toxins, the interaction between strains also affects the production of FBs. Resistant varieties should be planted to minimize the risk of FBs to humans and livestock and avoid long-term consumption of corn or corn products with high FBs contents.
Maize stalk rot is a typical transmitted disease occurring during the filling stage of maize. The peak of the disease occurs in the late milk to wax ripening stage. Stem base disease, a hollow interior, and blocked nutrient transport will occur once the disease strikes, seriously limiting yield and 100-grain weight [37]. The disease will affect lodging and a late mechanized harvest [38]. Most stem rot disease infects at the seedling stage, and the pathogen continues to infect throughout the growth period. In severe cases, the pathogen enters the ear of the maize and develops into ear rot [32]. We isolated and identified Fusarium spp. from ear stems, stalks, and kernels (Figure 8) and found that the main Fusarium isolated from corn kernels and ear stems was isolated from stalks, indicating that the pathogen in kernels caused by a systemic infection in the stalk and pathogens carried in the air may aggravate the occurrence of the diseases. Breeding maize varieties resistant to stem rot is the most economical and effective way to prevent the disease [39]. Zhengdan 958 and Xianyu 335 are the main maize varieties in maize producing areas and are the dominant varieties in production [40]. In stalks, 66.7% of the Zhengdan 958 samples were contaminated with Fusarium, which was higher than that of Xianyu 335, but only 25.0% of ear stems and 41.7% of kernels were contaminated (Figure 4, Figure 5 and Figure 6). We will further study the relationship between the maize stalk rot and ear rot to breed disease-resistant varieties.
The pathogen isolation analysis showed a correlation between maize stalk rot and ear rot. It is unknown whether the early invasion by pathogens causes stem rot and ear rot, or whether the nutritional supply is insufficient after stalk rot emerges; plants undergo premature senescence, with a decline in resistance, and ears hang upside down. We plan to detect the spread of pathogens in plants and the relationship between infections of different Fusarium species by labeling strains with different colored fluorescence.
4. Materials and Methods
4.1. Sample Collection and Fungus Isolation and Identification
A total of 49 whole plant corn stalk rot samples representative of corn stalk rot were collected from eight provinces in China from 2016 to 2018 (Figure 9) (Tables S3 and S4). The 30 kernels collected from each sample were soaked in a 1.0% sodium hypochlorite solution for 3 min. Five blocks of ear stems were collected from each sample, and 25 samples from two nodes of stalks near the ground were soaked in 75% anhydrous ethanol, then rinsed three times with sterile water. These kernels and blocks were dried with sterile filter paper and placed on a potato dextrose agar (potato infusion 200.0 g, dextrose 20.0 g, agar 13.0 g, and distilled water 1000 mL) plate for culture for 5 to 6 days at 25 °C. The strain was isolated and identified. The frequency of Fusarium isolates was calculated. The frequency of Fusarium isolates = number of Fusarium strains/number of isolated kernels (or blocks) × 100%.
4.2. Identification of Pathogenic Fungi
Genomic DNA was extracted from aerial mycelia using the CTAB method and was validated by species-specific polymerase chain reaction (PCR) (The specific primers were showed in Table 8). Each PCR reaction system (20.0 µL) consisted of a DNA template (2.0 µL), upstream and downstream primers (1.0 µL each), 2× Taq PCR Master Mix (10.0 µL), and double distilled H2O (6.0 µL).
The PCR amplification program was initiated at 95 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, annealing for 30 s, annealing temperature according to the primers at 72 °C for 1 min, with a final extension at 72 °C for 10 min. Electrophoretic analysis of the PCR-amplified products was performed on a 1.0% agarose gel.
4.3. Detection of Fumonisin FB1 and FB2
The FBs were analyzed according to a published method [44]. Ten grams of each ground maize sample was randomly and accurately weighed into a 250-mL conical flask and hydrated for 12 h with 10.0 mL ultrapure water. After 12 h, 30.0 mL acetonitrile was added to the mixtures and shaken at 120 r/min for 1 h on a shaking table. The sample extract was filtered through neutral filter paper and collected in a 50-mL plastic centrifuge tube. Eight milliliters of the filtered extract was evaporated and dried. The dried sample residues were re-dissolved in 2.0 mL acetonitrile–water (1:1, v/v) and filtered through a 0.22 µm nylon filter, before the high-performance liquid chromatography (HPLC) analysis [44,45].
The FB1 and FB2 contents were detected in this experiment according to a previous method. The incidence and contamination levels of FB1 and FB2 were analyzed by HPLC coupled with fluorescence detection following o-phthaldialdehyde derivatization [46].
4.4. Chemicals and Reagents
The Taq PCR Master Mix, DNA Marker DL2000 were acquired from TransGen Biotech (Beijing, China). Sodium hypochlorite solution, dextrose, agar were purchased from BBI Life Sciences Corporation. FB standards (FB1 and FB2) were obtained from Sigma Chemical Co. (St. Louis, MO, USA). HPLC-grade acetonitrile and methanol used for sample preparation and mobile phase were supplied by Dikma (Lake Forest, CA, USA). 2-Mercaptoethanol, OPA, and potassium borate buffer o-phthalaldehyde diluent (OD104) were purchased from Pickering Laboratories (Mountain View, CA, USA). Ultrapure water was prepared in all analytical steps using a Barnstead LabTower EDI water purification system (ThermoFisher Scientific, Waltham, MA, USA).
Supplementary Materials
The following are available online at https://www.mdpi.com/2072-6651/11/6/320/s1, Table S1: Isolation frequency of Fusarium species in 49 samples in 2016, 2017, 2018. Table S2: Sampling information. Table S3: Sample collection of corn stalk rot. Table S4: Supplementary samples of corn stalk rot.
Author Contributions
J.D., Y.W. and Z.C. conceived and designed the experiments; L.L. and Q.Q. performed the experiments; L.L., Z.C. and Q.Q. analyzed the data; Z.G., H.J. and N.L. contributed reagents/materials/analysis tools; L.L. and Z.C. wrote and revised the paper.
Funding
This work was supported by the China Agriculture Research System(CARS-02).
Acknowledgments
We are grateful to Yingchao Liu and Minhao Pang (Hebei Agricultural University College of Plant Protection）for providing High performance liquid Chromatography and related experimental techniques.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Li, W.J.; He, P.; Jin, J.Y. Effect of potassium on ultrastructure of maize stalk pith and young root and their relation to stalk tot resistance. Agric. Sci. China 2010, 9, 1467–1474. [Google Scholar] [CrossRef]
- Yu, C.J.; Saravanakumar, K.; Xia, H.; Gao, J.X.; Fu, K.H.; Sun, J.N.; Dou, K.; Chen, J. Occurrence and virulence of Fusarium spp. associated with stalk rot of maize in North-East China. Physiol. Mol. Plant Pathol. 2017, 98, 1–8. [Google Scholar] [CrossRef]
- Wang, C.; Yang, Q.; Wang, W.X.; Li, Y.P.; Guo, Y.L.; Zhang, D.F.; Ma, X.N.; Song, W.; Zhao, J.R.; Xu, M.L. A transposon-directed epigenetic change in ZmCCT underlies quantitative resistance to Gibberella stalk rot in maize. New Phytol. 2017, 215, 1503–1515. [Google Scholar] [CrossRef] [PubMed]
- Xie, L.H.; Chen, M.L.; Ma, T.; Gao, H.; Lu, P.A. Investigation on occurrence factors of corn stem base rot in Heilongjiang province in 2014. Mod. Agric. 2015, 6, 68–69. [Google Scholar]
- Wang, L.F.; Xu, G.J.; Zhang, S.L.; Zhang, J.K.; Lu, R.Q.; Li, C.J.; Wang, H.J.; Li, F.Z. Analysis of the resistance to stalk rot and yield loss evaluation of 25 maize varieties. J. Maize Sci. 2015, 23, 12–17. [Google Scholar]
- Li, X.J.; Zhang, G.G.; Wu, M.Q.; Hou, T.R.; Li, N.; Qiu, M. Effect of stem rot disease at late maturity on thousand-grain weight of summer corn. Shandong Agric. Sci. 2015, 47, 93–95. [Google Scholar]
- Wang, Z.Y.; Wang, X.M. Current status and management strategies for corn pets and diseases in China. Plant Prot. 2019, 45, 1–11. [Google Scholar]
- Pronczuk, M.; Pronczuk, S.; Messyasz, M. Pathogenicity of Fusarium spp. contributing to the stalk rot of maize in Poland. Mycotoxin Res. 1991, 7, 97–101. [Google Scholar] [CrossRef]
- Mathew, R.; Singh, K.K.; Paul, B. Pythium campanulatum sp. nov., isolated from the rhizosphere of maize, its taxonomy, ITS region of rDNA, and comparison with related species. FEMS Microbiol. Lett. 2003, 226, 9–14. [Google Scholar] [CrossRef]
- Sinha, S.K.; Prasad, M. Bacterial stalk rot of maize, its symptoms and host-range, Zentralblatt fur Bakteriol. Parasitenkd. Infekt. Hyg. Zweite natur-wissenschaftliche Abt Allg. Landwirtsch. Tech. Mikrobiol. 1997, 132, 81–88. [Google Scholar]
- El-Helaly, A.F.; Abo-El-Dahab, M.K.; El-Goorani, M.A.; Gabr, M.R. Identification of Erwinia sp., causing stalk rot of maize in Egypt. Zent. Bakteriol. Parasitenkd. Infekt. Hyg. Zweite Nat. Abt. Mikrobiol. Landwirtsch. Technol. Umweltschutzes 1978, 133, 680–685. [Google Scholar] [CrossRef]
- Ma, C.Y.; Yao, L.S.; Du, F.L.; Xu, M.L. Research progress on resistance of maize to stem rot. J. Maize Sci. 2018, 10, 131–137. [Google Scholar]
- Zhang, M.Z.; Wang, S.Z.; Wang, Z.Y.; Zhou, T. A preliminary study on the pathogens of corn bacterial wilt in Henan province. J. Henan Agric. Univ. 1988, 22, 135–148. [Google Scholar]
- Andreas, G.; Erich-Christian, O.; Ulrike, S.; Cees, W.; Ineke, V.; Heinz-Wilhelm, D. Biodiversity of Fusarium species causing ear rot of maize in Germany. Cereal Res. Commun. 2008, 36, 617–622. [Google Scholar]
- Qin, Z.H.; Ren, X.; Jiang, K.; Wu, X.F.; Yang, Z.H.; Wang, X.M. Identification of Fusarium species and F. graminearum species complex causing maize ear rot in China. Acta Phytophysiol. Sin. 2014, 41, 589–596. [Google Scholar]
- Ammar, M.; Merfat, A.; Walid, N.; Paul, H.V.; Mohammad, H. Morphological and molecular characterization of Fusarium isolated from maize in Syria. J. Phytopathol. 2013, 161, 452–458. [Google Scholar]
- Rahjoo, V.; Zad, J.; Javan-Nikkhah, A.; Mirzadi, G.A.; Okhovvat, S.M.; Bihamta, M.R.; Razzaghian, J.; Klemsdal, S.S. Morphological and molecular identification of Fusarium isolated from maize ears in Iran. J. Plant Pathol. 2008, 90, 463–468. [Google Scholar]
- Shi, J.; Wang, Z.Y.; He, K.L. Occurrence trend and cause analysis of summer maize diseases and insect pests in Huang-Huai-Hai region. Plant Prot. 2005, 31, 63–65. [Google Scholar]
- Guo, M.K.; Wang, X.M.; He, S.Q.; Liu, Y.G.; Jin, S.L.; Cao, S.Q.; Wei, H.Y. Occurrence of maize kernel rot and corn stalk rot in Gansu in 2009. Plant Prot. 2011, 37, 134–137. [Google Scholar]
- Morales-Rodríguez, I.; de Yañz-Morales, M.J.; Silva-Rojas, H.V.; García-de-los-Santos, G.; Guzman-de-Pena, D.A. Biodiversity of Fusarium species in Mexico associated with ear rot in maize, and their identification using a phylogenetic approach. Mycopathologia 2007, 163, 31–39. [Google Scholar] [CrossRef]
- Chulze, S.N.; Ramirez, M.L.; Torres, A.; Leslie, J.F. Genetic variation in Fusarium section Liseola from No-Till maize in Argentina. Appl. Environ. Microbiol. 2000, 66, 5312–5315. [Google Scholar] [CrossRef] [PubMed]
- Brown, D.W.; Dyer, R.B.; McCormick, S.P.; Kendra, D.F.; Plattner, R.D. Functional demarcation of the Fusarium core trichothecene gene cluster. Fungal Genet. Biol. 2004, 41, 454–462. [Google Scholar] [CrossRef] [PubMed]
- Alexander, N.J.; Proctor, R.H.; McCormick, S.P. Genes, gene clusters, and biosynthesis of trichothecenes and fumonisins in Fusarium. Toxin Rev. 2009, 28, 198–215. [Google Scholar] [CrossRef]
- Yin, S.; Guo, X.; Li, J.; Fan, L.; Hu, H. Fumonisin B1 induces autophagic cell death via activation of ERN1-MAPK8/9/10 pathway in monkey kidney MARC-145 cells. Arch. Toxicol. 2016, 90, 985–996. [Google Scholar] [CrossRef] [PubMed]
- Lino, C.M.; Silva, L.J.G.; Pena, A.L.S.; Silveira, M.I. Determination of fumonisins B1 and B2 in Portuguese maize and maize-based samples by HPLC with fluorescence detection. Anal Bioanal Chem. 2006, 384, 1214–1220. [Google Scholar] [CrossRef] [PubMed]
- Fu, M.; Li, R.; Guo, C.C.; Pang, M.H.; Liu, Y.C.; Dong, J.G. Natural incidence of Fusarium species and fumonisins B1 and B2 associated with maize kernels from nine provinces in China in 2012. Food Addit. Contam. 2015, 32, 503–511. [Google Scholar] [CrossRef]
- Covarelli, L.; Stifano, S.; Beccari, G.; Raggi, L.; Lattanzio, V.M.; Albertini, E. Characterization of Fusarium verticillioides strains isolated from maize in Italy: Fumonisin production, pathogenicity and genetic variability. Food Microbiol. 2012, 31, 17–24. [Google Scholar] [CrossRef]
- Gelderblom, W.C.; Jaskiewicz, K.; Marasas, W.F.; Thiel, P.G.; Horak, R.M.; Vleggaar, R.; Kriek, N.P. Fumonisins-novel mycotoxins with cancer-promoting activity produced by Fusarium moniliforme. Appl. Environ. Microbiol. 1998, 54, 1806–1811. [Google Scholar]
- European Commission. Commission regulation (EC) no. 856/2005 of 6 June 2005 amending regulation (EC) no. 466/2001 as regards Fusarium toxins. Off. J. Eur. Union 2005, 143, 3–8. [Google Scholar]
- Food and Drug Administration USA. Fumonisin levels in human foods and animal feeds. Center for food safety and applied nutrition. Center for veterinary medicine. Fed. Regist. 2001, 66, 218. [Google Scholar]
- Duan, C.X.; Wang, X.M.; Song, F.J.; Sun, S.L.; Zhou, D.N.; Zhu, Z.D. Advance in research on maize resistance to ear rot. Sci. Agric. Sin. 2015, 48, 2152–2164. [Google Scholar]
- Ren, J.P.; Wu, X.L.; Sun, X.H. A study on infection cycle of pathogen of corn ear rot and stalk rot in Jilin Province. Maize Sci. 1995, 10, 25–28. [Google Scholar]
- Chen, J. Status and perspective on research of ear rot and stalk rot in maize. J. Shenyang Agric. Univ. 2000, 31, 393–401. [Google Scholar]
- Zou, Q.D.; Xu, Y.; Wang, L.; Chen, J. Relationship of infection cycle between ear rot and stalk rot in maize caused by Fusarium. J. Shenyang Agric. Univ. 2000, 31, 487–489. [Google Scholar]
- Rahayu, D.; Rahayu, W.P.; Lioe, H.N. The effect of temperature and humidity on the growth of Fusarium verticillioides BIO 957 and fumonisin B1 productions. Agritech 2015, 35, 156–163. [Google Scholar] [CrossRef]
- Sewarm, V.; Mshicileli, N.; Shephard, G.S.; Vismer, H.F.; Rheeder, J.P.; Lee, Y.W.; Leslie, J.F.; Marasas, W.F. Production of fumonisin B and C analogues by several Fusarium species. J. Agric. Food Chem. 2005, 53, 4861–4866. [Google Scholar] [CrossRef]
- Cook, R.J. The incidence of stalk rot (Fusarium spp.) on maize hybrids and its effect on yield of maize in Britain. Ann. Appl. Biol. 1978, 88, 23–30. [Google Scholar] [CrossRef]
- Ledencan, T.; Sumic, D.; Brkic, I.; Jambrovic, A.; Zdunic, Z. Resistance of maize inbreds and their hybrids to Fusarium stalk rot. Czech J. Genet. Plant Breed 2003, 39, 15–20. [Google Scholar] [CrossRef]
- Jiang, Y.Y.; Du, J.; Chi, Y.P.; Liu, X.Y.; Liu, H.W.; Li, W.L. Occurrence and effective control of maize stalk rot. J. Northeast Agric. Sci. 2018, 43, 24–27. [Google Scholar]
- Li, Y.Y.; Feng, G.; Wang, L.; Wu, Y.J. Yield comparison of Zhengdan 958 and Xianyu 335 in different regions. China Seed Ind. 2009, 8, 36–37. [Google Scholar]
- Mulè, G.; Susca, A.; Stea, G.; Moretti, A. A species-specific PCR assay based on the calmodulin partial gene for identifcation of Fusarium verticillioides, F. proliferatum and F. subglutinans. Eur. J. Plant Pathol. 2004, 110, 495–502. [Google Scholar] [CrossRef]
- Nicholson, P.; Simpson, D.R.; Weston, G.; Rezanoor, H.N.; Lees, A.K.; Parry, D.W.; Joyce, D. Detection and quantification of Fusarium culmorum and Fusarium graminearumin cereals using PCR assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef]
- Mishra, P.K.; Fox, R.T.V.; Culham, A. Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusariam. FEMS Microbiol. Lett. 2003, 218, 329–332. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.Z.; Lu, X.H.; Tao, B.; Pang, M.H.; Liu, Y.C.; Dong, J.G. Natural occurrence of fumonisins B1 and B2 in corn from three main production provinces in China. J. Food Prot. 2011, 74, 1374–1378. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.C.; Zhu, W.F.; Fu, M.; Pang, M.H.; Liu, Y.C.; Dong, J.G. Occurrence of Fusarium species and fumonisins associated with maize kernels from Gansu province. Plant Prot. 2015, 42, 942–948. [Google Scholar]
- Liu, Y.X.; Jiang, Y.; Li, R.J.; Pang, M.H.; Liu, Y.C.; Dong, J.G. Natural occurrence of fumonisins B1 and B2 in maize from eight provinces of China in 2014. Food Addit. Contam. Part B Surveill. 2017, 10, 113–117. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Isolation frequency of Fusarium species in different parts of maize in 2016 (A, stalks; B, ear stems; C, kernels).
Figure 1.
Isolation frequency of Fusarium species in different parts of maize in 2016 (A, stalks; B, ear stems; C, kernels).
Figure 2.
Isolation frequency of Fusarium species in different parts of maize in 2017 (A, stalks; B, ear stems; C, kernels).
Figure 2.
Isolation frequency of Fusarium species in different parts of maize in 2017 (A, stalks; B, ear stems; C, kernels).
Figure 3.
Isolation frequency of Fusarium species in different parts of maize in 2018 (A, stalks; B, ear stems; C, kernels).
Figure 3.
Isolation frequency of Fusarium species in different parts of maize in 2018 (A, stalks; B, ear stems; C, kernels).
Figure 4.
Isolation frequency of Fusarium species in different maize varieties in 2016 (A, stalks; B, ear stems; C, kernels; 1, Xianyu 335; 2, Zhengdan 958).
Figure 4.
Isolation frequency of Fusarium species in different maize varieties in 2016 (A, stalks; B, ear stems; C, kernels; 1, Xianyu 335; 2, Zhengdan 958).
Figure 5.
Isolation frequency of Fusarium species in different maize varieties in 2017 (A, stalks; B, ear stems; C, kernels; 1, Xianyu 335; 2, Zhengdan 958).
Figure 5.
Isolation frequency of Fusarium species in different maize varieties in 2017 (A, stalks; B, ear stems; C, kernels; 1, Xianyu 335; 2, Zhengdan 958).
Figure 6.
Isolation frequency of Fusarium species in different maize varieties in 2018 (A, stalks; B, ear stems; C, kernels; 1, Xianyu 335; 2, Zhengdan 958).
Figure 6.
Isolation frequency of Fusarium species in different maize varieties in 2018 (A, stalks; B, ear stems; C, kernels; 1, Xianyu 335; 2, Zhengdan 958).
Figure 7.
Distribution of fumonisin contamination in maize kernel samples from different regions in 2016, 2017, and 2018 (nd = not detectable).
Figure 7.
Distribution of fumonisin contamination in maize kernel samples from different regions in 2016, 2017, and 2018 (nd = not detectable).
Figure 8.
Sampling patterns and pathogen transmission pathways.
Figure 9.
Sampling locations in China.
Table 1.
Fusarium species isolated from rotted corn stalks and kernels from 15 regions in China.
| Fusarium spp. | Number of Strains Isolated | Total | ||
|---|---|---|---|---|
| Corn Kernels | Ear Stems | Stalks | ||
| F. verticillioides | 668 | 105 | 428 | 1201 |
| F. oxysporum | 318 | 59 | 291 | 668 |
| FGSC | 240 | 52 | 282 | 574 |
| F. equiseti | 123 | 44 | 151 | 318 |
| F. proliferatum | 49 | 13 | 33 | 95 |
| F. subglutinans | 27 | 4 | 9 | 40 |
Table 2.
Isolation frequency of Fusarium species in different regions in 2016.
| Region | No. of Total Samples | Isolation Frequency of Fusarium spp. | |||||
|---|---|---|---|---|---|---|---|
| F. verticillioides | F. oxysporum | F. proliferatum | FGSC | F. equiseti | F. subglutinans | ||
| Wuwei | 5 | 25.3% | 40.3% | 3.3% | 5.7% | 21.3% | 8.0% |
| Pingliang | 4 | 42.1% | 21.7% | 0.8% | 5.0% | 17.9% | 1.2% |
| Changzhi | 3 | 26.7% | 27.2% | 0.0% | 49.4% | 28.9% | 0.0% |
| Changwu | 3 | 25.0% | 21.7% | 1.1% | 21.7% | 32.2% | 0.0% |
| Xinzhou | 2 | 39.2% | 30.8% | 0.0% | 15.0% | 30.8% | 4.2% |
| Yulin | 1 | 35.0% | 35.0% | 0.0% | 38.3% | 11.7% | 0.0% |
| Yongning | 1 | 8.3% | 15.0% | 0.0% | 11.7% | 11.7% | 0.0% |
| Tongxin | 1 | 61.7% | 15.0% | 0.0% | 0.0% | 23.3% | 0.0% |
Table 3.
Isolation frequency of Fusarium species in different regions in 2017.
| Region | No. of Total Samples | Isolation Frequency of Fusarium spp. | ||||
|---|---|---|---|---|---|---|
| F. verticillioides | F. oxysporum | F. proliferatum | FGSC | F. equiseti | ||
| Harbin | 2 | 60.8% | 51.7% | 9.2% | 0.0% | 0.0% |
| Tieling | 2 | 88.3% | 43.3% | 24.2% | 0.0% | 3.3% |
| Shenyang | 2 | 67.5% | 36.7% | 0.0% | 0.0% | 0.8% |
| Tongxin | 2 | 85.8% | 83.3% | 0.0% | 1.7% | 0.0% |
| Changwu | 1 | 35.0% | 35.0% | 0.0% | 58.3% | 0.0% |
| Changzhi | 1 | 6.7% | 6.7% | 0.0% | 61.7% | 10.0% |
| Panjin | 1 | 48.3% | 15.0% | 0.0% | 21.7% | 8.3% |
| Tonghua | 1 | 75.0% | 11.7% | 55.0% | 0.0% | 0.0% |
| Tongliao | 1 | 80.0% | 23.3% | 0.0% | 0.0% | 0.0% |
Table 4.
Isolation frequency of Fusarium species in different regions in 2018.
| Region | No. of Total Samples | Isolation Frequency of Fusarium spp. | |||||
|---|---|---|---|---|---|---|---|
| F. verticillioides | F. oxysporum | F. proliferatum | FGSC | F. equiseti | F. subglutinans | ||
| Xinzhou | 5 | 45.7% | 1.3% | 0.0% | 28.0% | 0.0% | 1.3% |
| Zhenyuan | 3 | 26.7% | 2.2% | 0.0% | 30.0% | 1.7% | 0.0% |
| Changzhi | 3 | 9.4% | 2.2% | 2.2% | 38.3% | 2.8% | 0.0% |
| Yulin | 2 | 41.7% | 1.7% | 0.0% | 1.7% | 11.7% | 0.0% |
| Tongxin | 2 | 29.2% | 0.0% | 3.3% | 51.7% | 0.0% | 3.3% |
| Changwu | 1 | 41.7% | 6.7% | 0.0% | 25.0% | 0.0% | 0.0% |
Table 5.
Incidence and levels of fumonisins in maize kernel samples from different regions in 2016 1.
Table 5.
Incidence and levels of fumonisins in maize kernel samples from different regions in 2016 1.
| Region | No. of Total Samples | Fumonisins | No. of Positive Samples (%) | Range (μg/g) | Mean (μg/g) |
|---|---|---|---|---|---|
| Changzhi | 3 | FB1 | 1/3(33.3) | nd–0.3 | 0.3 |
| FB2 | 3/3(100.0) | 1.7–4.5 | 2.8 | ||
| FB1 + FB2 | 3/3(100.0) | 1.7–4.5 | 2.9 | ||
| Xinzhou | 2 | FB1 | 0/2(0.0) | nd | - |
| FB2 | 1/2(50.0) | nd–1.7 | 1.7 | ||
| FB1 + FB2 | 1/2(50.0) | nd–1.73 | 1.7 | ||
| Pingliang | 4 | FB1 | 0/4(0.0) | nd | - |
| FB2 | 2/4(50.0) | nd–2.9 | 2.1 | ||
| FB1 + FB2 | 2/4(50.0) | nd–2.9 | 2.1 | ||
| Wuwei | 5 | FB1 | 0/5(0.0) | nd | - |
| FB2 | 3/5 (60.0) | nd–3.3 | 2.1 | ||
| FB1 + FB2 | 3/5 (60.0) | nd–3.3 | 2.1 | ||
| Changwu | 3 | FB1 | 2/3(66.7) | nd–1.2 | 0.8 |
| FB2 | 1/3(33.3) | nd–4.3 | 4.3 | ||
| FB1 + FB2 | 2/3(66.7) | nd–5.4 | 2.9 | ||
| Yulin | 1 | FB1 | 1/1(100.0) | 0.3 | 0.3 |
| FB2 | 0/1(0.0) | nd | - | ||
| FB1 + FB2 | 1/1(100.0) | 0.3 | 0.3 | ||
| Tongxin | 1 | FB1 | 0/1(0.0) | nd | - |
| FB2 | 1/1(100.0) | 2.5 | 2.5 | ||
| FB1 + FB2 | 1/1(100.0) | 2.5 | 2.5 | ||
| Total | 19 | FB1 | 4/19(21.1) | nd–1.2 | 0.6 |
| FB2 | 11/19(57.9) | nd–4.5 | 2.5 | ||
| FB1 + FB2 | 13/19(68.4) | nd–5.4 | 2.3 |
1 nd = not detected.
Table 6.
Incidence and levels of fumonisins in maize kernel samples from different regions in 2017 1.
Table 6.
Incidence and levels of fumonisins in maize kernel samples from different regions in 2017 1.
| Region | No. of Total Samples | Fumonisins | No. of Positive Samples (%) | Range (μg/g) | Mean (μg/g) |
|---|---|---|---|---|---|
| Changwu | 1 | FB1 | 1/1(100.0) | 0.2 | 0.2 |
| FB2 | 0/1(0.0) | nd | - | ||
| FB1 + FB2 | 1/1(100.0) | 0.2 | 0.2 | ||
| Changzhi | 1 | FB1 | 1/1(100.0) | 0.1 | 0.1 |
| FB2 | 0/1(0.0) | nd | - | ||
| FB1 + FB2 | 1/1(100.0) | 0.1 | 0.1 | ||
| Tieling | 2 | FB1 | 1/2(50.0) | nd–0.5 | 0.5 |
| FB2 | 1/2(50.0) | nd–0.5 | 0.5 | ||
| FB1 + FB2 | 1/2(50.0) | nd–1.1 | 1.1 | ||
| Tonghua | 1 | FB1 | 1/1(100.0) | 0.1 | 0.1 |
| FB2 | 0/1(0.0) | nd | - | ||
| FB1 + FB2 | 1/1(100.0) | 0.1 | 0.1 | ||
| Tongliao | 1 | FB1 | 1/1(100.0) | 0.1 | 0.1 |
| FB2 | 0/1(0.0) | nd | - | ||
| FB1 + FB2 | 1/1(100.0) | 0.1 | 0.1 | ||
| Total | 6 | FB1 | 5/6(83.3) | nd–0.5 | 0.2 |
| FB2 | 1/6(16.7) | 0.5 | 0.5 | ||
| FB1 + FB2 | 5/6(83.3) | nd–1.1 | 0.3 |
1 nd = not detected.
Table 7.
Incidence and levels of fumonisins in maize kernel samples from different regions in 2018 1.
Table 7.
Incidence and levels of fumonisins in maize kernel samples from different regions in 2018 1.
| Region | No. of Total Samples | Fumonisins | No.of Positive Samples (%) | Range (μg/g) | Mean (μg/g) |
|---|---|---|---|---|---|
| Yulin | 2 | FB1 | 1/2(50.0) | nd–5.4 | 5.4 |
| FB2 | 1/2(50.0) | nd–4.7 | 4.7 | ||
| FB1 + FB2 | 1/2(50.0) | nd–10.1 | 10.1 | ||
| Changwu | 1 | FB1 | 1/1(100.0) | 0.3 | 0.3 |
| FB2 | 1/1(100.0) | 0.2 | 0.2 | ||
| FB1 + FB2 | 1/1(100.0) | 0.5 | 0.5 | ||
| Changzhi | 3 | FB1 | 1/3(33.3) | 2.7 | 2.7 |
| FB2 | 1/3(33.3) | 0.7 | 0.7 | ||
| FB1 + FB2 | 1/3(33.3) | 3.4 | 3.4 | ||
| Xinzhou | 5 | FB1 | 2/5(40.0) | nd–3.8 | 1.9 |
| FB2 | 2/5 (40.0) | nd–2.6 | 1.4 | ||
| FB1 + FB2 | 3/5 (60.0) | nd–6.5 | 2.2 | ||
| Tongxin | 2 | FB1 | 1/2(50.0) | nd–0.1 | 0.1 |
| FB2 | 0/2(0.0) | nd | - | ||
| FB1 + FB2 | 1/2(50.0) | nd–0.1 | 0.1 | ||
| Total | 13 | FB1 | 9/13(69.2) | nd–5.4 | 1.4 |
| FB2 | 6/13(46.2) | nd–4.7 | 1.4 | ||
| FB1 + FB2 | 10/13(76.9) | nd–10.1 | 2.1 |
1 nd = not detected.
Table 8.
Specific primer pairs for Fusarium spp.
| Fungi | Primer | Sequences (5′-3′) | Product Size (bp) | Tm (°C) | Ref. |
|---|---|---|---|---|---|
| F. verticillioides | VER1 VER2 | CTTCCTGCGATGTTTCTCC AATTGGCCATTGGTATTATATATCTA | 578 | 56 | [41] |
| F. proliferatum | PRO1 PRO2 | CTTTCCGCCAAGTTTCTTC TGTCAGTAACTCGACGTTGTTG | 585 | 56 | [41] |
| F. subglutinans | SUB1 SUB2 | CTGTCGCTAACCTCTTTATCCA CAGTATGGACGTTGGTATTATATCTAA | 631 | 56 | [41] |
| FGSC | Fg16NF Fg16NR | ACAGATGACAAGATTCAGGCACA TTCTTTGACATCTGTTCAACCCA | 280 | 57 | [42] |
| F. oxysporum | FoF1 FoF2 | ACATACCACTTGTTGCCTCG CGCCAATCAATTTGAGGAACG | 340 | 58 | [43] |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Li, L.; Qu, Q.; Cao, Z.; Guo, Z.; Jia, H.; Liu, N.; Wang, Y.; Dong, J. The Relationship Analysis on Corn Stalk Rot and Ear Rot According to Fusarium Species and Fumonisin Contamination in Kernels. Toxins 2019, 11, 320. https://doi.org/10.3390/toxins11060320
AMA Style
Li L, Qu Q, Cao Z, Guo Z, Jia H, Liu N, Wang Y, Dong J. The Relationship Analysis on Corn Stalk Rot and Ear Rot According to Fusarium Species and Fumonisin Contamination in Kernels. Toxins. 2019; 11(6):320. https://doi.org/10.3390/toxins11060320
Chicago/Turabian StyleLi, Lina, Qing Qu, Zhiyan Cao, Zhengyu Guo, Hui Jia, Ning Liu, Yanhui Wang, and Jingao Dong. 2019. "The Relationship Analysis on Corn Stalk Rot and Ear Rot According to Fusarium Species and Fumonisin Contamination in Kernels" Toxins 11, no. 6: 320. https://doi.org/10.3390/toxins11060320
APA StyleLi, L., Qu, Q., Cao, Z., Guo, Z., Jia, H., Liu, N., Wang, Y., & Dong, J. (2019). The Relationship Analysis on Corn Stalk Rot and Ear Rot According to Fusarium Species and Fumonisin Contamination in Kernels. Toxins, 11(6), 320. https://doi.org/10.3390/toxins11060320
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
