Evidence of the Involvement of a Cyclase Gene in the Biosynthesis of Ochratoxin A in Aspergillus carbonarius
Abstract
:1. Introduction
2. Results
2.1. Gene Expression Analysis
2.2. Selection and Analysis of ∆otaY Mutants
2.3. Genome Sequencing
2.4. Expression Analysis of OTA Cluster Genes in ∆otaY Mutant Strain
2.5. OTA Analysis
3. Discussion
4. Materials and Methods
4.1. Fungal Strains and Growth Conditions
4.2. Cyclase Gene Expression Analysis
4.3. Cyclase Gene Deletion: sgRNAs Selection and Fungal Transformation
4.4. PCR Analysis of Putative A. Carbonarius ∆otaY Mutants
4.5. Gene Expression Analysis of OTA Cluster Genes in ∆otaY Mutant
4.6. Genome Sequencing and Assembly
4.7. OTA Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jørgensen, K. Occurrence of ochratoxin A in commodities and processed food—A review of EU occurrence data. Food Addit. Contam. 2005, 22, 26–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- el Khoury, A.E.; Atoui, A. Ochratoxin a: General overview and actual molecular status. Toxins 2010, 2, 461–493. [Google Scholar] [CrossRef] [Green Version]
- Castegnaro, M.; Canadas, D.; Vrabcheva, T.; Petkova-Bocharova, T.; Chernozemsky, I.N.; Pfohl-Leszkowicz, A. Balkan endemic nephropathy: Role of ochratoxins A through biomarkers. Mol. Nutr. Food Res. 2006, 50, 519–529. [Google Scholar] [CrossRef] [PubMed]
- IARC. Monographs on the Evaluation of Carcinogenic Risks to Humans: Some Naturally Occurring Substances: Food Items and Constituents, Heterocyclic Aromatic Amines and Mycotoxins; International Agency for Research on Cancer: Lion, France, 1993. [Google Scholar]
- Malir, F.; Ostry, V.; Pfohl-Leszkowicz, A.; Malir, J.; Toman, J. Ochratoxin A: 50 years of research. Toxins 2016, 8, 191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Houbraken, J.; Kocsubé, S.; Visagie, C.M.; Yilmaz, N.; Wang, X.C.; Meijer, M.; Kraak, B.; Hubka, V.; Bensch, K.; Samson, R.A.; et al. Classification of Aspergillus, Penicillium, Talaromyces and related genera (Eurotiales): An overview of families, genera, subgenera, sections, series and species. Stud. Mycol. 2020, 95, 5–169. [Google Scholar] [CrossRef]
- Perrone, G.; Gallo, A.; Susca, A.; Varga, J. Aspergillus in grapes: Ecology, biodiversity and genomics. In Aspergillus in the Genomic Era; Varga, J., Samson, R.A., Eds.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2008; pp. 179–212. [Google Scholar] [CrossRef]
- Vesth, T.C.; Brandl, J.; Andersen, M.R. FunGeneClusterS: Predicting fungal gene clusters from genome and transcriptome data. Synth. Syst. Biotechnol. 2016, 1, 122–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kjaerbølling, I.; Vesth, T.C.; Frisvad, J.C.; Nybo, J.L.; Theobald, S.; Kuo, A.; Bowyer, P.; Matsuda, Y.; Mondo, S.; Lyhne, E.K.; et al. Linking secondary metabolites to gene clusters through genome sequencing of six diverse Aspergillus species. Proc. Natl. Acad. Sci. USA 2018, 115, E753–E761. [Google Scholar] [CrossRef] [Green Version]
- Pel, H.J.; de Winde, J.H.; Archer, D.B.; Dyer, P.S.; Hofmann, G.; Schaap, P.J.; Turner, G.; de Vries, R.P.; Albang, R.; Albermann, K.; et al. Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nat. Biotechnol. 2007, 25, 221–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baker, S.E.; Perrone, G.; Gallo, A.; Mulè, G.; Susca, A. The Aspergillus carbonarius genome: Analysis of potential secondary metabolite biosynthetic gene clusters. In Proceedings of the Book of Abstract of 25th Fungal Genetics Conference, Asilomar, CA, USA, 17–22 March 2009; p. 106. [Google Scholar]
- Ferrara, M.; Gallo, A.; Perrone, G.; Magistà, D.; Baker, S.E. Comparative Genomic Analysis of Ochratoxin A Biosynthetic Cluster in Producing Fungi: New Evidence of a Cyclase Gene Involvement. Front. Microbiol. 2020, 11, 581309. [Google Scholar] [CrossRef]
- Gil-Serna, J.; Vázquez, C.; Patiño, B. The Genomic Regions That Contain Ochratoxin A Biosynthetic Genes Widely Differ in Aspergillus Section Circumdati Species. Toxins 2020, 12, 754. [Google Scholar] [CrossRef]
- Ferrara, M.; Perrone, G.; Gambacorta, L.; Epifani, F.; Solfrizzo, M.; Gallo, A. Identification of a halogenase involved in the biosynthesis of ochratoxin A in Aspergillus carbonarius. Appl. Environ. Microbiol. 2016, 82, 5631–5641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallo, A.; Bruno, K.; Solfrizzo, M.; Perrone, G.; Mulè, G.; Visconti, A.; Baker, S. New insight in the ochratoxin A biosynthetic pathway by deletion of an nrps gene in Aspergillus carbonarius. Appl. Environ. Microbiol. 2012, 78, 8208–8218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallo, A.; Ferrara, M.; Perrone, G. Recent advances on the molecular aspects of ochratoxin A biosynthesis. Curr. Opin. Food Sci. 2017, 17, 49–56. [Google Scholar] [CrossRef]
- Gerin, D.; Garrapa, F.; Ballester, A.-R.; González-Candelas, L.; De Miccolis Angelini, R.M.; Faretra, F.; Pollastro, S. Functional Role of Aspergillus carbonarius AcOTAbZIP Gene, a bZIP Transcription Factor within the OTA Gene Cluster. Toxins 2021, 13, 111. [Google Scholar] [CrossRef] [PubMed]
- Sultana, A.; Kallio, P.; Jansson, A.; Wang, J.S.; Niemi, J.; Mäntsälä, P.; Schneider, G. Structure of the polyketide cyclase SnoaL reveals a novel mechanism for enzymatic aldol condensation. EMBO J. 2004, 23, 1911–1921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ullah, M.; Xia, L.; Xie, S.; Sun, S. CRISPR/Cas9-based genome engineering: A new breakthrough in the genetic manipulation of filamentous fungi. Biotechnol. Appl. Biochem. 2020, 67, 835–851. [Google Scholar] [CrossRef] [PubMed]
- Nødvig, C.S.; Nielsen, J.B.; Kogle, M.E.; Mortensen, U.H. A CRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi. PLoS ONE 2015, 10, e0133085. [Google Scholar] [CrossRef] [Green Version]
- Katayama, T.; Tanaka, Y.; Okabe, T.; Nakamura, H.; Fujii, W.; Kitamoto, K.; Maruyama, J. Development of a genome editing technique using the CRISPR/Cas9 system in the industrial filamentous fungus Aspergillus oryzae. Biotechnol. Lett. 2016, 38, 637–642. [Google Scholar] [CrossRef]
- Fuller, K.K.; Chen, S.; Loros, J.J.; Dunlap, J.C. Development of the CRISPR/Cas9 System for Targeted Gene Disruption in Aspergillus fumigatus. Eukaryot. Cell 2015, 14, 1073–1080. [Google Scholar] [CrossRef] [Green Version]
- Weber, J.; Valiante, V.; Nødvig, C.S.; Mattern, D.J.; Slotkowski, R.A.; Mortensen, U.H.; Brakhage, A.A. Functional reconstitution of a fungal natural product gene cluster by advanced genome editing. ACS Synth. Biol. 2017, 6, 62–68. [Google Scholar] [CrossRef]
- Leynaud-Kieffer, L.; Curran, S.C.; Kim, I.; Magnuson, J.K.; Gladden, J.M.; Baker, S.E.; Simmons, B.A. A new approach to Cas9-based genome editing in Aspergillus niger that is precise, efficient and selectable. PLoS ONE 2019, 14, e0210243. [Google Scholar] [CrossRef] [PubMed]
- Weyda, I.; Yang, L.; Vang, J.; Ahring, B.K.; Lübeck, M.; Lübeck, P.S. A comparison of Agrobacterium-mediated transformation and protoplast-mediated transformation with CRISPR-Cas9 and bipartite gene targeting substrates, as effective gene targeting tools for Aspergillus carbonarius. J. Microbiol. Methods 2017, 135, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Matsu-Ura, T.; Baek, M.; Kwon, J.; Hong, C. Efficient gene editing in Neurospora crassa with CRISPR technology. Fungal Biol. Biotechnol. 2015, 2, 4. [Google Scholar] [CrossRef] [Green Version]
- Wenderoth, M.; Pinecker, C.; Voß, B.; Fischer, R. Establishment of CRISPR/Cas9 in Alternaria alternata. Fungal Genet. Biol. 2017, 101, 55–60. [Google Scholar] [CrossRef]
- Wang, Q.; Cobine, P.A.; Coleman, J.J. Efficient genome editing in Fusarium oxysporum based on CRISPR/Cas9 ribonucleoprotein complexes. Fungal Genet Biol. 2018, 117, 21–29. [Google Scholar] [CrossRef] [PubMed]
- Gardiner, D.M.; Kazan, K. Selection is required for efficient Cas9-mediated genome editing in Fusarium graminearum. Fungal Biol. 2017, 122, 131–137. [Google Scholar] [CrossRef]
- Zhang, C.; Meng, X.; Wei, X.; Lu, L. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet. Biol. 2016, 86, 47–57. [Google Scholar] [CrossRef]
- Kuivanen, J.; Wang, Y.J.; Richard, P. Engineering Aspergillus niger for galactaric acid production: Elimination of galactaric acid catabolism by using RNA sequencing and CRISPR/Cas9. Microb. Cell Fact. 2016, 15, 210. [Google Scholar] [CrossRef] [Green Version]
- Liu, R.; Chen, L.; Jiang, Y.; Zhou, Z.; Zou, G. Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 2015, 1, 15007. [Google Scholar] [CrossRef] [Green Version]
- Pohl, C.; Kiel, J.A.; Driessen, A.J.; Bovenberg, R.A.; Nygård, Y. CRISPR/Cas9 based genome editing of Penicillium chrysogenum. ACS Synth. Biol. 2016, 5, 754–764. [Google Scholar] [CrossRef]
- Ferrara, M.; Haidukowski, M.; Logrieco, A.F.; Leslie, J.F.; Mulè, G. A CRISPR-Cas9 System for Genome Editing of Fusarium proliferatum. Sci. Rep. 2019, 9, 19836. [Google Scholar] [CrossRef] [PubMed]
- Gallo, A.; Knox, B.P.; Bruno, K.S.; Solfrizzo, M.; Baker, S.E.; Perrone, G. Identification and characterization of the polyketide synthase involved in ochratoxin A biosynthesis in Aspergillus carbonarius. Int. J. Food Microbiol. 2014, 79, 10–17. [Google Scholar] [CrossRef]
- Herbst, D.A.; Townsend, C.A.; Maier, T. The architectures of iterative type I PKS and FAS. Nat. Prod. Rep. 2018, 35, 1046–1069. [Google Scholar] [CrossRef] [Green Version]
- Hang, L.; Liu, N.; Tang, Y. Coordinated and Iterative Enzyme Catalysis in Fungal Polyketide Biosynthesis. ACS Catal. 2016, 6, 5935–5945. [Google Scholar] [CrossRef] [Green Version]
- Mao, X.-M.; Zhan, Z.-J.; Grayson, M.N.; Tang, M.-C.; Xu, W.; Li, Y.-Q.; Yin, W.-B.; Lin, H.-C.; Chooi, Y.-H.; Houk, K.N.; et al. Efficient Biosynthesis of Fungal Polyketides Containing the Dioxabicyclo-octane Ring System. J. Am. Chem. Soc. 2015, 137, 11904–11907. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Pei, Z.; Li, P.; Li, X.; Duan, Y.; Liu, H.; Chen, X.; Zheng, L.; Luo, C.; Huang, J.; et al. Quantitative Proteomics Analysis Reveals the Function of the Putative Ester Cyclase UvEC1 in the Pathogenicity of the Rice False Smut Fungus Ustilaginoidea virens. Int. J. Mol. Sci. Artic. 2021, 22, 4069. [Google Scholar] [CrossRef]
- Schümann, J.; Hertweck, C. Advances in cloning, functional analysis and heterologous expression of fungal polyketide synthase genes. J. Biotechnol. 2006, 124, 690–703. [Google Scholar] [CrossRef] [PubMed]
- Adrover-Castellano, M.L.; Schmidt, J.J.; Sherman, D.H. Biosynthetic Cyclization Catalysts for the Assembly of Peptide and Polyketide Natural Products. ChemCatChem 2021, 13, 2095–2116. [Google Scholar] [CrossRef] [PubMed]
- Cervini, C.; Gallo, A.; Piemontese, L.; Magistà, D.; Logrieco, A.F.; Ferrara, M.; Solfrizzo, M.; Perrone, G. Effects of temperature and water activity change on ecophysiology of ochratoxigenic Aspergillus carbonarius in field-simulating conditions. Int. J. Food Microbiol. 2020, 315, 108420. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [Green Version]
- Zimin, A.V.; Març Ais, G.; Puiu, D.; Roberts, M.; Salzberg, S.L.; Yorke, J.A. Genome analysis The MaSuRCA genome assembler. Bioinformatics 2013, 29, 2669–2677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Visconti, A.; Pascale, M.; Centonze, G. Determination of Ochratoxin A in Wine and Beer by Immunoaffinity Column Cleanup and Liquid Chromatographic Analysis with Fluorometric Detection: Collaborative Study. J. AOAC Int. 2001, 84, 1818–1827. [Google Scholar] [CrossRef] [PubMed] [Green Version]
ID | Protospacer Sequence 5′→3′ | PAM Site |
---|---|---|
sgRNAotaY_up | ATTAGCCCTACACGTCAACC | GGG |
sgRNAotaY_dw | GTTAGTTGGGATTCGCTGCT | GGG |
Primer | Sequence (5′–3′) | Concentration | Target Gene | Reference |
---|---|---|---|---|
RT_OTApks_Ac_FOR | CGTGTCCGATACTGTCTGTGA | 200 nM | otaA | [35] |
RT_OTApks_Ac_REV | GCATGGAGTCCTCAAGAACC | 200 nM | ||
RT_Ac_otaY_for | ACCATCCTCACCACCCTTGT | 200 nM | otaY | [14] |
RT_Ac_otaY_rev | GGGACTCTGGGCTAACACCT | 200 nM | ||
RT_nrps_Ac_FOR | ACGGGTCGCTGCTCTATATC | 200 nM | otaB | [14] |
RT_nrps_Ac_REV | ACTCACCACATCAACCACGA | 200 nM | ||
RT_AcOTAp450_F | GTGGTTATCCCGCCCAATAC | 200 nM | otaC | [14] |
RT_AcOTAp450_R | TGCCAGATTCATCCCGATAC | 200 nM | ||
RT_Ac_OTAbZIP_for | AATGGAACCAGCATTGATCTC | 250 nM | oraR1 | [14] |
RT_Ac_OTAbZIP_rev | GACCCAAGCATTCGCTCTA | 250 nM | ||
RT_hal_Ac_FOR | GAACGCCAGTAGAGGGACAG | 200 nM | otaD | [14] |
RT_hal_Ac_REV | ATGGAGGTGGTGTTGTTGTG | 200 nM | ||
RT3 BT Ac_F | CAAACCGGCCAGTGTGGTA | 200 nM | BenA | [14] |
RT3 BT Ac_R | CGGAGGTGCCATTGTAAACA | 200 nM |
Primer ID | Nucleotide Sequence 5′→3′ |
---|---|
IVT-cycUP-fwd | TAATACGACTCACTATAGATTAGCCCTACACGTC |
IVT-cycUP-rev | TTCTAGCTCTAAAACGGTTGACGTGTAGGGCTAA |
IVT-cycDW-fwd | TAATACGACTCACTATAGGTTAGTTGGGATTCGC |
IVT-cycDW-rev | TTCTAGCTCTAAAACAGCAGCGAATCCCAACTAA |
5harm_cyc_Hyg_F | CTCACCAGGCTGTGGCAAGCAGTTGGCGTGTATATTAGCCCTACACGTCAACAGTTTAGCTTGCCTCGTC |
3harm_cyc_HygB_R | TACTTCATATATCCAACCAAACAAAACACATACCCTAGTTTCTCACCCAGTCCAGTATAGCGACCAGCATT |
cyc_out_F | CATTGTGCTGGACTTTGGGC |
cyc_out_R | CCGGCTTTACTTTCATGGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ferrara, M.; Gallo, A.; Cervini, C.; Gambacorta, L.; Solfrizzo, M.; Baker, S.E.; Perrone, G. Evidence of the Involvement of a Cyclase Gene in the Biosynthesis of Ochratoxin A in Aspergillus carbonarius. Toxins 2021, 13, 892. https://doi.org/10.3390/toxins13120892
Ferrara M, Gallo A, Cervini C, Gambacorta L, Solfrizzo M, Baker SE, Perrone G. Evidence of the Involvement of a Cyclase Gene in the Biosynthesis of Ochratoxin A in Aspergillus carbonarius. Toxins. 2021; 13(12):892. https://doi.org/10.3390/toxins13120892
Chicago/Turabian StyleFerrara, Massimo, Antonia Gallo, Carla Cervini, Lucia Gambacorta, Michele Solfrizzo, Scott E. Baker, and Giancarlo Perrone. 2021. "Evidence of the Involvement of a Cyclase Gene in the Biosynthesis of Ochratoxin A in Aspergillus carbonarius" Toxins 13, no. 12: 892. https://doi.org/10.3390/toxins13120892