Apamin Enhances Neurite Outgrowth and Regeneration after Laceration Injury in Cortical Neurons
Abstract
:1. Introduction
2. Results
2.1. Among Bee Venom Components, Apamin Did Not Cause Neurotoxicity in Mature Neurons
2.2. Apamin May Act as a Potential Contributor to Neurite Outgrowth
2.3. Apamin Enhances Neurite Outgrowth and Axon Regeneration after Laceration Injury in Mature Cortical Neurons
2.4. Apamin Enhances BDNF and NGF Expression after Laceration Injury in Mature Cortical Neurons
2.5. Apamin Promotes the Expression of Growth-Associated Genes in Mature Cortical Neurons
3. Discussion
4. Materials and Methods
4.1. Primary Cultures of Rat Cerebral Cortical Neurons
4.2. Neuronal Viability Assays
4.3. Laceration Injury
4.4. Immunocytochemistry
4.5. Western Blotting
4.6. Real-Time PCR
4.7. Flow Cytometry
4.8. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gu, H.; Han, S.M.; Park, K.K. Therapeutic Effects of Apamin as a Bee Venom Component for Non-Neoplastic Disease. Toxins 2020, 12, 195. [Google Scholar] [CrossRef] [Green Version]
- Son, D.J.; Lee, J.W.; Lee, Y.H.; Song, H.S.; Lee, C.K.; Hong, J.T. Therapeutic application of anti-arthritis, pain-releasing, and anti-cancer effects of bee venom and its constituent compounds. Pharmacol. Ther. 2007, 115, 246–270. [Google Scholar] [CrossRef]
- Van Rietschoten, J.; Granier, C.; Rochat, H.; Lissitzky, S.; Miranda, F. Synthesis of apamin, a neurotoxic peptide from bee venom. Eur. J. Biochem. 1975, 56, 35–40. [Google Scholar] [CrossRef]
- Vincent, J.P.; Schweitz, H.; Lazdunski, M. Structure-function relationships and site of action of apamin, a neurotoxic polypeptide of bee venom with an action on the central nervous system. Biochemistry 1975, 14, 2521–2525. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Fischer, D.; Noelker, C.; Vulinovic, F.; Grunewald, A.; Chevarin, C.; Klein, C.; Oertel, W.H.; Hirsch, E.C.; Michel, P.P.; Hartmann, A. Bee venom and its component apamin as neuroprotective agents in a Parkinson disease mouse model. PLoS ONE 2013, 8, e61700. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.M.; Cho, S.N.; Son, E.; Song, C.H.; Kim, D.S. Apamin from bee venom suppresses inflammation in a murine model of gouty arthritis. J. Ethnopharmacol. 2020, 257, 112860. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Jang, K.M.; Park, K.K. Apamin Suppresses LPS-Induced Neuroinflammatory Responses by Regulating SK Channels and TLR4-Mediated Signaling Pathways. Int. J. Mol. Sci. 2020, 21, 4319. [Google Scholar] [CrossRef]
- Bae, G.S.; Heo, K.H.; Park, K.C.; Choi, S.B.; Jo, I.J.; Seo, S.H.; Kim, D.G.; Shin, J.Y.; Kang, D.G.; Lee, H.S.; et al. Apamin attenuated cerulein-induced acute pancreatitis by inhibition of JNK pathway in mice. Dig. Dis. Sci. 2013, 58, 2908–2917. [Google Scholar] [CrossRef] [PubMed]
- Proulx, E.; Power, S.K.; Oliver, D.K.; Sargin, D.; McLaurin, J.; Lambe, E.K. Apamin Improves Prefrontal Nicotinic Impairment in Mouse Model of Alzheimer’s Disease. Cereb. Cortex. 2020, 30, 563–574. [Google Scholar] [CrossRef] [PubMed]
- Kallarackal, A.J.; Simard, J.M.; Bailey, A.M. The effect of apamin, a small conductance calcium activated potassium (SK) channel blocker, on a mouse model of neurofibromatosis 1. Behav. Brain Res. 2013, 237, 71–75. [Google Scholar] [CrossRef]
- Silva, J.; Monge-Fuentes, V.; Gomes, F.; Lopes, K.; dos Anjos, L.; Campos, G.; Arenas, C.; Biolchi, A.; Goncalves, J.; Galante, P.; et al. Pharmacological Alternatives for the Treatment of Neurodegenerative Disorders: Wasp and Bee Venoms and Their Components as New Neuroactive Tools. Toxins 2015, 7, 3179–3209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mohammadi-Rad, M.; Ghasemi, N.; Aliomrani, M. Evaluation of apamin effects on myelination process in C57BL/6 mice model of multiple sclerosis. Res. Pharm. Sci. 2019, 14, 424–431. [Google Scholar] [CrossRef]
- Moreno, M.; Giralt, E. Three valuable peptides from bee and wasp venoms for therapeutic and biotechnological use: Melittin, apamin and mastoparan. Toxins 2015, 7, 1126–1150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Deltheil, T.; Turle-Lorenzo, N.; Liberge, M.; Rosier, C.; Watabe, I.; Sreng, L.; Amalric, M.; Mourre, C. SK channel blockade reverses cognitive and motor deficits induced by nigrostriatal dopamine lesions in rats. Int. J. Neuropsychopharmacol. 2014, 17, 1295–1306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salthun-Lassalle, B.; Hirsch, E.C.; Wolfart, J.; Ruberg, M.; Michel, P.P. Rescue of mesencephalic dopaminergic neurons in culture by low-level stimulation of voltage-gated sodium channels. J. Neurosci. 2004, 24, 5922–5930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toulorge, D.; Guerreiro, S.; Hild, A.; Maskos, U.; Hirsch, E.C.; Michel, P.P. Neuroprotection of midbrain dopamine neurons by nicotine is gated by cytoplasmic Ca2+. FASEB J. 2011, 25, 2563–2573. [Google Scholar] [CrossRef]
- Eteraf-Oskouei, T.; Najafi, M. Traditional and modern uses of natural honey in human diseases: A review. Iran. J. Basic Med. Sci. 2013, 16, 731–742. [Google Scholar] [PubMed]
- Wehbe, R.; Frangieh, J.; Rima, M.; El Obeid, D.; Sabatier, J.M.; Fajloun, Z. Bee Venom: Overview of Main Compounds and Bioactivities for Therapeutic Interests. Molecules 2019, 24, 2997. [Google Scholar] [CrossRef] [Green Version]
- Hossen, M.S.; Shapla, U.M.; Gan, S.H.; Khalil, M.I. Impact of Bee Venom Enzymes on Diseases and Immune Responses. Molecules 2016, 22, 25. [Google Scholar] [CrossRef]
- Kim, K.H.; Kum, Y.S.; Park, Y.Y.; Park, J.H.; Kim, S.J.; Lee, W.R.; Lee, K.G.; Han, S.M.; Park, K.K. The protective effect of bee venom against ethanol-induced hepatic injury via regulation of the mitochondria-related apoptotic pathway. Basic Clin. Pharmacol. Toxicol. 2010, 107, 619–624. [Google Scholar] [CrossRef] [PubMed]
- Hur, E.M.; Saijilafu; Zhou, F.Q. Growing the growth cone: Remodeling the cytoskeleton to promote axon regeneration. Trends Neurosci. 2012, 35, 164–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.; Hong, J.Y.; Jeon, W.J.; Lee, J.; Baek, S.H.; Ha, I.H. Lycopus lucidus Turcz Exerts Neuroprotective Effects Against H2O2-Induced Neuroinflammation by Inhibiting NLRP3 Inflammasome Activation in Cortical Neurons. J. Inflamm. Res. 2021, 14, 1759–1773. [Google Scholar] [CrossRef] [PubMed]
- Stupack, J.; Xiong, X.P.; Jiang, L.L.; Zhang, T.; Zhou, L.; Campos, A.; Ranscht, B.; Mobley, W.; Pasquale, E.B.; Xu, H.; et al. Soluble SORLA Enhances Neurite Outgrowth and Regeneration through Activation of the EGF Receptor/ERK Signaling Axis. J. Neurosci. 2020, 40, 5908–5921. [Google Scholar] [CrossRef] [PubMed]
Gene | 5′–3′ | Primer Sequence |
---|---|---|
BDNF | Forward | CTTGGAGAAGGAAACCGCCT |
Reverse | GTCCACACAAAGCTCTCGGA | |
NGF | Forward | CCAAGGACGCAGCTTTCTATC |
Reverse | CTGTGTCAAGGGAATGCTGAAG | |
NF200 | Forward | AACACCACTTAGATGGCGGG |
Reverse | ACGTGGAGCGTTCAGCAATA | |
GAP43 | Forward | TGCCCTTTCTCAGATCCACT |
Reverse | TTGCCACACAGAGAGAGAGG | |
GAPDH | Forward | CCCCCAATGTATCCGTTGTG |
Reverse | TAGCCCAGGATGCCCTTTAGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, H.; Hong, J.Y.; Lee, J.; Jeon, W.-J.; Ha, I.-H. Apamin Enhances Neurite Outgrowth and Regeneration after Laceration Injury in Cortical Neurons. Toxins 2021, 13, 603. https://doi.org/10.3390/toxins13090603
Kim H, Hong JY, Lee J, Jeon W-J, Ha I-H. Apamin Enhances Neurite Outgrowth and Regeneration after Laceration Injury in Cortical Neurons. Toxins. 2021; 13(9):603. https://doi.org/10.3390/toxins13090603
Chicago/Turabian StyleKim, Hyunseong, Jin Young Hong, Junseon Lee, Wan-Jin Jeon, and In-Hyuk Ha. 2021. "Apamin Enhances Neurite Outgrowth and Regeneration after Laceration Injury in Cortical Neurons" Toxins 13, no. 9: 603. https://doi.org/10.3390/toxins13090603