Community Structure and Toxicity Potential of Cyanobacteria during Summer and Winter in a Temperate-Zone Lake Susceptible to Phytoplankton Blooms
Abstract
:1. Introduction
2. Results
2.1. Physicochemical Parameters and Phytoplankton Structure in Lubosińskie Lake
2.2. Overview of Cyanobacteria Strains Isolated from the Lake during Summer and Winter
2.3. Cyanometabolites and Toxigenicity Genes
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Lake Location and Physicochemical Parameters
5.2. Biological Material
5.2.1. Isolation, Cultivation, and Identification of Cyanobacterial Strains and Sample Analyses
5.2.2. Isolation of DNA and Phylogenetic Characterization of Cyanobacterial Strains
5.3. Toxicological Investigations
5.3.1. Enzyme-Linked Immunosorbent Assay (ELISA)
5.3.2. Noncompetitive Time-Resolved Fluorescence Immunoassay (TRFIA)
5.3.3. High-Performance Liquid Chromatography with Diode Array UV Detection (HPLC-DAD)
5.3.4. Liquid Chromatography–Mass Spectrometry (LC-MS)
5.3.5. Isolation of DNA and Toxigenicity Assessments
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Beaulieu, J.J.; DelSontro, T.; Downing, J.A. Eutrophication will increase methane emissions from lakes and impoundments during the 21st century. Nat. Commun. 2019, 10, 1375. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Zhang, Y.; Zhou, Y.; Zhang, Y.; Shi, K.; Jiang, C. Influence of cyanobacterial bloom accumulation and dissipation on underwater light attenuation in a large and shallow lake. Environ. Sci. Pollut. R. 2022, 29, 79082–79094. [Google Scholar] [CrossRef] [PubMed]
- Moustaka-Gouni, M.; Sommer, U. Effects of harmful blooms of large-sized and colonial cyanobacteria on aquatic food webs. Water 2020, 12, e1587. [Google Scholar] [CrossRef]
- Krztoń, W.; Kosiba, J.; Pociecha, A.; Wilk-Woźniak, E. The effect of cyanobacterial blooms on bio- and functional diversity of zooplankton communities. Biodivers. Conserv. 2019, 28, 1815–1835. [Google Scholar] [CrossRef]
- Drugă, B.; Buda, D.M.; Szekeres, E.; Chiş, C.; Chiş, I.; Sicora, C. The impact of cation concentration on Microcystis (cyanobacteria) scum formation. Sci. Rep. 2019, 9, 3017. [Google Scholar] [CrossRef] [PubMed]
- Martin-Creuzburg, D.; Von Elert, E. Good food versus bad food: The role of sterols and polyunsaturated fatty acids in determining growth and reproduction of Daphnia magna. Aquat. Ecol. 2009, 43, 943–950. [Google Scholar] [CrossRef]
- Bernard, C.; Ballot, A.; Thomazeau, S.; Maloufi, S.; Furey, A.; Mankiewicz-Boczek, J.; Pawlik-Skowrońska, B.; Capelli, C.; Salmaso, N. Appendix 2: Cyanobacteria associated with the production of cyanotoxins. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, G.A., Eds.; John Wiley & Sons: Chichester, UK, 2017; pp. 501–525. [Google Scholar] [CrossRef]
- Janssen, E.M.L. Cyanobacterial peptides beyond microcystins—A review on co-occurrence, toxicity, and challenges for risk assessment. Water Res. 2019, 151, 488–499. [Google Scholar] [CrossRef] [PubMed]
- National Rivers Authority. Toxic Blue-Green Algae. Water Quality Series No 2; National River Authority: London, UK, 1990. [Google Scholar]
- Krienitz, L.; Ballot, A.; Kotut, K.; Wiegand, C.; Pütz, S.; Metcalf, J.S.; Codd, G.A.; Pflugmacher, S. Contribution of hot spring cyanobacteria to the mysterious deaths of Lesser Flamingos at Lake Bogoria, Kenya. FEMS Microbiol. Ecol. 2003, 43, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Svirčev, Z.; Obradović, V.; Codd, G.A.; Marjanović, P.; Spoof, L.; Drobac, D.; Tokodi, N.; Petković, A.; Nenin, T.; Simeunović, J.; et al. Massive fish mortality and Cylindrospermopsis raciborskii bloom in Aleksandrovac Lake. Ecotoxicology 2016, 25, 1353–1363. [Google Scholar] [CrossRef]
- Carmichael, W.W.; Azevedo, S.M.F.O.; An, J.S.; Molica, R.J.R.; Jochimsen, E.M.; Lau, S.; Rinehart, K.L.; Shaw, G.R.; Eaglesham, G.K. Human fatalities from cyanobacteria: Chemical and biological evidence for cyanotoxins. Environ. Health Perspect. 2001, 109, 663–668. [Google Scholar] [CrossRef]
- Hamilton, D.P.; Wood, S.A.; Dietrich, D.R.; Puddick, J. Costs of harmful blooms of freshwater cyanobacteria. In Cyanobacteria: An Economic Perspective; Sharma, N.K., Rai, A.K., Stal, L.J., Eds.; John Wiley & Sons: Chichester, UK, 2013; pp. 247–256. [Google Scholar] [CrossRef]
- Wiegand, C.; Hernandez, S.; Le Moal, M.; Gruau, G. Payment for ecosystem services: An efficient approach to reduce eutrophication? Water 2023, 15, 3871. [Google Scholar] [CrossRef]
- Intergovernmental Panel on Climate Change. Climate Change 2022: Impacts, Adaptation, and Vulnerability. In Contribution of Working Group II to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change; Pörtner, H.O., Roberts, D.C., Tignor, M., Poloczanska, E.S., Mintenbeck, K., Alegría, A., Craig, M., Langsdorf, S., Löschke, S., Möller, V., et al., Eds.; Cambridge University Press: Cambridge, UK, 2022; p. 3056. [Google Scholar] [CrossRef]
- Lürling, M.; Eshetu, F.; Faassen, E.J.; Kosten, S.; Huszar, V.L.M. Comparison of cyanobacterial and green algal growth rates at different temperatures. Freshwater Biol. 2013, 58, 552–559. [Google Scholar] [CrossRef]
- Lehtimäki, J.; Moisander, P.; Sivonen, K.; Kononen, K. Growth, nitrogen fixation, and nodularin production by two Baltic Sea cyanobacteria. Appl. Environ. Microbiol. 1997, 63, 1647–1656. [Google Scholar] [CrossRef]
- Dias, E.; Pereira, P.; Franca, S. Production of paralytic shellfish toxins by Aphanizomenon sp. LMECYA 31 (Cyanobacteria). J. Phycol. 2002, 38, 705–712. [Google Scholar] [CrossRef]
- Walls, J.T.; Wyatt, K.H.; Doll, J.C.; Rubenstein, E.M.; Rober, A.R. Hot and toxic: Temperature regulates microcystin release from cyanobacteria. Sci. Total Environ. 2018, 610–611, 786–795. [Google Scholar] [CrossRef]
- Lürling, M.; Van Oosterhout, F.; Faassen, E. Eutrophication and warming boost cyanobacterial biomass and microcystins. Toxins 2017, 9, 64. [Google Scholar] [CrossRef]
- Davis, T.W.; Berry, D.L.; Boyer, G.L.; Gobler, C.J. The effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of Microcystis during cyanobacteria blooms. Harmful Algae 2009, 8, 715–725. [Google Scholar] [CrossRef]
- Rücker, J.; Wiedner, C.; Zippel, P. Factors controlling the dominance of Planktothrix agardhii and Limnothrix redekei in eutrophic shallow lakes. Hydrobiologia 1997, 342/343, 107–115. [Google Scholar] [CrossRef]
- Simeunović, J.; Svirčev, Z.; Kristić, S.; Lazić, L. Occurrence of cyanobacterial blooms in Vojvodina water ecosystems. Geogr. Pannonica 2005, 9, 13–19. [Google Scholar] [CrossRef]
- Toporowska, M.; Pawlik-Skowrońska, B.; Krupa, D.; Kornijów, R. Winter versus summer blooming of phytoplankton in a shallow lake: Effect of hypertrophic conditions. Pol. J. Ecol. 2010, 58, 3–12. [Google Scholar]
- Kokociński, M.; Stefaniak, K.; Izydorczyk, K.; Jurczak, T.; Mankiewicz-Boczek, J.; Soininen, J. Temporal variation in microcystin production by Planktothrix agardhii (Gomont) Anagnostidis and Komárek (Cyanobacteria, Oscillatoriales) in a temperate lake. Ann. Limnol. Int. J. Lim. 2011, 47, 363–371. [Google Scholar] [CrossRef]
- Ma, J.; Qin, B.; Paerl, H.W.; Brookes, J.D.; Hall, N.S.; Shi, K.; Zhou, Y.; Guo, J.; Li, Z.; Xu, H.; et al. The persistence of cyanobacterial (Microcystis spp.) blooms throughout winter in lake Taihu, China. Limnol. Oceanogr. 2016, 61, 711–722. [Google Scholar] [CrossRef]
- Shcherbak, V.I.; Semenyuk, N.Y.; Linchuk, M.I. Winter under the ice water bloom formed by Aphanizomenon gracile Lemmermann. Hydrobiol. J. 2019, 55, 20–34. [Google Scholar] [CrossRef]
- Reinl, K.L.; Harris, T.D.; North, R.L.; Almela, P.; Berger, S.A.; Bizic, M.; Burnet, S.H.; Grossart, H.P.; Ibelings, B.W.; Jakobsson, E.; et al. Blooms also like it cold. Limnol. Oceanogr. Lett. 2023, 8, 546–564. [Google Scholar] [CrossRef]
- Jacoby, J.M.; Gibbons, H.L.; Hanowell, R.; Bouchard, D.D. Wintertime blue-green algal toxicity in a mesotrophic lake. J. Freshw. Ecol. 1994, 9, 241–251. [Google Scholar] [CrossRef]
- Mankiewicz-Boczek, J.; Gągała, I.; Kokociński, M.; Jurczak, T.; Stefaniak, K. Perennial toxigenic Planktothrix agardhii bloom in selected lakes of Western Poland. Environ. Toxicol. 2011, 26, 10–20. [Google Scholar] [CrossRef] [PubMed]
- Wejnerowski, Ł.; Rzymski, P.; Kokociński, M.; Meriluoto, J. The structure and toxicity of winter cyanobacterial bloom in a eutrophic lake of the temperate zone. Ecotoxicology 2018, 27, 752–760. [Google Scholar] [CrossRef]
- Stark, G.F.; Martin, R.M.; Smith, L.E.; Wei, B.; Hellweger, F.L.; Bullerjahn, G.S.; McKay, R.M.L.; Boyer, G.L.; Wilhelm, S.W. Microcystin aids in cold temperature acclimation: Differences between a toxic Microcystis wildtype and non-toxic mutant. Harmful Algae 2023, 129, 102531. [Google Scholar] [CrossRef]
- Chrapusta, E.; Węgrzyn, M.; Zabaglo, K.; Kaminski, A.; Adamski, M.; Wietrzyk, P.; Bialczyk, J. Microcystins and anatoxin-a in Arctic biocrust cyanobacterial communities. Toxicon 2015, 101, 35–40. [Google Scholar] [CrossRef]
- Jungblut, A.D.; Wilbraham, J.; Banack, S.A.; Metcalf, J.S.; Codd, G.A. Microcystins, BMAA and BMAA isomers in 100-year-old Antarctic cyanobacterial mats collected during Captain R.F. Scott’s Discovery Expedition. Eur. J. Phycol. 2018, 53, 115–121. [Google Scholar] [CrossRef]
- Ernst, B.; Hitzfeld, B.; Dietrich, B. Presence of Planktothrix sp. and cyanobacterial toxins in lake Ammersee, Germany and their impact on whitefish (Coregonus Lavaretus L.). Environ. Toxicol. 2001, 16, 483–488. [Google Scholar] [CrossRef] [PubMed]
- Kobos, J.; Błaszczyk, A.; Hohlfeld, N.; Toruńska-Sitarz, A.; Krakowiak, A.; Hebel, A.; Sutryk, K.; Grabowska, M.; Toporowska, M.; Kokociński, M.; et al. Cyanobacteria and cyanotoxins in Polish freshwater bodies. Oceanol. Hydrobiol. Stud. 2013, 42, 358–378. [Google Scholar] [CrossRef]
- Humbert, J.F.; Fastner, J. Ecology of cyanobacteria. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, G.A., Eds.; John Wiley & Sons: Chichester, UK, 2017; pp. 11–18. [Google Scholar] [CrossRef]
- Foy, R.H.; Gibson, C.E.; Smith, R.V. The influence of day length, light intensity and temperature on the growth rates of planktonic blue-green algae. Br. Phycol. J. 1976, 11, 151–163. [Google Scholar] [CrossRef]
- Foy, R.H. Interaction of temperature and light on the growth rates of two planktonic Oscillatoria species under a short photoperiod regime. Br. Phycol. J. 1983, 18, 267–273. [Google Scholar] [CrossRef]
- Nicklisch, A.; Roloff, B.; Ratsch, A. Competition experiments with two planktic blue-green algae (Oscillatoriaceae). Verh. Internat. Verein Limnol. 1991, 24, 889–892. [Google Scholar] [CrossRef]
- Kaštovský, J.; Hauer, T.; Mareš, J.; Krautová, M.; Bešta, T.; Komárek, J.; Desortová, B.; Heteša, J.; Hindáková, A.; Houk, V.; et al. A review of the alien and expansive species of freshwater cyanobacteria and algae in the Czech Republic. Biol. Invasions 2010, 12, 3599–3625. [Google Scholar] [CrossRef]
- Wilk-Woźniak, E.; Solarz, W.; Najberek, K.; Pociecha, A. Alien cyanobacteria: An unsolved part of the “expansion and evolution” jigsaw puzzle? Hydrobiologia 2016, 764, 65–79. [Google Scholar] [CrossRef]
- Kokociński, M.; Gągała, I.; Jasser, I.; Karosienė, J.; Kasperovičienė, J.; Kobos, J.; Koreivienė, J.; Soininen, J.; Szczurowska, A.; Woszczyk, M.; et al. Distribution of invasive Cylindrospermopsis raciborskii in the East-Central Europe is driven by climatic and local environmental variables. FEMS Microbiol. Ecol. 2017, 93, fix035. [Google Scholar] [CrossRef] [PubMed]
- Rzymski, P.; Horyn, O.; Budzyńska, A.; Jurczak, T.; Kokociński, M.; Niedzielski, P.; Klimaszyk, P.; Falfushynska, H. A report of Cylindrospermopsis raciborskii and other cyanobacteria in the water reservoirs of power plants in Ukraine. Environ. Sci. Pollut. R. 2018, 25, 15245–15252. [Google Scholar] [CrossRef]
- Budzyńska, A.; Rosińska, J.; Pełechata, A.; Toporowska, M.; Napiórkowska-Krzebietke, A.; Kozak, A.; Messyasz, B.; Pęczuła, W.; Kokociński, M.; Szeląg-Wasielewska, E.; et al. Environmental factors driving the occurrence of the invasive cyanobacterium Sphaerospermopsis aphanizomenoides (Nostocales) in temperate lakes. Sci. Total Environ. 2019, 650, 1338–1347. [Google Scholar] [CrossRef]
- Dochin, K. The dominance of invasive algae Raphidiopsis raciborskii in lowland reservoirs in Bulgaria. Bulg. J. Agric. Sci. 2022, 28, 158–165. [Google Scholar]
- Dokulil, M.T. Vegetative survival of Cylindrospermopsis raciborskii (Cyanobacteria) at low temperature and low light. Hydrobiologia 2016, 764, 241–247. [Google Scholar] [CrossRef]
- Bonilla, S.; Aubriot, L.; Soares, M.C.S.; Gonzáles-Piana, M.; Fabre, A.; Huszar, V.L.M.; Lürling, M.; Antoniades, D.; Padisák, J.; Kruk, C. What drives the distribution of the bloom-forming cyanobacteria Planktothrix agardhii and Cylindrospermopsis raciborskii? FEMS Microbiol. Ecol. 2012, 79, 594–607. [Google Scholar] [CrossRef] [PubMed]
- Jia, N.; Wang, Y.; Guan, Y.; Chen, Y.; Li, R.; Yu, G. Occurrence of Raphidiopsis raciborskii blooms in cool waters: Synergistic effects of nitrogen availability and ecotypes with adaptation to low temperature. Environ. Pollut. 2021, 270, 116070. [Google Scholar] [CrossRef] [PubMed]
- Babanazarova, O.; Sidelev, S.; Schischeleva, S. The structure of winter phytoplankton in Lake Nero, Russia, a hypertrophic lake dominated by Planktothrix-like cyanobacteria. Aquat. Biosyst. 2013, 9, 18. [Google Scholar] [CrossRef] [PubMed]
- Padisák, J. Cylindrospermopsis raciborskii (Woloszynska) Seenayya et Subba Raju, an expanding, highly adaptive cyanobacterium: Worldwide distribution and review of its ecology. Arch. Hydrobiol. 1997, 107, 563–593. [Google Scholar]
- Mehnert, G.; Rücker, J.; Wiedner, C. Population dynamics and akinete formation of an invasive and a native cyanobacterium in temperate lakes. J. Plankton Res. 2014, 36, 378–387. [Google Scholar] [CrossRef]
- Gobler, C.J.; Davis, T.W.; Coyne, K.J.; Boyer, G.L. Interactive influences of nutrient loading, zooplankton grazing, and microcystin synthetase gene expression on cyanobacterial bloom dynamics in a eutrophic New York lake. Harmful Algae 2007, 6, 119–133. [Google Scholar] [CrossRef]
- Mazur-Marzec, H.; Błaszczyk, A.; Felczykowska, A.; Hohlfeld, N.; Kobos, J.; Toruńska-Sitarz, A.; Devi, P.; Montalvão, S.; D’souza, L.; Tammela, P.; et al. Baltic cyanobacteria—A source of biologically active compounds. Eur. J. Phycol. 2015, 50, 343–360. [Google Scholar] [CrossRef]
- Spoof, L.; Błaszczyk, A.; Meriluoto, J.; Cegłowska, M.; Mazur-Marzec, H. Structures and activity of new anabaenopeptins produced by Baltic Sea cyanobacteria. Mar. Drugs 2016, 14, 8. [Google Scholar] [CrossRef]
- Monteiro, P.R.; do Amaral, S.C.; Siqueira, A.S.; Xavier, L.P.; Santos, A.V. Anabaenopeptins: What We Know So Far. Toxins 2021, 13, 522. [Google Scholar] [CrossRef] [PubMed]
- Sedmak, B.; Carmeli, S.; Eleršek, T. “Non-toxic” cyclic peptides induce lysis of cyanobacteria—An effective cell population density control mechanism in cyanobacterial blooms. Microb. Ecol. 2008, 56, 201–209. [Google Scholar] [CrossRef]
- Sønstebø, J.H.; Rohrlack, T. Possible implications of chytrid parasitism for population subdivisions in freshwater cyanobacteria of the genus Planktothrix. Appl. Environ. Microbiol. 2011, 77, 1344–1351. [Google Scholar] [CrossRef]
- Urrutia-Cordero, P.; Agha, R.; Cirés, S.; Ángeles Lezcano, M.; Sánchez-Contreras, M.; Waara, K.O.; Utkilen, H.; Quesada, A. Effects of harmful cyanobacteria on the freshwater pathogenic free-living amoeba Acanthamoeba castellanii. Aquat. Toxicol. 2013, 130, 9–17. [Google Scholar] [CrossRef]
- Louati, I.; Pascault, N.; Debroas, D.; Bernard, C.; Humbert, J.F.; Leloup, J. Structural diversity of bacterial communities associated with bloom-forming freshwater cyanobacteria differs according to the cyanobacterial genus. PLoS ONE 2015, 10, e0140614. [Google Scholar] [CrossRef]
- Willis, A.; Chuang, A.W.; Woodhouse, J.N.; Neilan, B.A.; Burford, M.A. Intraspecific variation in growth, morphology and toxin quotas for the cyanobacterium, Cylindrospermopsis raciborskii. Toxicon 2016, 119, 307–310. [Google Scholar] [CrossRef]
- Xiao, M.; Willis, A.; Burford, M.A. Differences in cyanobacterial strain responses to light and temperature reflect species plasticity. Harmful Algae 2017, 62, 84–93. [Google Scholar] [CrossRef]
- Xiao, M.; Adams, M.P.; Willis, A.; Burford, M.A.; O’Brien, K.R. Variation within and between cyanobacterial species and strains affects competition: Implications for phytoplankton modelling. Harmful Algae 2017, 69, 38–47. [Google Scholar] [CrossRef]
- Johansson, E.; Legrand, C.; Björnerås, C.; Godhe, A.; Mazur-Marzec, H.; Säll, T.; Rengefors, K. High diversity of microcystin chemotypes within a summer bloom of the cyanobacterium Microcystis botrys. Toxins 2019, 11, 698. [Google Scholar] [CrossRef]
- Collins, S. Growth rate evolution in improved environments under Prodigal Son dynamics. Evol. Appl. 2016, 9, 1179–1188. [Google Scholar] [CrossRef]
- Lindberg, R.T.; Collins, S. Quality–quantity trade-offs drive functional trait evolution in a model microalgal ‘climate change winner’. Ecol. Lett. 2020, 23, 780–790. [Google Scholar] [CrossRef] [PubMed]
- Komárkowá, J.; Vyhnalek, V.; Kubecka, J. Impact of fishstock manipulation on the composition of net phytoplankton in the Rimov Reservoir (Czech Republic). Wat. Sci. Technol. 1995, 32, 207–216. [Google Scholar] [CrossRef]
- Guillard, R.R.L.; Lorenzen, C.J. Yellow-green algae with chlorophyllide c. J. Phycol. 1972, 8, 10–14. [Google Scholar] [CrossRef]
- Komárek, J.; Anagnostidis, K. Cyanoprocaryota. 2. Teil: Oscillatoriales. In Süßwasserflora von Mitteleuropa 19/2; Büdel, B., Krienitz, L., Gärtner, G., Schagerl, M., Eds.; Elsevier GmbH: München, Germany, 2005. [Google Scholar]
- Komárek, J. Cyanoprokaryota: 3. Teil/3rd part: Heterocytous genera. In Süßwasserflora von Mitteleuropa Bd. 19/3; Büdel, B., Gärtner, G., Krienitz, L., Schagerl, L., Eds.; Springer Spectrum: Heidelberg, Germany, 2013. [Google Scholar]
- ISO 10260:1992; Water quality—Measurement of biochemical parameters—Spectrometric determination of the chlorophyll—A concentration. International Organization for Standardization: Geneva, Switzerland, 1992.
- ISO 15681-1:2003; Water quality—Determination of orthophosphate and total phosphorus contents by flow analysis (FIA and CFA)—Part 1: Method by flow injection analysis (FIA). International Organization for Standardization: Geneva, Switzerland, 2003.
- ISO 29441:2010; Water quality—Determination of total nitrogen after UV digestion—Method using flow analysis (CFA and FIA) and spectrometric detection. International Organization for Standardization: Geneva, Switzerland, 2010.
- Rajaniemi, P.; Hrouzek, P.; Kaštovská, K.; Willame, R.; Rantala, A.; Hoffmann, L.; Komárek, J.; Sivonen, K. Phylogenetic and morphological evaluation of the genera Anabaena, Aphanizomenon, Trichormus and Nostoc (Nostocales, Cyanobacteria). Int. J. Syst. Evol. Micr. 2005, 55, 11–26. [Google Scholar] [CrossRef] [PubMed]
- Gaget, V.; Gribaldo, S.; Tandeau de Marsac, N. An rpoB signature sequence provides unique resolution for the molecular typing of cyanobacteria. Int. J. Syst. Evol. Micr. 2011, 61, 170–183. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Akter, S.; Vehniäinen, M.; Spoof, L.; Nybom, S.; Meriluoto, J.; Lamminmäki, U. Broad-spectrum noncompetitive immunocomplex immunoassay for cyanobacterial peptide hepatotoxins (microcystins and nodularins). Anal. Chem. 2016, 88, 10080–10087. [Google Scholar] [CrossRef]
- Kaczkowski, Z.; Wojtal-Frankiewicz, A.; Gągała, I.; Mankiewicz-Boczek, J.; Jaskulska, A.; Frankiewicz, P.; Izydorczyk, K.; Jurczak, T.; Godlewska, M. Relationships among cyanobacteria, zooplankton and fish in sub-bloom conditions in the Sulejow Reservoir. J. Limnol. 2017, 76, 380–396. [Google Scholar] [CrossRef]
- Ballot, A.; Fastner, J.; Lentz, M.; Wiedner, C. First report of anatoxin-a-producing cyanobacterium Aphanizomenon issatschenkoi in northeastern Germany. Toxicon 2010, 56, 964–971. [Google Scholar] [CrossRef] [PubMed]
- Mihali, T.K.; Kellmann, R.; Muenchhoff, J.; Barrow, K.D.; Neilan, B.A. Characterization of the gene cluster responsible for cylindrospermopsin biosynthesis. Appl. Environ. Microbiol. 2008, 74, 716–722. [Google Scholar] [CrossRef] [PubMed]
- Rantala, A.; Rajaniemi-Wacklin, P.; Lyra, C.; Lepistö, L.; Rintala, J.; Mankiewicz-Boczek, J.; Sivonen, K. Detection of microcystin-producing cyanobacteria in Finnish lakes with genus-specific microcystin synthetase gene E (mcyE) PCR and associations with environmental factors. Appl. Environ. Microbiol. 2006, 72, 6101–6110. [Google Scholar] [CrossRef] [PubMed]
Cyanometabolite | Method | Summer Sampling | Winter Sampling | |||||||
---|---|---|---|---|---|---|---|---|---|---|
P. agardhii W49 | P. agardhii W67 | R. raciborskii W73 | R. raciborskii W88 | A. gracile W4 | A. gracile W58 | A. gracile W71 | A. gracile W89 | P. agardhii W70 | ||
APs | ELISA | + | + | + | + | + | + | + | ||
ATX-a | ELISA | (f+) | (f+) | (f+) | ||||||
HPLC-DAD | NA | |||||||||
LC-MS | NA | |||||||||
anaF gene | ||||||||||
CYN | HPLC-DAD | NA | ||||||||
LC-MS | NA | |||||||||
cyrJ gene | ||||||||||
MCs | HPLC-DAD | + | NA | + | ||||||
LC-MS | + | NA | + | |||||||
mcyE gene | + | + | ||||||||
NOD | HPLC-DAD | NA | ||||||||
LC-MS | NA | |||||||||
MCs/NOD | TRFIA | + | NA | + | ||||||
STXs | ELISA |
Gene | Associated Metabolite | Primer Name [Primer Sequence (5′–3′)] | Annealing Temperature | Reference |
---|---|---|---|---|
anaF | ATX-a | Atoaf [TCGGAAGCGCGATCGCAAAT] Atxar [GCTTCCTGAGAAGGTCCGCT] | 57 °C | [82] |
cyrJ | CYN | cynsulfF [ACTTCTCTCCTTTCCCTATC] cylnamR [GAGTGAAAATGCGTAGAACTTG] | 57 °C | [83] |
mcyE | MCs | mcyE-F2 [GAAATTTGTGTAGAAGGTGC] mcyE-R4 [AATTCTAAAGCCCAAAGACG] | 56 °C | [84] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wejnerowski, Ł.; Dulić, T.; Akter, S.; Font-Nájera, A.; Rybak, M.; Kamiński, O.; Czerepska, A.; Dziuba, M.K.; Jurczak, T.; Meriluoto, J.; et al. Community Structure and Toxicity Potential of Cyanobacteria during Summer and Winter in a Temperate-Zone Lake Susceptible to Phytoplankton Blooms. Toxins 2024, 16, 357. https://doi.org/10.3390/toxins16080357
Wejnerowski Ł, Dulić T, Akter S, Font-Nájera A, Rybak M, Kamiński O, Czerepska A, Dziuba MK, Jurczak T, Meriluoto J, et al. Community Structure and Toxicity Potential of Cyanobacteria during Summer and Winter in a Temperate-Zone Lake Susceptible to Phytoplankton Blooms. Toxins. 2024; 16(8):357. https://doi.org/10.3390/toxins16080357
Chicago/Turabian StyleWejnerowski, Łukasz, Tamara Dulić, Sultana Akter, Arnoldo Font-Nájera, Michał Rybak, Oskar Kamiński, Anna Czerepska, Marcin Krzysztof Dziuba, Tomasz Jurczak, Jussi Meriluoto, and et al. 2024. "Community Structure and Toxicity Potential of Cyanobacteria during Summer and Winter in a Temperate-Zone Lake Susceptible to Phytoplankton Blooms" Toxins 16, no. 8: 357. https://doi.org/10.3390/toxins16080357