Virtual Multiplexing Chamber-Based Digital PCR for Camel Milk Authentication Applications
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparations of Reagent, Primers and Probes
Design of Specific Primers and Probes
2.2. Design and Fabrication of cdPCR Microfluidic Chip
2.3. Multiplexed Imaging and Data Processing
3. Results and Discussion
3.1. Benefits of Virtual Multiplex Imaging
3.2. Validation with ddPCR
3.3. Applications in Milk Authentication
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Agrimonti, C.; Pirondini, A.; Marmiroli, M.; Marmiroli, N. A quadruplex PCR (qxPCR) assay for adulteration in dairy products. Food Chem. 2015, 187, 58–64. [Google Scholar] [CrossRef]
- Kim, J.; Kim, H.Y. Direct duplex real-time loop mediated isothermal amplification assay for the simultaneous detection of cow and goat species origin of milk and yogurt products for field use. Food Chem. 2018, 246, 26–31. [Google Scholar] [CrossRef] [PubMed]
- Ahrberg, C.D.; Manz, A.; Chung, B.G. Polymerase chain reaction in microfluidic devices. Lab Chip 2016, 16, 3866–3884. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Xu, W.; Zhai, Z.; Luo, Y.; Yan, X.; Zhang, N.; Huang, K. Universal primer-multiplex-polymerase chain reaction (UP-M-PCR) and capillary electrophoresis–laser-induced fluorescence analysis for the simultaneous detection of six genetically modified maize lines. J. Agric. Food Chem. 2011, 59, 5188–5194. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Zhai, Z.; Huang, K.; Nan, Z.; Yanfang, Y.; Ying, S. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis. PLoS ONE 2012, 7, e22900. [Google Scholar] [CrossRef]
- Yuan, Y.; Xu, W.; Zhai, Z.; Shi, H.; Luo, Y.; Chen, Z.; Huang, K. Universal primer-multiplex PCR approach for simultaneous detection of Escherichia coli, Listeria monocytogenes, and Salmonella spp. in food samples. Food Sci. 2009, 74, M446–M452. [Google Scholar] [CrossRef]
- Shang, Y.; Zhu, P.; Xu, W.; Guo, T.; Tian, W.; Luo, Y.; Huang, K. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis. Anal. Biochem. 2013, 443, 243–248. [Google Scholar] [CrossRef]
- Zhang, N.; Xu, W.; Bai, W.; Zhai, Z.; Luo, Y.; Yan, X.; He, J.; Huang, K. Event-specific qualitative and quantitative PCR detection of LY038 maize in mixed samples. Food Control 2011, 22, 1287–1295. [Google Scholar] [CrossRef]
- Buh Gašparĭc, M.; Tengs, T.; La Paz, J.L.; Holst-Jensen, A.; Pla, M.; Esteve, T.; Žel, J.; Gruden, K. Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection. Anal. Bioanal. Chem. 2010, 396, 2023–2029. [Google Scholar] [CrossRef]
- Higuchi, R.; Fockler, C.; Dollinger, G.; Watson, R. Kinetic PCR analysis: Real-time monitoring of DNA amplification reactions. Biotechnology 1993, 11, 1026–1030. [Google Scholar] [CrossRef]
- Querci, M.; Foti, N.; Bogni, A.; Kluga, L.; Broll, H.; van den Eede, G. Real-time PCR-based ready-to-use multi-target analytical system for GMO detection. Food Anal. Methods 2009, 2, 325–336. [Google Scholar] [CrossRef]
- Heid, C.A.; Stevens, J.; Livak, K.J.; Williams, P.M. Real time quantitative PCR. Genome Res. 1996, 6, 986–994. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucl. Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Vogelstein, B.; Kinzler, K.W. Digital PCR. Proc. Natl. Acad. Sci. USA 1999, 96, 9236–9241. [Google Scholar] [CrossRef]
- Heyries, K.A.; Tropini, C.; VanInsberghe, M.; Doolin, C.; Petriv, O.I.; Singhal, A.; Leung, K.; Hughesman, C.B.; Hansen, C.L. Megapixel digital PCR. Nat. Methods 2011, 8, 649–651. [Google Scholar] [CrossRef] [PubMed]
- Loy, T.; Shaw, P.C. DNA-based techniques for authentication of processed food and food supplements. Food Chem. 2018, 240, 767–774. [Google Scholar] [CrossRef] [PubMed]
- Sreejith, K.R.; Ooi, C.H.; Jin, J.; Dao, D.V.; Nguyen, N.T. Digital polymerase chain reaction technology–recent advances and future perspectives. Lab Chip 2018, 18, 3717–3732. [Google Scholar]
- Chen, X.; Song, Q.; Zhang, B.; Gao, Y.; Lou, K.; Liu, Y.; Wen, W. A Rapid Digital PCR System with a Pressurized Thermal Cycler. Micromachines 2021, 12, 1562. [Google Scholar] [CrossRef] [PubMed]
- Si, H.; Xu, G.; Jing, F.; Sun, P.; Zhao, D.; Wu, D. A multi-volume microfluidic device with no reagent loss for low-cost digital PCR application. Sens. Actuators B Chem. 2020, 318, 128197. [Google Scholar] [CrossRef]
- Ottesen, E.A.; Hong, J.W.; Quake, S.R.; Leadbetter, J.R. Targeted enrichment of genomic DNA regions for next-generation sequencing. Science 2006, 314, 1464–1467. [Google Scholar] [CrossRef]
- Shen, F.; Du, W.; Kreutz, J.E.; Fok, A.; Ismagilov, R.F. Digital PCR on a Slip Chip. Lab Chip 2010, 10, 2666–2672. [Google Scholar] [CrossRef] [PubMed]
- Kojabad, A.A.; Farzanehpour, M.; Galeh, H.E.; Dorostkar, R.; Jafarpour, A.; Bolandian, M.; Nodooshan, M.M. Droplet digital PCR of viral DNA/RNA, current progress, challenges, and future perspectives. J. Med. Virol. 2021, 93, 4182–4197. [Google Scholar] [CrossRef]
- Wei, C.; Yu, C.; Li, S.; Meng, J.; Li, T.; Cheng, J.; Pan, F.; Li, J. Easy-to-operate co-flow step emulsification device for droplet digital polymerase chain reaction. Anal. Chem. 2022, 94, 3939–3947. [Google Scholar] [CrossRef] [PubMed]
- Wei, C.; Yu, C.; Li, S.; Meng, J.; Li, T.; Cheng, J.; Li, J. A droplet-based multivolume microfluidic device for digital polymerase chain reaction. Sens. Actuators B Chem. 2022, 371, 132473. [Google Scholar] [CrossRef]
- Cui, X.; Wu, L.; Wu, Y.; Zhang, J.; Zhao, Q.; Jing, F.; Yi, L.; Li, G. Fast and robust sample self-digitization for digital PCR. Anal. Chim. Acta 2020, 1107, 127–134. [Google Scholar] [CrossRef]
- Xu, G.; Si, H.; Jing, F.; Sun, P.; Wu, D. A Self-Priming Microfluidic Chip with Cushion Chambers for Easy Digital PCR. Biosensors 2021, 11, 158. [Google Scholar] [CrossRef]
- Hu, H.; Cheng, J.; Wei, C.; Li, S.; Yu, C.; Meng, X.; Li, J. Pre-Degassed Microfluidic Chamber-Based Digital PCR Device for Meat Authentication Applications. Micromachines 2021, 12, 694. [Google Scholar] [CrossRef]
- Yu, C.; Dai, S.; Zhang, Z.; Li, S.; Cheng, J.; Hu, H.; Wu, J.; Li, J. An integrated digital polymerase chain reaction chip for multiplexed meat adulteration detection. Electrophoresis 2023, accepted. [Google Scholar] [CrossRef]
- Liang, D.Y.; Tentori, A.M.; Dimov, I.K.; Lee, L.P. Systematic characterization of degas-driven flow for poly (dimethylsiloxane)microfluidic devices. Biomicrofluidics 2011, 5, 024108. [Google Scholar] [CrossRef]
- Yeh, E.-C.; Fu, C.-C.; Hu, L.; Thakur, R.; Feng, J.; Lee, L.P. Self-powered integrated microfluidic point-of-care low-cost enabling (SIMPLE) chip. Sci. Adv. 2017, 3, e1501645. [Google Scholar] [CrossRef]
Species | Primers/Probes | Sequence (5′→3′) |
---|---|---|
Cow milk | Primer upstream | TTAGCAGGCAACCTAGCCCA |
Primer downstream | CGAACAGAGGGGTTTGGTATTG | |
Probes | FAM-CTTCAGTAGATCTAACCATT-MGB | |
Camel milk | Primer upstream | CATCCACAGCAGTCCACACC |
Primer downstream | GGTAGAAGATGTAGGTGGAAGGAC | |
Probes | CY5-CCAGCCTCTTCACCAGTATCCCTGACA-BHQ1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Cheng, J.; Li, S.; Wu, J.J.; Li, J. Virtual Multiplexing Chamber-Based Digital PCR for Camel Milk Authentication Applications. Micromachines 2023, 14, 1619. https://doi.org/10.3390/mi14081619
Li J, Cheng J, Li S, Wu JJ, Li J. Virtual Multiplexing Chamber-Based Digital PCR for Camel Milk Authentication Applications. Micromachines. 2023; 14(8):1619. https://doi.org/10.3390/mi14081619
Chicago/Turabian StyleLi, Jinchao, Jingmeng Cheng, Shanshan Li, Jie Jayne Wu, and Junwei Li. 2023. "Virtual Multiplexing Chamber-Based Digital PCR for Camel Milk Authentication Applications" Micromachines 14, no. 8: 1619. https://doi.org/10.3390/mi14081619