Development and Characterization of Alkaline Phosphatase-Positive Human Umbilical Cord Perivascular Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Alkaline Phosphatase (ALP) Activity Assay
2.2. Morphological Observation of HUCPVCs
2.2.1. Alkaline Phosphatase Staining
2.2.2. Rhodamine Phalloidin–DAPI Staining
2.2.3. Fluorescent Immunostaining
2.3. Cell Proliferation Assay
2.4. Quantitative Polymerase Chain Reaction (qPCR) Analysis
2.5. Detection of Mineralized Nodules in HUCPVC
2.6. Characterization of Matrix Vesicles of HUCPVCs
2.6.1. Fractionation of Matrix Vesicles
2.6.2. ALP Activity Assay
2.6.3. Measurement of Ca Content
2.6.4. Western Blotting
2.7. Search for Calcification Inhibitor Produced by HUCPVCs
2.7.1. Preparation of Conditioned Medium from PPU7 and HUCPVCs
2.7.2. Preparation of Mineralization Medium Containing Conditioned Medium of PPU7 or HUCPVC
2.7.3. Comparison of Mineralized Nodules in PPU7 Cultured in Mineralization Medium Containing CM-PPU7 or CM-HUCPVC
2.8. Statistical Analysis
3. Results
3.1. Examination of Conditions for Producing ALP-Positive HUCPVCs
3.2. ALP Gene Expression and ALP Staining of HUCPVCs
3.3. Cell Proliferation Rate of HUCPVCs
3.4. Quantitative PCR Analysis of HUCPVCs
3.5. Observation of Actin Filaments of HUCPVCs
3.6. Mineralization-Induction Ability of HUCPVCs
3.7. Characterization of Matrix Vesicle in HUCPVCs
3.8. Effect of CM-PPU7 and CM-HUCPVC on Mineralization-Induction Ability
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| MHC-II | major histocompatibility complex class II molecules |
| LDN | 4-[6-[4-(1-piperazinyl)phenyl]pyrazol [1,5-a]pyrimidin-3-yl]-quinolinehydrochloride |
| SB | 4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]-benzamide |
| MTS | 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphentl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt) |
| SDS | sodium dodecyl sulfate |
| PAGE | polyacrylamide gel electrophoresis |
| PVDF | polyvinylidene difluoride |
| ID | internal diameter |
Appendix A
Preparation of HUCPVC
Appendix B


| Gene | Sequence (5′---3′) | Product Size (bp) | qPCR Protocol (45 Cycles) | |||
|---|---|---|---|---|---|---|
| ALP | F | GGACCATTCCCACGTCTTCA | 128 | |||
| R | CAGGCCCATTGCCATACA | |||||
| COL1a1 | F | CGAGAGCATGACCGATGGAT | 141 | |||
| R | ACGCTGTTCTTGCAGTGGTA | |||||
| OPN | F | ACACATATGATGGCCGAGGTGA | 116 | |||
| R | GTGTGAGGTGATGTCCTCGTCTGTA | |||||
| RUNX2 | F | CTTTGTAGCACAAACATTGCTGGA | 122 | |||
| R | CAAAGCTGTGGTACCTGTTCTGGA | |||||
| OC | F | CAGAGTCCAGCAAAGGTGCAG | 178 | |||
| R | ATGTGGTCAGCCAACTCGTC | |||||
| ELN | F | CTTGGAGGTGTCCTAGGGGGT | 80 | |||
| R | ATGGGAGACAATCCGAAGCCA | |||||
| FBN-1 | F | TCAATGGCTACCCCAAACGG | 128 | Denaturation | 95 °C | 10 s |
| R | GGCTGTCTTCTCAACATCCCA | |||||
| MYOD1 | F | CGACGGCATGATGGACTACA | 134 | Annealing | 60 °C | 10 s |
| R | GGCAGTCTAGGCTCGACAC | |||||
| MYF5 | F | GGCATGCCCGAATGTAACAG | 150 | Extension | 72 °C | 15 s |
| R | GGTGATCCGGTCCACTATGT | |||||
| POSTN | F | ACACACCCGTGAGGAAGTTG | 80 | |||
| R | TCACTGAGAACGACCTTCCCT | |||||
| PLAP1 | F | TCCCAAATCATTAGCAGAACTCA | 145 | |||
| R | AAATGCCCCTGGCTCTATCC | |||||
| CD90 | F | TCTCCTCCCAGAACGTCACA | 137 | |||
| R | GGACATGAAATCCGTGGCCT | |||||
| α-SMA | F | GGCTCTGGGCTCTGTAAGGC | 142 | |||
| R | TCTGTGCTTCGTCACCCACG | |||||
| PIT1 | F | CCTCCATAAGGCAGATCCAGT | 147 | |||
| R | AGGATGGTACCCCACAGAGG | |||||
| CD73 | F | GCAACATGGGCAACCTGATT | 133 | |||
| R | TTGCGTTCATCAATGGGCGA | |||||
| CD105 | F | AAGGTGCACTGCCTCAACAT | 148 | |||
| R | CAGGAACTCGGAGACGGATG | |||||
| GAPDH | F | CCATCACCATCTTCCAGGAG | 346 | |||
| R | ACAGTCTTCTGGGTGGCAGT | |||||
References
- Haynesworth, S.E.; Goshima, J.; Goldberg, V.M.; Caplan, A.I. Characterization of cells with osteogenic potential from human marrow. Bone 1992, 13, 81–88. [Google Scholar] [CrossRef]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [Green Version]
- Halvorsen, Y.C.; Wilkison, W.O.; Gimble, J.M. Adipose-derived stromal cells—Their utility and potential in bone formation. Int. J. Obes. Relat. Metab. Disord. 2000, 24 (Suppl. 4), S41–S44. [Google Scholar] [CrossRef] [Green Version]
- Zuk, P.A.; Zhu, M.; Mizuno, H.; Huang, J.; Futrell, J.W.; Katz, A.J.; Benhaim, P.; Lorenz, H.P.; Hedrick, M.H. Multilineage Cells from Human Adipose Tissue: Implications for Cell-Based Therapies. Tissue Eng. 2001, 7, 211–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- In’t Anker, P.S.; Scherjon, S.A.; Kleijburg-van der Keur, C.; de Groot-Swings, G.M.; Claas, F.H.; Fibbe, W.E.; Kanhai, H.H. Isolation of Mesenchymal Stem Cells of Fetal or Maternal Origin from Human Placenta. Stem Cells 2004, 22, 1338–1345. [Google Scholar] [CrossRef] [PubMed]
- Romanov, Y.A.; Svintsitskaya, V.A.; Smirnov, V.N. Searching for Alternative Sources of Postnatal Human Mesenchymal Stem Cells: Candidate MSC-Like Cells from Umbilical Cord. Stem Cells 2003, 21, 105–110. [Google Scholar] [CrossRef] [Green Version]
- He, S.; Gleason, J.; Fik-Rymarkiewicz, E.; DiFiglia, A.; Bharathan, M.; Morschauser, A.; Djuretic, I.; Xu, Y.; Krakovsky, M.; Jankovic, V.; et al. Human Placenta-Derived Mesenchymal Stromal-Like Cells Enhance Angiogenesis via T Cell-Dependent Reprogramming of Macrophage Differentiation. Stem Cells 2017, 35, 1603–1613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, G.T.; Gronthos, S.; Shi, S. Mesenchymal Stem Cells Derived from Dental Tissues vs. Those from Other Sources: Their Biology and Role in Regenerative Medicine. J. Dent. Res. 2009, 88, 792–806. [Google Scholar] [CrossRef]
- Hasegawa, N.; Kawaguchi, H.; Hirachi, A.; Takeda, K.; Mizuno, N.; Nishimura, M.; Koike, C.; Tsuji, K.; Iba, H.; Kato, Y.; et al. Behavior of Transplanted Bone Marrow-Derived Mesenchymal Stem Cells in Periodontal Defects. J. Periodontol. 2006, 77, 1003–1007. [Google Scholar] [CrossRef]
- Wang, H.S.; Hung, S.C.; Peng, S.T.; Huang, C.C.; Wei, H.M.; Guo, Y.J.; Fu, Y.S.; Lai, M.C.; Chen, C.C. Mesenchymal Stem Cells in the Wharton’s Jelly of the Human Umbilical Cord. Stem Cells 2004, 22, 1330–1337. [Google Scholar] [CrossRef] [Green Version]
- Sarugaser, R.; Lickorish, D.; Baksh, D.; Hosseini, M.M.; Davies, J.E. Human Umbilical Cord Perivascular (HUCPV) Cells: A Source of Mesenchymal Progenitors. Stem Cells 2005, 23, 220–229. [Google Scholar] [CrossRef] [PubMed]
- Sarugaser, R.; Hanoun, L.; Keating, A.; Stanford, W.L.; Davies, J.E. Human Mesenchymal Stem Cells Self-Renew and Differentiate According to a Deterministic Hierarchy. PLoS ONE 2009, 4, e6498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zebardast, N.; Lickorish, D.; Davies, J.E. Human umbilical cord perivascular cells (HUCPVC): A mesenchymal cell source for dermal wound healing. Organogenesis 2010, 6, 197–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shohara, R.; Yamamoto, A.; Takikawa, S.; Iwase, A.; Hibi, H.; Kikkawa, F.; Ueda, M. Mesenchymal stromal cells of human umbilical cord Wharton’s jelly accelerate wound healing by paracrine mechanisms. Cytotherapy 2012, 14, 1171–1181. [Google Scholar] [CrossRef] [PubMed]
- Szaraz, P.; Librach, M.; Mander, P.; Hoseini, B.; Librach, M.; Iqbal, F.; Librach, C. A solution to prevent secondary flow in adherent cell cultures. Biol. Open 2019, 8, bio045294. [Google Scholar] [CrossRef] [Green Version]
- Szaraz, P.; Mander, P.; Gasner, N.; Librach, M.; Iqbal, F.; Librach, C. Glucose withdrawal induces Endothelin 1 release with significant angiogenic effect from first trimester (FTM), but not term human umbilical cord perivascular cells (HUCPVC). Angiogenesis 2020, 23, 131–144. [Google Scholar] [CrossRef] [PubMed]
- Gauthier-Fisher, A.; Kauffman, A.; Librach, C.L. Potential use of stem cells for fertility preservation. Andrology 2020, 8, 862–878. [Google Scholar] [CrossRef] [Green Version]
- Kajiyama, S.; Ujiie, Y.; Nishikawa, S.; Inoue, K.; Shirakawa, S.; Hanada, N.; Liddell, R.; Davies, J.E.; Gomi, K. Bone formation by human umbilical cord perivascular cells. J. Biomed. Mater. Res. A 2015, 103, 2807–2814. [Google Scholar] [CrossRef]
- Kajiyama, S.; Nagashima, Y.; Funatsu, T.; Suzuki, T.; Fukaya, M.; Matsushima, Y.; Nagano, T.; Davies, J.E.; Gomi, K. Effects of Conditioned Medium from Bone Marrow Cells on Human Umbilical Cord Perivascular Cells. Tissue Eng. Part A 2021, 27, 382–389. [Google Scholar] [CrossRef] [PubMed]
- Harris, H. The human alkaline phosphatases: What we know and what we don’t know. Clin. Chim. Acta 1990, 186, 133–150. [Google Scholar] [CrossRef]
- Miao, D.; Scutt, A. Histochemical Localization of Alkaline Phosphatase Activity in Decalcified Bone and Cartilage. J. Histochem. Cytochem. 2002, 50, 333–340. [Google Scholar] [CrossRef]
- Liu, B.; Lu, Y.; Wang, Y.; Ge, L.; Zhai, N.; Han, J. A protocol for isolation and identification and comparative characterization of primary osteoblasts from mouse and rat calvaria. Cell Tissue Bank 2019, 20, 173–182. [Google Scholar] [CrossRef] [Green Version]
- Štefková, K.; Procházková, J.; Pacherník, J. Alkaline Phosphatase in Stem Cells. Stem Cells Int. 2015, 2015, 628368. [Google Scholar] [CrossRef] [Green Version]
- Karakida, T.; Onuma, K.; Saito, M.M.; Yamamoto, R.; Chiba, T.; Chiba, R.; Hidaka, Y.; Fujii-Abe, K.; Kawahara, H.; Yamakoshi, Y. Potential for Drug Repositioning of Midazolam for Dentin Regeneration. Int. J. Mol. Sci. 2019, 20, 670. [Google Scholar] [CrossRef] [Green Version]
- Nagano, T.; Oida, S.; Suzuki, S.; Iwata, T.; Yamakoshi, Y.; Ogata, Y.; Gomi, K.; Arai, T.; Fukae, M. Porcine Enamel Protein Fractions Contain Transforming Growth Factor-β1. J. Periodontol. 2006, 77, 1688–1694. [Google Scholar] [CrossRef] [Green Version]
- Hayashi, Y.; Nagasawa, H. Matrix vesicles isolated from apical pulp of rat incisors: Crystal formation in low Ca X Pi ion-product medium containing β-glycerophosphate. Calcif. Tissue Int. 1990, 47, 365–372. [Google Scholar] [CrossRef]
- Igarashi, M.; Kamiya, N.; Hasegawa, M.; Kasuya, T.; Takahashi, T.; Takagi, M. Inductive effects of dexamethasone on the gene expression of Cbfa1, Osterix and bone matrix proteins during differentiation of cultured primary rat osteoblasts. J. Mol. Histol. 2004, 35, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; van der Kraan, P.M.; van den Dolder, J.; Walboomers, X.F.; Bian, Z.; Fan, M.; Jansen, J.A. STRO-1 Selected Rat Dental Pulp Stem Cells Transfected with Adenoviral-Mediated Human Bone Morphogenetic Protein 2 Gene Show Enhanced Odontogenic Differentiation. Tissue Eng. 2007, 13, 2803–2812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohazama, A.; Tucker, A.; Sharpe, P.T. Organized Tooth-specific Cellular Differentiation Stimulated by BMP4. J. Dent. Res. 2005, 84, 603–606. [Google Scholar] [CrossRef]
- Zhang, T.; Shao, H.; Xu, K.Q.; Kuang, L.T.; Chen, R.F.; Xiu, H.H. Midazolam suppresses osteogenic differentiation of human bone marrow-derived mesenchymal stem cells. Eur. Rev. Med. Pharmacol. Sci. 2014, 18, 1411–1418. [Google Scholar] [PubMed]
- Sloan, A.J.; Rutherford, R.B.; Smith, A.J. Stimulation of the rat dentine-pulp complex by bone morphogenetic protein-7 in vitro. Arch. Oral Biol. 2000, 45, 173–177. [Google Scholar] [CrossRef]
- Katagiri, T.; Yamaguchi, A.; Komaki, M.; Abe, E.; Takahashi, N.; Ikeda, T.; Rosen, V.; Wozney, J.M.; Fujisawa-Sehara, A.; Suda, T. Bone Morphogenetic Protein-2 Converts the Differentiation Pathway of C2C12 Myoblasts into the Osteoblast Lineage. J. Cell Biol. 1994, 127, 1755–1766. [Google Scholar] [CrossRef] [Green Version]
- Chen, G.; Deng, C.; Li, Y.P. TGF-β and BMP Signaling in Osteoblast Differentiation and Bone Formation. Int. J. Biol. Sci. 2012, 8, 272–288. [Google Scholar] [CrossRef] [Green Version]
- Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef]
- Abe, T.; Hara, Y.; Abe, Y.; Aida, Y.; Maeda, K. Isolation of alkaline phosphatase-positive gingival fibroblasts from patients with chronic inflammatory periodontal disease. J. Periodontal Res. 1996, 31, 285–293. [Google Scholar] [CrossRef]
- Tsurumi, A.; Kobayashi, M.; Murayama, R.; Usui, M.; Koide, Y.; Yamamoto, M. Characterization of Alkaline Phosphatase-Positive and -Negative Cells Isolated from Human Periodontal Ligament Cells (Japanese). Dent. Med. Res. 2009, 29, 28–39. [Google Scholar] [CrossRef]
- Tomasek, J.J.; Gabbiani, G.; Hinz, B.; Chaponnier, C.; Brown, R.A. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002, 3, 349–363. [Google Scholar] [CrossRef]
- Kis, K.; Liu, X.; Hagood, J.S. Myofibroblast differentiation and survival in fibrotic disease. Expert Rev. Mol. Med. 2011, 13, e27. [Google Scholar] [CrossRef] [PubMed]
- Desmoulière, A.; Geinoz, A.; Gabbiani, F.; Gabbiani, G. Transforming Growth Factor-β1 Induces α-Smooth Muscle Actin Expression in Granulation Tissue Myofibroblasts and in Quiescent and Growing Cultured Fibroblasts. J. Cell Biol. 1993, 122, 103–111. [Google Scholar] [CrossRef] [Green Version]
- Van der Rest, M.; Garrone, R. Collagen family of proteins. FASEB J. 1991, 5, 2814–2823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baranyi, U.; Winter, B.; Gugerell, A.; Hegedus, B.; Brostjan, C.; Laufer, G.; Messner, B. Primary Human Fibroblasts in Culture Switch to a Myofibroblast-Like Phenotype Independently of TGF Beta. Cells 2019, 8, 721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sandbo, N.; Dulin, N. Actin cytoskeleton in myofibroblast differentiation: Ultrastructure defining form and driving function. Transl. Res. 2011, 158, 181–196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, J.; Ma, Q. Osteopontin enhances multi-walled carbon nanotube-triggered lung fibrosis by promoting TGF-β1 activation and myofibroblast differentiation. Part. Fibre Toxicol. 2017, 14, 18. [Google Scholar] [CrossRef] [PubMed]
- Tsukui, T.; Ueha, S.; Abe, J.; Hashimoto, S.; Shichino, S.; Shimaoka, T.; Shand, F.H.; Arakawa, Y.; Oshima, K.; Hattori, M.; et al. Qualitative Rather than Quantitative Changes Are Hallmarks of Fibroblasts in Bleomycin-Induced Pulmonary Fibrosis. Am. J. Pathol. 2013, 183, 758–773. [Google Scholar] [CrossRef]
- Hidaka, Y.; Chiba-Ohkuma, R.; Karakida, T.; Onuma, K.; Yamamoto, R.; Fujii-Abe, K.; Saito, M.M.; Yamakoshi, Y.; Kawahara, H. Combined Effect of Midazolam and Bone Morphogenetic Protein-2 for Differentiation Induction from C2C12 Myoblast Cells to Osteoblasts. Pharmaceutics 2020, 12, 218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.; Yu, K.; Liu, D.; Yang, J.; Tan, L.; Zhang, D. Irisin enhances osteogenic differentiation of mouse MC3T3-E1 cells via upregulating osteogenic genes. Exp. Ther. Med. 2021, 21, 580. [Google Scholar] [CrossRef]
- Ansari, S.; de Wildt, B.W.M.; Vis, M.A.M.; de Korte, C.E.; Ito, K.; Hofmann, S.; Yuana, Y. Matrix Vesicles: Role in Bone Mineralization and Potential Use as Therapeutics. Pharmaceuticals 2021, 14, 289. [Google Scholar] [CrossRef]
- Hasegawa, T.; Yamamoto, T.; Tsuchiya, E.; Hongo, H.; Tsuboi, K.; Kudo, A.; Abe, M.; Yoshida, T.; Nagai, T.; Khadiza, N.; et al. Ultrastructural and biochemical aspects of matrix vesicle-mediated mineralization. Jpn. Dent. Sci. Rev. 2017, 53, 34–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vogel, K.G.; Ordög, A.; Pogány, G.; Oláh, J. Proteoglycans in the compressed region of human tibialis posterior tendon and in ligaments. J. Orthop. Res. 1993, 11, 68–77. [Google Scholar] [CrossRef]
- Hakkinen, L.; Oksala, O.; Salo, T.; Rahemtulla, F.; Larjava, H. Immunohistochemical Localization of Proteoglycans in Human Periodontium. J. Histochem. Cytochem. 1993, 41, 1689–1699. [Google Scholar] [CrossRef] [Green Version]
- Qian, H.; Xiao, Y.; Bartold, P.M. Immunohistochemical localization and expression of fibromodulin in adult rat periodontium and inflamed human gingiva. Oral Dis. 2004, 10, 233–239. [Google Scholar] [CrossRef] [PubMed]
- Weiskirchen, R.; Weiskirchen, S.; Tacke, F. Organ and tissue fibrosis: Molecular signals, cellular mechanisms and translational implications. Mol. Asp. Med. 2019, 65, 2–15. [Google Scholar] [CrossRef]
- Jun, J.I.; Lau, L.F. Resolution of organ fibrosis. J. Clin. Investig. 2018, 128, 97–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horowitz, J.C.; Thannickal, V.J. Mechanisms for the Resolution of Organ Fibrosis. Physiology 2019, 34, 43–55. [Google Scholar] [CrossRef]
- Ennis, J.; Sarugaser, R.; Gomez, A.; Baksh, D.; Davies, J.E. Isolation, Characterization, and Differentiation of Human Umbilical Cord Perivascular Cells (HUCPVCs). Methods Cell Biol. 2008, 86, 121–136. [Google Scholar] [PubMed]










Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nonoyama, S.; Karakida, T.; Chiba-Ohkuma, R.; Yamamoto, R.; Ujiie, Y.; Nagano, T.; Yamakoshi, Y.; Gomi, K. Development and Characterization of Alkaline Phosphatase-Positive Human Umbilical Cord Perivascular Cells. Cells 2021, 10, 3011. https://doi.org/10.3390/cells10113011
Nonoyama S, Karakida T, Chiba-Ohkuma R, Yamamoto R, Ujiie Y, Nagano T, Yamakoshi Y, Gomi K. Development and Characterization of Alkaline Phosphatase-Positive Human Umbilical Cord Perivascular Cells. Cells. 2021; 10(11):3011. https://doi.org/10.3390/cells10113011
Chicago/Turabian StyleNonoyama, Shun, Takeo Karakida, Risako Chiba-Ohkuma, Ryuji Yamamoto, Yuko Ujiie, Takatoshi Nagano, Yasuo Yamakoshi, and Kazuhiro Gomi. 2021. "Development and Characterization of Alkaline Phosphatase-Positive Human Umbilical Cord Perivascular Cells" Cells 10, no. 11: 3011. https://doi.org/10.3390/cells10113011
APA StyleNonoyama, S., Karakida, T., Chiba-Ohkuma, R., Yamamoto, R., Ujiie, Y., Nagano, T., Yamakoshi, Y., & Gomi, K. (2021). Development and Characterization of Alkaline Phosphatase-Positive Human Umbilical Cord Perivascular Cells. Cells, 10(11), 3011. https://doi.org/10.3390/cells10113011

