Chemogenetic Activation of CX3CR1-Expressing Spinal Microglia Using Gq-DREADD Elicits Mechanical Allodynia in Male Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice
2.2. Drug Administration
2.3. Microglia Depletion
2.4. Immunohistochemistry
2.5. Von Frey Test
2.6. Hargreaves Test
2.7. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)
2.8. Statistical Analysis
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Colloca, L.; Ludman, T.; Bouhassira, D.; Baron, R.; Dickenson, A.H.; Yarnitsky, D.; Freeman, R.; Truini, A.; Attal, N.; Finnerup, N.B.; et al. Neuropathic pain. Nat. Rev. Dis. Primers. 2017, 3, 17002. [Google Scholar] [CrossRef] [Green Version]
- Jensen, T.S.; Finnerup, N.B. Allodynia and hyperalgesia in neuropathic pain: Clinical manifestations and mechanisms. Lancet Neurol. 2014, 13, 924–935. [Google Scholar] [CrossRef]
- Van Hecke, O.; Austin, S.K.; Khan, R.A.; Smith, B.H.; Torrance, N. Neuropathic pain in the general population: A systematic review of epidemiological studies. Pain 2014, 155, 654–662. [Google Scholar] [CrossRef]
- Bouhassira, D.; Lanteri-Minet, M.; Attal, N.; Laurent, B.; Touboul, C. Prevalence of chronic pain with neuropathic characteristics in the general population. Pain 2008, 136, 380–387. [Google Scholar] [CrossRef] [Green Version]
- Jaggi, A.S.; Jain, V.; Singh, N. Animal models of neuropathic pain. Fundam. Clin. Pharmacol. 2011, 25, 1–28. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Zhang, Y.Q.; Qadri, Y.J.; Serhan, C.N.; Ji, R.R. Microglia in Pain: Detrimental and Protective Roles in Pathogenesis and Resolution of Pain. Neuron 2018, 100, 1292–1311. [Google Scholar] [CrossRef] [Green Version]
- Inoue, K.; Tsuda, M. Microglia in neuropathic pain: Cellular and molecular mechanisms and therapeutic potential. Nat. Rev. Neurosci. 2018, 19, 138–152. [Google Scholar] [CrossRef]
- Kierdorf, K.; Prinz, M. Microglia in steady state. J. Clin. Investig. 2017, 127, 3201–3209. [Google Scholar] [CrossRef] [Green Version]
- Kettenmann, H.; Hanisch, U.K.; Noda, M.; Verkhratsky, A. Physiology of microglia. Physiol. Rev. 2011, 91, 461–553. [Google Scholar] [CrossRef]
- Ji, R.R.; Chamessian, A.; Zhang, Y.Q. Pain regulation by non-neuronal cells and inflammation. Science 2016, 354, 572–577. [Google Scholar] [CrossRef] [Green Version]
- Kataoka, A.; Tozaki-Saitoh, H.; Koga, Y.; Tsuda, M.; Inoue, K. Activation of P2X7 receptors induces CCL3 production in microglial cells through transcription factor NFAT. J. Neurochem. 2009, 108, 115–125. [Google Scholar] [CrossRef]
- Simpson, J.E.; Newcombe, J.; Cuzner, M.L.; Woodroofe, M.N. Expression of monocyte chemoattractant protein-1 and other beta-chemokines by resident glia and inflammatory cells in multiple sclerosis lesions. J. Neuroimmunol. 1998, 84, 238–249. [Google Scholar] [CrossRef]
- Sorge, R.E.; Mapplebeck, J.C.; Rosen, S.; Beggs, S.; Taves, S.; Alexander, J.K.; Martin, L.J.; Austin, J.S.; Sotocinal, S.G.; Chen, D.; et al. Different immune cells mediate mechanical pain hypersensitivity in male and female mice. Nat. Neurosci. 2015, 18, 1081–1083. [Google Scholar] [CrossRef] [Green Version]
- Urban, D.J.; Roth, B.L. DREADDs (designer receptors exclusively activated by designer drugs): Chemogenetic tools with therapeutic utility. Annu. Rev. Pharmacol. Toxicol. 2015, 55, 399–417. [Google Scholar] [CrossRef] [PubMed]
- Roth, B.L. DREADDs for Neuroscientists. Neuron 2016, 89, 683–694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Whissell, P.D.; Tohyama, S.; Martin, L.J. The Use of DREADDs to Deconstruct Behavior. Front. Genet. 2016, 7, 70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grace, P.M.; Wang, X.; Strand, K.A.; Baratta, M.V.; Zhang, Y.; Galer, E.L.; Yin, H.; Maier, S.F.; Watkins, L.R. DREADDed microglia in pain: Implications for spinal inflammatory signaling in male rats. Exp. Neurol. 2018, 304, 125–131. [Google Scholar] [CrossRef] [PubMed]
- Saika, F.; Matsuzaki, S.; Kobayashi, D.; Ideguchi, Y.; Nakamura, T.Y.; Kishioka, S.; Kiguchi, N. Chemogenetic Regulation of CX3CR1-Expressing Microglia Using Gi-DREADD Exerts Sex-Dependent Anti-Allodynic Effects in Mouse Models of Neuropathic Pain. Front. Pharmacol. 2020, 11, 925. [Google Scholar] [CrossRef]
- Kiguchi, N.; Uta, D.; Ding, H.; Uchida, H.; Saika, F.; Matsuzaki, S.; Fukazawa, Y.; Abe, M.; Sakimura, K.; Ko, M.C.; et al. GRP receptor and AMPA receptor cooperatively regulate itch-responsive neurons in the spinal dorsal horn. Neuropharmacology 2020, 170, 108025. [Google Scholar] [CrossRef] [PubMed]
- Elmore, M.R.; Najafi, A.R.; Koike, M.A.; Dagher, N.N.; Spangenberg, E.E.; Rice, R.A.; Kitazawa, M.; Matusow, B.; Nguyen, H.; West, B.L.; et al. Colony-stimulating factor 1 receptor signaling is necessary for microglia viability, unmasking a microglia progenitor cell in the adult brain. Neuron 2014, 82, 380–397. [Google Scholar] [CrossRef] [Green Version]
- Ma, D.; Zhao, Y.; Huang, L.; Xiao, Z.; Chen, B.; Shi, Y.; Shen, H.; Dai, J. A novel hydrogel-based treatment for complete transection spinal cord injury repair is driven by microglia/macrophages repopulation. Biomaterials 2020, 237, 119830. [Google Scholar] [CrossRef] [PubMed]
- Chaplan, S.R.; Bach, F.W.; Pogrel, J.W.; Chung, J.M.; Yaksh, T.L. Quantitative assessment of tactile allodynia in the rat paw. J. Neurosci. Methods 1994, 53, 55–63. [Google Scholar] [CrossRef]
- Dixon, W.J. Efficient analysis of experimental observations. Annu. Rev. Pharmacol. Toxicol. 1980, 20, 441–462. [Google Scholar] [CrossRef]
- Nayak, D.; Roth, T.L.; McGavern, D.B. Microglia development and function. Annu. Rev. Immunol. 2014, 32, 367–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanisch, U.K.; Kettenmann, H. Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci. 2007, 10, 1387–1394. [Google Scholar] [CrossRef] [PubMed]
- Hickman, S.; Izzy, S.; Sen, P.; Morsett, L.; el Khoury, J. Microglia in neurodegeneration. Nat. Neurosci. 2018, 21, 1359–1369. [Google Scholar] [CrossRef]
- Guan, Z.; Kuhn, J.A.; Wang, X.; Colquitt, B.; Solorzano, C.; Vaman, S.; Guan, A.K.; Evans-Reinsch, Z.; Braz, J.; Devor, M.; et al. Injured sensory neuron-derived CSF1 induces microglial proliferation and DAP12-dependent pain. Nat. Neurosci. 2016, 19, 94–101. [Google Scholar] [CrossRef]
- Patel, S.; Player, M.R. Colony-stimulating factor-1 receptor inhibitors for the treatment of cancer and inflammatory disease. Curr. Top. Med. Chem. 2009, 9, 599–610. [Google Scholar] [CrossRef]
- Calvo, M.; Dawes, J.M.; Bennett, D.L. The role of the immune system in the generation of neuropathic pain. Lancet Neurol. 2012, 11, 629–642. [Google Scholar] [CrossRef]
- Kiguchi, N.; Kobayashi, Y.; Maeda, T.; Saika, F.; Kishioka, S. CC-chemokine MIP-1alpha in the spinal cord contributes to nerve injury-induced neuropathic pain. Neurosci. Lett. 2010, 484, 17–21. [Google Scholar] [CrossRef]
- Milligan, E.D.; Watkins, L.R. Pathological and protective roles of glia in chronic pain. Nat. Rev. Neurosci. 2009, 10, 23–36. [Google Scholar] [CrossRef]
- Sweitzer, S.; Martin, D.; DeLeo, J.A. Intrathecal interleukin-1 receptor antagonist in combination with soluble tumor necrosis factor receptor exhibits an anti-allodynic action in a rat model of neuropathic pain. Neuroscience 2001, 103, 529–539. [Google Scholar] [CrossRef]
- Reeve, A.J.; Patel, S.; Fox, A.; Walker, K.; Urban, L. Intrathecally administered endotoxin or cytokines produce allodynia, hyperalgesia and changes in spinal cord neuronal responses to nociceptive stimuli in the rat. Eur. J. Pain 2000, 4, 247–257. [Google Scholar] [CrossRef]
- Svensson, C.I.; Schafers, M.; Jones, T.L.; Powell, H.; Sorkin, L.S. Spinal blockade of TNF blocks spinal nerve ligation-induced increases in spinal P-p38. Neurosci. Lett. 2005, 379, 209–213. [Google Scholar] [CrossRef]
- Rojewska, E.; Zychowska, M.; Piotrowska, A.; Kreiner, G.; Nalepa, I.; Mika, J. Involvement of Macrophage Inflammatory Protein-1 Family Members in the Development of Diabetic Neuropathy and Their Contribution to Effectiveness of Morphine. Front. Immunol. 2018, 9, 494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Filipovic, R.; Zecevic, N. Neuroprotective role of minocycline in co-cultures of human fetal neurons and microglia. Exp. Neurol. 2008, 211, 41–51. [Google Scholar] [CrossRef]
- Gonzalez, J.C.; Egea, J.; del Carmen-Godino, M.; Fernandez-Gomez, F.J.; Sanchez-Prieto, J.; Gandia, L.; Garcia, A.G.; Jordan, J.; Hernandez-Guijo, J.M. Neuroprotectant minocycline depresses glutamatergic neurotransmission and Ca(2+) signalling in hippocampal neurons. Eur. J. Neurosci. 2007, 26, 2481–2495. [Google Scholar] [CrossRef]
- Peng, H.Z.; Ma, L.X.; Lv, M.H.; Hu, T.; Liu, T. Minocycline enhances inhibitory transmission to substantia gelatinosa neurons of the rat spinal dorsal horn. Neuroscience 2016, 319, 183–193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sweitzer, S.M.; Schubert, P.; DeLeo, J.A. Propentofylline, a glial modulating agent, exhibits antiallodynic properties in a rat model of neuropathic pain. J. Pharmacol. Exp. Ther. 2001, 297, 1210–1217. [Google Scholar]
- Gwak, Y.S.; Crown, E.D.; Unabia, G.C.; Hulsebosch, C.E. Propentofylline attenuates allodynia, glial activation and modulates GABAergic tone after spinal cord injury in the rat. Pain 2008, 138, 410–422. [Google Scholar] [CrossRef] [Green Version]
- Binning, W.; Hogan-Cann, A.E.; Yae-Sakae, D.; Maksoud, M.; Ostapchenko, V.; Al-Onaizi, M.; Matovic, S.; Lu, W.Y.; Prado, M.A.M.; Inoue, W.; et al. Chronic hM3Dq signaling in microglia ameliorates neuroinflammation in male mice. Brain Behav. Immun. 2020, 88, 791–801. [Google Scholar] [CrossRef] [PubMed]
- Barnes, B.J.; Richards, J.; Mancl, M.; Hanash, S.; Beretta, L.; Pitha, P.M. Global and distinct targets of IRF-5 and IRF-7 during innate response to viral infection. J. Biol. Chem. 2004, 279, 45194–45207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Izaguirre, A.; Barnes, B.J.; Amrute, S.; Yeow, W.S.; Megjugorac, N.; Dai, J.; Feng, D.; Chung, E.; Pitha, P.M.; Fitzgerald-Bocarsly, P. Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells. J. Leukoc. Biol. 2003, 74, 1125–1138. [Google Scholar] [CrossRef]
- Takaoka, A.; Yanai, H.; Kondo, S.; Duncan, G.; Negishi, H.; Mizutani, T.; Kano, S.; Honda, K.; Ohba, Y.; Mak, T.W.; et al. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature 2005, 434, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Masuda, T.; Iwamoto, S.; Yoshinaga, R.; Tozaki-Saitoh, H.; Nishiyama, A.; Mak, T.W.; Tamura, T.; Tsuda, M.; Inoue, K. Transcription factor IRF5 drives P2X4R+-reactive microglia gating neuropathic pain. Nat. Commun. 2014, 5, 3771. [Google Scholar] [CrossRef] [Green Version]
- Al Mamun, A.; Chauhan, A.; Yu, H.; Xu, Y.; Sharmeen, R.; Liu, F. Interferon regulatory factor 4/5 signaling impacts on microglial activation after ischemic stroke in mice. Eur. J. Neurosci. 2018, 47, 140–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ning, S.; Pagano, J.S.; Barber, G.N. IRF7: Activation, regulation, modification and function. Genes Immun. 2011, 12, 399–414. [Google Scholar] [CrossRef] [Green Version]
- Donnelly, C.R.; Andriessen, A.S.; Chen, G.; Wang, K.; Jiang, C.; Maixner, W.; Ji, R.R. Central Nervous System Targets: Glial Cell Mechanisms in Chronic Pain. Neurotherapeutics 2020, 17, 846–860. [Google Scholar] [CrossRef] [PubMed]
- Ji, R.R.; Donnelly, C.R.; Nedergaard, M. Astrocytes in chronic pain and itch. Nat. Rev. Neurosci. 2019, 20, 667–685. [Google Scholar] [CrossRef] [PubMed]
- Mogil, J.S. Qualitative sex differences in pain processing: Emerging evidence of a biased literature. Nat. Rev. Neurosci. 2020, 21, 353–365. [Google Scholar] [CrossRef]
- Chen, G.; Luo, X.; Qadri, M.Y.; Berta, T.; Ji, R.R. Sex-Dependent Glial Signaling in Pathological Pain: Distinct Roles of Spinal Microglia and Astrocytes. Neurosci. Bull. 2018, 34, 98–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berta, T.; Qadri, Y.J.; Chen, G.; Ji, R.R. Microglial Signaling in Chronic Pain with a Special Focus on Caspase 6, p38 MAP Kinase, and Sex Dependence. J. Dent. Res. 2016, 95, 1124–1131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guneykaya, D.; Ivanov, A.; Hernandez, D.P.; Haage, V.; Wojtas, B.; Meyer, N.; Maricos, M.; Jordan, P.; Buonfiglioli, A.; Gielniewski, B.; et al. Transcriptional and Translational Differences of Microglia from Male and Female Brains. Cell Rep. 2018, 24, 2773–2783.e2776. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Villa, A.; Gelosa, P.; Castiglioni, L.; Cimino, M.; Rizzi, N.; Pepe, G.; Lolli, F.; Marcello, E.; Sironi, L.; Vegeto, E.; et al. Sex-Specific Features of Microglia from Adult Mice. Cell Rep. 2018, 23, 3501–3511. [Google Scholar] [CrossRef] [PubMed]
- Hassan, S.; Muere, A.; Einstein, G. Ovarian hormones and chronic pain: A comprehensive review. Pain 2014, 155, 2448–2460. [Google Scholar] [CrossRef]
- Lee, J.Y.; Choi, H.Y.; Ju, B.G.; Yune, T.Y. Estrogen alleviates neuropathic pain induced after spinal cord injury by inhibiting microglia and astrocyte activation. Biochim. Biophys. Acta 2018, 1864, 2472–2480. [Google Scholar] [CrossRef]
- Li, L.; Fan, X.; Warner, M.; Xu, X.J.; Gustafsson, J.A.; Wiesenfeld-Hallin, Z. Ablation of estrogen receptor alpha or beta eliminates sex differences in mechanical pain threshold in normal and inflamed mice. Pain 2009, 143, 37–40. [Google Scholar] [CrossRef]
- Yu, X.; Liu, H.; Hamel, K.A.; Morvan, M.G.; Yu, S.; Leff, J.; Guan, Z.; Braz, J.M.; Basbaum, A.I. Dorsal root ganglion macrophages contribute to both the initiation and persistence of neuropathic pain. Nat. Commun. 2020, 11, 264. [Google Scholar] [CrossRef] [Green Version]
- Yi, M.H.; Liu, Y.U.; Liu, K.; Chen, T.; Bosco, D.B.; Zheng, J.; Xie, M.; Zhou, L.; Qu, W.; Wu, L.J. Chemogenetic manipulation of microglia inhibits neuroinflammation and neuropathic pain in mice. Brain Behav. Immun. 2020. [Google Scholar] [CrossRef]
Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
GAPDH | GGGTGTGAACCACGAGAAAT | ACTGTGGTCATGAGCCCTTC |
IL-1β | AAAGCTCTCCACCTCAATGG | AGGCCACAGGTATTTTGTCG |
TNF-α | CCCCAAAGGGATGAGAAGTT | TGGGCTACAGGCTTGTCACT |
CCL3 | CTGCCCTTGCTGTTCTTCTC | GTGGAATCTTCCGGCTGTAG |
CCL4 | ATGAACTCTGCGTGTCTGC | GCCGGGAGGTGTAAGAGAAA |
Iba1 | ATGAGCCAAAGCAGGGATTT | TTGGGATCATCGAGGAATTG |
CD11b | GTTTCTACTGTCCCCCAGCA | GTTGGAGCCGAACAAATAGC |
IRF5 | ACACTGAAGGGGTGATGAG | CGAGGGCCATCATAGAACAG |
IRF7 | GTGTGTCCCCAGGATCATTT | CTGCAGAACCTGAAGCAAGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saika, F.; Matsuzaki, S.; Kishioka, S.; Kiguchi, N. Chemogenetic Activation of CX3CR1-Expressing Spinal Microglia Using Gq-DREADD Elicits Mechanical Allodynia in Male Mice. Cells 2021, 10, 874. https://doi.org/10.3390/cells10040874
Saika F, Matsuzaki S, Kishioka S, Kiguchi N. Chemogenetic Activation of CX3CR1-Expressing Spinal Microglia Using Gq-DREADD Elicits Mechanical Allodynia in Male Mice. Cells. 2021; 10(4):874. https://doi.org/10.3390/cells10040874
Chicago/Turabian StyleSaika, Fumihiro, Shinsuke Matsuzaki, Shiroh Kishioka, and Norikazu Kiguchi. 2021. "Chemogenetic Activation of CX3CR1-Expressing Spinal Microglia Using Gq-DREADD Elicits Mechanical Allodynia in Male Mice" Cells 10, no. 4: 874. https://doi.org/10.3390/cells10040874