Aggregated Tau-PHF6 (VQIVYK) Potentiates NLRP3 Inflammasome Expression and Autophagy in Human Microglial Cells
Abstract
:1. Introduction
2. Material and Methods
2.1. Cell Culture
2.2. Aggregation Assay
2.3. Microscopic Analysis of Aggregates
2.4. Circular Dichroism (CD) Spectroscopy
2.5. Dose and Time Dependency
2.6. Cell Viability
2.6.1. CTB Assay
2.6.2. LDH Release Assay
2.7. Gene Expression Analysis
2.8. Western Blot
2.9. Immunocytochemistry
2.10. Caspase-1 Activity Kit
2.11. ELISA
2.12. Detection of Autophagosome Formation
2.13. Analysis
3. Results
3.1. PHF6 Rapidly Forms Aggregates
3.2. aPHF6 Affects the Metabolic Activity of Microglia in A Time- and Concentration-Dependent Manner
3.3. aPHF6 Induced NLRP3 mRNA and Protein Upregulation
3.4. aPHF6 Induced Upregulation of ASC (PYCARD) and M1 Markers
3.5. aPHF6 Upregulated Caspase-1 Activity, Inflammatory Cytokines, and M2 Markers
3.6. aPHF6 Induced Autophagy after 6 h in HMC3 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
References
- Nichols, E.; Szoeke, C.E.I.; Vollset, S.E.; Abbasi, N.; Abd-Allah, F.; Abdela, J.; Aichour, M.T.E.; Akinyemi, R.O.; Alahdab, F.; Asgedom, S.W.; et al. Global, regional, and national burden of Alzheimer's disease and other dementias, 1990–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet Neurol. 2019, 18, 88–106. [Google Scholar] [CrossRef] [Green Version]
- Hyman, B.T.; Phelps, C.H.; Beach, T.G.; Bigio, E.H.; Cairns, N.J.; Carrillo, M.C.; Dickson, D.W.; Duyckaerts, C.; Frosch, M.P.; Masliah, E.; et al. National Institute on Aging-Alzheimer's Association guidelines for the neuropathologic assessment of Alzheimer disease. Alzheimer's Dement. 2012, 8, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arriagada, P.V.; Growdon, J.H.; Hedley-Whyte, E.T.; Hyman, B.T. Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer’s disease. Neurology 1992, 42, 631. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, A.R.; Berger, F.; Berger, C.L.; Hendricks, A.G. Tau directs intracellular trafficking by regulating the forces exerted by kinesin and dynein teams. Traffic 2018, 19, 111–121. [Google Scholar] [CrossRef] [Green Version]
- Guo, T.; Noble, W.; Hanger, D.P. Roles of tau protein in health and disease. Acta Neuropathol. 2017, 133, 665–704. [Google Scholar] [CrossRef] [Green Version]
- Martin, L.; Latypova, X.; Terro, F. Post-translational modifications of tau protein: Implications for Alzheimer’s disease. Neurochem. Int. 2011, 58, 458–471. [Google Scholar] [CrossRef]
- Ganguly, P.; Do, T.D.; Larini, L.; Lapointe, N.E.; Sercel, A.J.; Shade, M.F.; Feinstein, S.C.; Bowers, M.T.; Shea, J.E. Tau assembly: The dominant role of PHF6 (VQIVYK) in microtubule binding region repeat R3. J. Phys. Chem. B 2015, 119, 4582–4593. [Google Scholar] [CrossRef] [Green Version]
- KrishnaKumar, V.G.; Paul, A.; Gazit, E.; Segal, D. Mechanistic insights into remodeled Tau-derived PHF6 peptide fibrils by Naphthoquinone-Tryptophan hybrids. Sci. Rep. 2018, 8, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Fitzpatrick, A.W.P.; Falcon, B.; He, S.; Murzin, A.G.; Murshudov, G.; Garringer, H.J.; Crowther, R.A.; Ghetti, B.; Goedert, M.; Scheres, S.H.W. Cryo-EM structures of tau filaments from Alzheimer's disease. Nature 2017, 547, 185–190. [Google Scholar] [CrossRef] [Green Version]
- Fanni, A.M.; Vander Zanden, C.M.; Majewska, P.V.; Majewski, J.; Chi, E.Y. Membrane-mediated fibrillation and toxicity of the tau hexapeptide PHF6. J. Biol. Chem. 2019, 294, 15304–15317. [Google Scholar] [CrossRef]
- Frenkel-Pinter, M.; Richman, M.; Belostozky, A.; Abu-Mokh, A.; Gazit, E.; Rahimipour, S.; Segal, D. Selective Inhibition of Aggregation and Toxicity of a Tau-Derived Peptide using Its Glycosylated Analogues. Chem. A Eur. J. 2016, 22, 5945–5952. [Google Scholar] [CrossRef]
- Mohamed, T.; Hoang, T.; Jelokhani-Niaraki, M.; Rao, P.P.N. Tau-Derived-Hexapeptide 306VQIVYK311 Aggregation Inhibitors: Nitrocatechol Moiety as A Pharmacophore In Drug Design. ACS Chem. Neurosci. 2013, 4, 1559–1570. [Google Scholar] [CrossRef] [Green Version]
- Cunningham, C. Microglia and neurodegeneration: The role of systemic inflammation. Glia 2013, 61, 71–90. [Google Scholar] [CrossRef]
- Heneka, M.T.; Carson, M.J.; Khoury, J.E.; Landreth, G.E.; Brosseron, F.; Feinstein, D.L.; Jacobs, A.H.; Wyss-Coray, T.; Vitorica, J.; Ransohoff, R.M.; et al. Neuroinflammation in Alzheimer's disease. Lancet Neurol. 2015, 14, 388–405. [Google Scholar] [CrossRef] [Green Version]
- Heneka, M.T.; Kummer, M.P.; Stutz, A.; Delekate, A.; Schwartz, S.; Vieira-Saecker, A.; Griep, A.; Axt, D.; Remus, A.; Tzeng, T.C.; et al. NLRP3 is activated in Alzheimer's disease and contributes to pathology in APP/PS1 mice. Nature 2013, 493, 674–678. [Google Scholar] [CrossRef]
- Broz, P.; Dixit, V.M. Inflammasomes: Mechanism of assembly, regulation and signalling. Nat. Rev. Immunol. 2016, 16, 407–420. [Google Scholar] [CrossRef]
- Jo, E.K.; Kim, J.K.; Shin, D.M.; Sasakawa, C. Molecular mechanisms regulating NLRP3 inflammasome activation. Cell. Mol. Immunol. 2016, 13, 148–159. [Google Scholar] [CrossRef] [Green Version]
- Martinon, F.; Burns, K.; Tschopp, J. The Inflammasome: A molecular platform triggering activation of inflammatory caspases and processing of pro IL-β. Mol. Cell 2002, 10, 417–426. [Google Scholar] [CrossRef]
- Vogels, T.; Murgoci, A.N.; Hromádka, T. Intersection of pathological tau and microglia at the synapse. Acta Neuropathol. Commun. 2019, 7, 109. [Google Scholar] [CrossRef]
- Reed-Geaghan, E.G.; Savage, J.C.; Hise, A.G.; Landreth, G.E. CD14 and Toll-Like Receptors 2 and 4 Are Required for Fibrillar Aβ-Stimulated Microglial Activation. J. Neurosci. 2009, 29, 11982–11992. [Google Scholar] [CrossRef]
- Halle, A.; Hornung, V.; Petzold, G.C.; Stewart, C.R.; Monks, B.G.; Reinheckel, T.; Fitzgerald, K.A.; Latz, E.; Moore, K.J.; Golenbock, D.T. The NALP3 inflammasome is involved in the innate immune response to amyloid-β. Nat. Immunol. 2008, 9, 857–865. [Google Scholar] [CrossRef] [Green Version]
- Koenigsknecht, J.; Landreth, G. Microglial phagocytosis of fibrillar β-amyloid through a β1 integrin-dependent mechanism. J. Neurosci. 2004, 24, 9838–9846. [Google Scholar] [CrossRef] [Green Version]
- Koenigsknecht-Talboo, J.; Landreth, G.E. Microglial phagocytosis induced by fibrillar β-amyloid and IgGs are differentially regulated by proinflammatory cytokines. J. Neurosci. 2005, 25, 8240–8249. [Google Scholar] [CrossRef]
- Asai, H.; Ikezu, S.; Tsunoda, S.; Medalla, M.; Luebke, J.; Haydar, T.; Wolozin, B.; Butovsky, O.; Kügler, S.; Ikezu, T. Depletion of microglia and inhibition of exosome synthesis halt tau propagation. Nat. Neurosci. 2015, 18, 1584–1593. [Google Scholar] [CrossRef]
- Hopp, S.C.; Lin, Y.; Oakley, D.; Roe, A.D.; Devos, S.L.; Hanlon, D.; Hyman, B.T. The role of microglia in processing and spreading of bioactive tau seeds in Alzheimer’s disease. J. Neuroinflamm. 2018, 15, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Gorlovoy, P.; Larionov, S.; Pham, T.T.H.; Neumann, H. Accumulation of tau induced in neurites by microglial proinflammatory mediators. FASEB J. 2009, 23, 2502–2513. [Google Scholar] [CrossRef]
- Stancu, I.C.; Cremers, N.; Vanrusselt, H.; Couturier, J.; Vanoosthuyse, A.; Kessels, S.; Lodder, C.; Brône, B.; Huaux, F.; Octave, J.N.; et al. Aggregated Tau activates NLRP3–ASC inflammasome exacerbating exogenously seeded and non-exogenously seeded Tau pathology in vivo. Acta Neuropathol. 2019, 137, 599–617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Glick, D.; Barth, S.; Macleod, K.F. Autophagy: Cellular and molecular mechanisms. J Pathol 2010, 221, 3–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Houtman, J.; Freitag, K.; Gimber, N.; Schmoranzer, J.; Heppner, F.L.; Jendrach, M. Beclin1-driven autophagy modulates the inflammatory response of microglia via NLRP 3. EMBO J. 2019, 38, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Lucin, K.M.; O'Brien, C.E.; Bieri, G.; Czirr, E.; Mosher, K.I.; Abbey, R.J.; Mastroeni, D.F.; Rogers, J.; Spencer, B.; Masliah, E.; et al. Microglial Beclin 1 Regulates Retromer Trafficking and Phagocytosis and Is Impaired in Alzheimer’s Disease. Neuron 2013, 79, 873–886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reddy, P.H.; Oliver, D.M. Amyloid Beta and Phosphorylated Tau-Induced Defective Autophagy and Mitophagy in Alzheimer's Disease. Cells 2019, 8, 488. [Google Scholar] [CrossRef] [Green Version]
- Omata, Y.; Lim, Y.M.; Akao, Y.; Tsuda, L. Age-induced reduction of autophagy-related gene expression is associated with onset of Alzheimer's disease. Am. J. Neurodegener. Dis. 2014, 3, 134–142. [Google Scholar]
- Nixon, R.A.; Wegiel, J.; Kumar, A.; Yu, W.H.; Peterhoff, C.; Cataldo, A.; Cuervo, A.M. Extensive involvement of autophagy in Alzheimer disease: An immuno-electron microscopy study. J. Neuropathol. Exp. Neurol. 2005, 64, 113–122. [Google Scholar] [CrossRef] [Green Version]
- Kuang, H.; Tan, C.Y.; Tian, H.Z.; Liu, L.H.; Yang, M.W.; Hong, F.F.; Yang, S.L. Exploring the bi-directional relationship between autophagy and Alzheimer's disease. CNS Neurosci. 2020, 26, 155–166. [Google Scholar] [CrossRef] [Green Version]
- Caballero, B.; Wang, Y.; Diaz, A.; Tasset, I.; Juste, Y.R.; Stiller, B.; Mandelkow, E.M.; Mandelkow, E.; Cuervo, A.M. Interplay of pathogenic forms of human tau with different autophagic pathways. Aging Cell 2018, 17, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Ciechanover, A.; Kwon, Y.T.A. Degradation of misfolded proteins in neurodegenerative diseases: Therapeutic targets and strategies. Exp. Mol. Med. 2015, 47, e147. [Google Scholar] [CrossRef] [Green Version]
- Ising, C.; Venegas, C.; Zhang, S.; Scheiblich, H.; Schmidt, S.V.; Vieira-Saecker, A.; Schwartz, S.; Albasset, S.; McManus, R.M.; Tejera, D.; et al. NLRP3 inflammasome activation drives tau pathology. Nature 2019, 575, 669–673. [Google Scholar] [CrossRef]
- Dello Russo, C.; Cappoli, N.; Coletta, I.; Mezzogori, D.; Paciello, F.; Pozzoli, G.; Navarra, P.; Battaglia, A. The human microglial HMC3 cell line: Where do we stand? A systematic literature review. J. Neuroinflamm. 2018, 15, 1–24. [Google Scholar] [CrossRef] [Green Version]
- Micsonai, A.; Wien, F.; Bulyáki, É.; Kun, J.; Moussong, É.; Lee, Y.H.; Goto, Y.; Réfrégiers, M.; Kardos, J. BeStSel: A web server for accurate protein secondary structure prediction and fold recognition from the circular dichroism spectra. Nucleic Acids Res. 2018, 46, W315–W322. [Google Scholar] [CrossRef]
- Habib, P.; Dreymueller, D.; Ludwig, A.; Beyer, C.; Dang, J. Sex steroid hormone-mediated functional regulation of microglia-like BV-2 cells during hypoxia. J. Steroid Biochem. Mol. Biol. 2013, 138, 195–205. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Green Version]
- Thankam, F.G.; Dilisio, M.F.; Dietz, N.E.; Agrawal, D.K. TREM-1, HMGB1 and RAGE in the Shoulder Tendon: Dual Mechanisms for Inflammation Based on the Coincidence of Glenohumeral Arthritis. PLoS ONE 2016, 11, e0165492. [Google Scholar] [CrossRef] [Green Version]
- Faul, F.; Erdfelder, E.; Buchner, A.; Lang, A.G. Statistical power analyses using G*Power 3.1: Tests for correlation and regression analyses. Behav. Res. Methods 2009, 41, 1149–1160. [Google Scholar] [CrossRef] [Green Version]
- Guru KrishnaKumar, V.; Baweja, L.; Ralhan, K.; Gupta, S. Carbamylation promotes amyloidogenesis and induces structural changes in Tau-core hexapeptide fibrils. Biochim. Et Biophys. Acta Gen. Subj. 2018, 1862, 2590–2604. [Google Scholar] [CrossRef]
- Khurana, R.; Coleman, C.; Ionescu-Zanetti, C.; Carter, S.A.; Krishna, V.; Grover, R.K.; Roy, R.; Singh, S. Mechanism of thioflavin T binding to amyloid fibrils. J. Struct. Biol. 2005, 151, 229–238. [Google Scholar] [CrossRef]
- Greenfield, N.J. Using circular dichroism spectra to estimate protein secondary structure. Nat. Protoc. 2007, 1, 2876–2890. [Google Scholar] [CrossRef]
- Micsonai, A.; Wien, F.; Kernya, L.; Lee, Y.H.; Goto, Y.; Réfrégiers, M.; Kardos, J. Accurate secondary structure prediction and fold recognition for circular dichroism spectroscopy. Proc. Natl. Acad. Sci. USA 2015, 112, E3095–E3103. [Google Scholar] [CrossRef] [Green Version]
- Bittar, A.; Bhatt, N.; Kayed, R. Advances and considerations in AD tau-targeted immunotherapy. Neurobiol. Dis. 2020, 134, 104707. [Google Scholar] [CrossRef]
- Roberts, M.; Sevastou, I.; Imaizumi, Y.; Mistry, K.; Talma, S.; Dey, M.; Gartlon, J.; Ochiai, H.; Zhou, Z.; Akasofu, S.; et al. Pre-clinical characterisation of E2814, a high-affinity antibody targeting the microtubule-binding repeat domain of tau for passive immunotherapy in Alzheimer's disease. Acta Neuropathol. Commun. 2020, 8, 13. [Google Scholar] [CrossRef]
- Martín-Sánchez, F.; Diamond, C.; Zeitler, M.; Gomez, A.I.; Baroja-Mazo, A.; Bagnall, J.; Spiller, D.; White, M.; Daniels, M.J.D.; Mortellaro, A.; et al. Inflammasome-dependent IL-1β release depends upon membrane permeabilisation. Cell Death Differ. 2016, 23, 1219–1231. [Google Scholar] [CrossRef] [Green Version]
- Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef] [PubMed]
- Schölwer, I.; Habib, P.; Voelz, C.; Rolfes, L.; Beyer, C.; Slowik, A. NLRP3 Depletion Fails to Mitigate Inflammation but Restores Diminished Phagocytosis in BV-2 Cells After In Vitro Hypoxia. Mol. Neurobiol. 2020, 57, 2588–2599. [Google Scholar] [CrossRef] [PubMed]
- Slowik, A.; Lammerding, L.; Zendedel, A.; Habib, P.; Beyer, C. Impact of steroid hormones E2 and P on the NLRP3/ASC/Casp1 axis in primary mouse astroglia and BV-2 cells after in vitro hypoxia. J. Steroid Biochem. Mol. Biol. 2018, 183, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Cherry, J.D.; Olschowka, J.A.; O’Banion, M.K. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. J. Neuroinflamm. 2014, 11, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Ransohoff, R.M. A polarizing question: Do M1 and M2 microglia exist? Nat. Neurosci. 2016, 19, 987–991. [Google Scholar] [CrossRef]
- Tang, Y.; Le, W. Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Mol. Neurobiol. 2016, 53, 1181–1194. [Google Scholar] [CrossRef]
- Plaza-Zabala, A.; Sierra-Torre, V.; Sierra, A. Autophagy and microglia: Novel partners in neurodegeneration and aging. Int. J. Mol. Sci. 2017, 18, 598. [Google Scholar] [CrossRef] [Green Version]
- Shi, C.S.; Shenderov, K.; Huang, N.N.; Kabat, J.; Abu-Asab, M.; Fitzgerald, K.A.; Sher, A.; Kehrl, J.H. Activation of autophagy by inflammatory signals limits IL-1β production by targeting ubiquitinated inflammasomes for destruction. Nat. Immunol. 2012, 13, 255–263. [Google Scholar] [CrossRef]
- Liu, K.; Zhao, E.; Ilyas, G.; Lalazar, G.; Lin, Y.; Haseeb, M.; Tanaka, K.E.; Czaja, M.J. Impaired macrophage autophagy increases the immune response in obese mice by promoting proinflammatory macrophage polarization. Autophagy 2015, 11, 271–284. [Google Scholar] [CrossRef] [Green Version]
- Harris, J.; Hartman, M.; Roche, C.; Zeng, S.G.; O'Shea, A.; Sharp, F.A.; Lambe, E.M.; Creagh, E.M.; Golenbock, D.T.; Tschopp, J.; et al. Autophagy controls IL-1β secretion by targeting Pro-IL-1β for degradation. J. Biol. Chem. 2011, 286, 9587–9597. [Google Scholar] [CrossRef] [Green Version]
- Bjørkøy, G.; Lamark, T.; Brech, A.; Outzen, H.; Perander, M.; Øvervatn, A.; Stenmark, H.; Johansen, T. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005, 171, 603–614. [Google Scholar] [CrossRef] [Green Version]
- Komatsu, M.; Waguri, S.; Koike, M.; Sou, Y.s.; Ueno, T.; Hara, T.; Mizushima, N.; Iwata, J.i.; Ezaki, J.; Murata, S.; et al. Homeostatic Levels of p62 Control Cytoplasmic Inclusion Body Formation in Autophagy-Deficient Mice. Cell 2007, 131, 1149–1163. [Google Scholar] [CrossRef] [Green Version]
- Runwal, G.; Stamatakou, E.; Siddiqi, F.H.; Puri, C.; Zhu, Y.; Rubinsztein, D.C. LC3-positive structures are prominent in autophagy-deficient cells. Sci. Rep. 2019, 9, 1–14. [Google Scholar] [CrossRef] [Green Version]
Primer | Sequence | AT 1 [°C] |
---|---|---|
PYCARD | for: TGGATGCTCTGTACGGGAAG | 60 |
(ASC) | rev: CCAGGCTGGTTGAAACTGAA | |
B2M | for: TGGGATCGAGACATGTAAGCAG | 62 |
rev: AGCAAGCAAGCAGAATTTGGAA | ||
BECN1 | for: ACGTGGAAAAGAACCGCAAG | 60 |
(Beclin-1) | rev: ACTGAGCTTCCTCCTGATCCA | |
CD163 | for: AAAGTCCAGGAGGAGTGGGG | 65 |
rev: TCCAAATGCGTCCAGAACCT | ||
CD200R1 | for: CTTCATGGCCTGTAAAGATGGC | 60 |
rev: GGCTGGCCTCTAGGATTAT | ||
HPRT1 | for: CCTGGCGTVGTGATTAGTA | 60 |
rev: AGACGTTCAGTCCTGTCCAT | ||
IL1B | for: CTTCGAGGCACAAGGGACAA | 65 |
(IL1β) | rev: TTCACTGGCGAGCTCAGGTA | |
IL10 | for: GGCATCTACAAAGCCATGAGTG | 60 |
rev: ATAGAGTCGCCACCCTGATGT | ||
IL12A | for: GCTTTCAGAATTCGGGGAGTG | 60 |
rev: GTTTGGAGGGACCTCGCTTT | ||
IL18 | for: ATGCACCCCGGACCATATTT | 64 |
rev: TGTTCTCACAGGAGAGAGTTGA | ||
MRC1 | for: TGACGAATTGTGGATCGGCT | 62 |
rev: CGTTACAGGGGTCCCATCAC | ||
NLRP1 | for: GAGACAGCTGCCTGACACAT | 60 |
rev: ACTCCTGGCTTGGAGACTCA | ||
NLRP3 | for: CATCGGGGTCAAACAGCAAC | 60 |
rev: ACGACTGCGTCTCATCAAGG | ||
TLR4 | for: TGGATCAAGGACCAGAGGCA | 65 |
rev: GAGGACCGACACACCAATGA |
Antibody | Company | Order-No. | Host | Dilution |
---|---|---|---|---|
β-actin | Santa Cruz, Dallas, TX, USA | sc-47778 | mouse | 1:5000 |
ASC | Santa Cruz, USA | sc-271054 | mouse | 1:1000 |
BECN1 | Cell Signaling, Danvers, MA, USA | 3495 | rabbit | 1:1000 |
LC3II | Thermo Fisher Scientific, USA | PA1-46286 | rabbit | 1:1000 |
IL1β | Abcam, Cambridge, UK | ab9722 | rabbit | 1:1000 |
NLRP3 | Thermo Fisher Scientific, USA | PA5-79740 | rabbit | 1:1000 |
SQSTM1/p62 | Cell Signaling, USA | 5114 | rabbit | 1:1000 |
anti-mouse | Sigma–Aldrich, Germany | A4416 | goat | 1:4000 |
anti-rabbit | Bio-Rad, USA | 170-6515 | goat | 1:5000 |
Antibody | Company | Order-No. | Host | Dilution |
---|---|---|---|---|
ASC | Santa Cruz, USA | sc-271054 | mouse | 1:500 |
AIF1 (IBA1) | Millipore, Burlington, MA, USA | MABN92 | mouse | 1:100 |
NLRP3 | Bioss, Woburn, MA, USA | bs-10021R | rabbit | 1:500 |
anti-mouse 594 | Thermo Fisher Scientific, USA | A21203 | donkey | 1:500 |
anti-rabbit 488 | Thermo Fisher Scientific, USA | A21206 | donkey | 1:500 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Panda, C.; Voelz, C.; Habib, P.; Mevissen, C.; Pufe, T.; Beyer, C.; Gupta, S.; Slowik, A. Aggregated Tau-PHF6 (VQIVYK) Potentiates NLRP3 Inflammasome Expression and Autophagy in Human Microglial Cells. Cells 2021, 10, 1652. https://doi.org/10.3390/cells10071652
Panda C, Voelz C, Habib P, Mevissen C, Pufe T, Beyer C, Gupta S, Slowik A. Aggregated Tau-PHF6 (VQIVYK) Potentiates NLRP3 Inflammasome Expression and Autophagy in Human Microglial Cells. Cells. 2021; 10(7):1652. https://doi.org/10.3390/cells10071652
Chicago/Turabian StylePanda, Chinmaya, Clara Voelz, Pardes Habib, Christian Mevissen, Thomas Pufe, Cordian Beyer, Sharad Gupta, and Alexander Slowik. 2021. "Aggregated Tau-PHF6 (VQIVYK) Potentiates NLRP3 Inflammasome Expression and Autophagy in Human Microglial Cells" Cells 10, no. 7: 1652. https://doi.org/10.3390/cells10071652