Next Article in Journal
Emerging Evidence of Noncoding RNAs in Bleb Scarring after Glaucoma Filtration Surgery
Next Article in Special Issue
LINC00152 Drives a Competing Endogenous RNA Network in Human Hepatocellular Carcinoma
Previous Article in Journal
Target Hopping from Protein Kinases to PXR: Identification of Small-Molecule Protein Kinase Inhibitors as Selective Modulators of Pregnane X Receptor from TüKIC Library
Previous Article in Special Issue
The Regulatory Functions and the Mechanisms of Long Non-Coding RNAs in Cervical Cancer
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Chemopreventive Effects of Polyphenols and Coffee, Based upon a DMBA Mouse Model with microRNA and mTOR Gene Expression Biomarkers

1
Doctoral School of Health Sciences, Faculty of Health Sciences, University of Pécs, 7624 Pécs, Hungary
2
Department of Public Health Medicine, Medical School, University of Pécs, 7624 Pécs, Hungary
3
Institute of Transdisciplinary Discoveries, Medical School, University of Pécs, 7624 Pécs, Hungary
4
Institute of Physiology, Medical School, University of Pécs, 7624 Pécs, Hungary
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Cells 2022, 11(8), 1300; https://doi.org/10.3390/cells11081300
Submission received: 21 March 2022 / Revised: 8 April 2022 / Accepted: 10 April 2022 / Published: 12 April 2022
(This article belongs to the Special Issue Regulatory Roles of Non-coding RNAs in Cancer)

Abstract

:
Polyphenols are capable of decreasing cancer risk. We examined the chemopreventive effects of a green tea (Camellia sinensis) extract, polyphenol extract (a mixture of blackberry (Rubus fruticosus), blackcurrants (Ribes nigrum), and added resveratrol phytoalexin), Chinese bayberry (Myrica rubra) extract, and a coffee (Coffea arabica) extract on 7,12-dimethylbenz[a]anthracene (DMBA) carcinogen-increased miR-134, miR-132, miR-124-1, miR-9-3, and mTOR gene expressions in the liver, spleen, and kidneys of CBA/Ca mice. The elevation was quenched significantly in the organs, except for miR-132 in the liver of the Chinese bayberry extract-consuming group, and miR-132 in the kidneys of the polyphenol-fed group. In the coffee extract-consuming group, only miR-9-3 and mTOR decreased significantly in the liver; also, miR-134 decreased significantly in the spleen, and, additionally, miR-124-1 decreased significantly in the kidney. Our results are supported by literature data, particularly the DMBA generated ROS-induced inflammatory and proliferative signal transducers, such as TNF, IL1, IL6, and NF-κB; as well as oncogenes, namely RAS and MYC. The examined chemopreventive agents, besides the obvious antioxidant and anti-inflammatory effects, mainly blocked the mentioned DMBA-activated factors and the mitogen-activated protein kinase (MAPK) as well, and, at the same time, induced PTEN as well as SIRT tumor suppressor genes.

Graphical Abstract

1. Introduction

Nowadays, the incidence and mortality of cancer in high-income countries (HIC) is decreasing [1,2], but in the low- and middle-income countries (LMIC), the trend-line is still supposed to increase slightly [1]. According to the WHO’s assessment, 30–50% of cancer cases could have been prevented [3]. Indeed, the improving tendency in HIC is the result of successful primer prevention, early detection, and advanced therapies [1]. However, cancer is still, globally, the second leading cause of death (with approximately 9.6 million deaths in 2018) [4] and is also the greatest disease burden.
Therefore, novel chemopreventive strategies are warranted to enhance anticarcinogen mechanisms [5,6,7,8,9,10]. In vitro studies and in vivo animal experiments suggest antimutagenic and anticarcinogenic effects of flavonoids [11,12,13]. Moreover, flavonoids are consumed widely, and a negative correlation was found between the total flavonoid intake and the incidence of lung cancer formation among smokers [11].
Among flavonoids, green tea catechin (GTC), polyphenols [14], myricetin (3,5,7,3′,4′,5′-hexahydroxyflavone) [15], and stilbene resveratrol (3,5,4′-trihydroxystilbene), as well as its precursor, the piceid (3,5,4′-trihydroxystilbene-3-O-‚-D-glucopyranoside) [12], are promising compounds. The anticancer properties of these compounds have been proven by numerous in vitro and in vivo experiments, as well as clinical and epidemiological studies [9,13,16]. In addition, the main components of coffee (Coffea arabica), such as caffeine, chlorogenic acids, hydroxycinnamic acids, melanoidins, etc., also exert tumor-suppressive effects [16,17]. However, during the Maillard reactions when coffee is roasted (besides the melanoidins), acrylamide and furan are produced in traces [17,18], which are second-class carcinogens [17].
Grapes (Vitis vinifera) are abundant in stilbene phytoalexin molecules, such as resveratrol and piceid, among other polyphenols, namely anthocyanins, flavanols, flavonols, etc. [12,19]. Although resveratrol’s bioavailability is poor, it provided promising anticarcinogen results in preclinical in vitro and in vivo animal tests [20]. Still in a clinical phase I pilot study, the cancer-preventative effects of resveratrol and freeze-dried grape powder were confirmed, as they significantly inhibited (n = 8, p < 0.03) the expression of the WNT oncogene in the colonic mucosa [21]. Catechins of green tea (Camellia sinensis) are among the main anticarcinogenic chemopreventive agents [14], especially the most potent epigallocatechin-3-gallate (EGCG) [14,22,23]. A meta-analysis highlighted that daily consumption of green tea decreased the risk of liver cancers [22] in Asian women (with 5+ cups consumed daily) in a significant manner [23]. Chinese bayberry (Myrica rubra) contains a high amount of myricetin (3,5,7,3′,4′,5′-hexahydroxyflavone), that can be extracted [24]. Based on nutrition surveys, the myricetin intake decreased the relative risk (RR) of prostate cancer between the highest and lowest quartiles of myricetin-consuming men (RR = 0.43 (95% CI: 0.22, 0.86: p for trend = 0.002)) [15]. According to the case-controlled study by Ferruci et al., the regularly high intake of tea combined with coffee reduced the risk of basal cell carcinoma (BCC), compared to proper random control persons (OR = 0.57, 95% CI = 0.34–0.95, p = 0.037) [25].
Further in vivo tests are required, with the purpose of possessing knowledge about the chemopreventive agent’s possible additional health-promoting effects in order to develop novel chemopreventive strategies. To perform an in vivo test, the 7,12-dimethylbenz[a]anthracene (DMBA) carcinogen model was utilized [26]. DMBA is a complete, pluripotent carcinogen aromatic hydrocarbon molecule [27], which forms DNA adducts and generates reactive oxygen species (ROS) [28,29], inducing carcinogenesis [30]. Therefore, DMBA causes, in codon 61 of the RAS oncogenes CAA→CTA, transversion mutations [31]. Moreover, DMBA alters the expression patterns of onco- and tumorsuppressor genes in the following manner: DMBA increases the expression levels of oncogenes, which consequently (in most cases) increases the expression of protective tumorsuppressor genes [26,32,33,34,35]. Moreover, in vivo experimental data has established some relevant miRNAs (miRs), such as miR-134, miR-132, miR-124-1, and miR-9-3, whose expressions are increased in response to DMBA exposure [36,37,38,39,40]. MiRs are noncoding, single-stranded RNA molecules transcribed from DNA. After maturation, their length is 19–25 nucleotides and they are transported to target cells by the following carriers: apoptosis bodies, exosomes, membrane-derived vesicles, high-density lipoproteins (HDL), and ribonucleoprotein complexes [41]. MiRNAs bind to their target mRNA complementary sequences in the 3′-untranslated region (3′-UTR) of a protein-coding gene, leading to a decrease in protein synthesis [42]. In chemical carcinogen-induced tumorigenesis, dysregulated patterns of miRNAs play crucial roles [41]. For example, DMBA exposure increases the expression of the oncogene RAS family [35], while miRs play an important role in (RAS-involved) mitogen-activated protein kinase (MAPK) pathways, inducing carcinogenesis [43].
Thus, the mentioned molecular epidemiological biomarkers indicate DMBA exposure early and in a reliable manner [26,32,33,35,39,40]. Furthermore, we also examined the gene expression level of the mammalian target of rapamycin (mTOR), which is involved in several cellular homeostasis mechanisms [36,38]. More specifically, the liver, kidneys, and spleen parenchymal organs were studied because the DMBA treatment caused a significantly increased expression on relevant miR-134, miR-132, miR-124-1, miR-9-3, and mTOR in those organs for at least 24 h, based upon earlier research data [36,37,38]. Moreover, in earlier studies, the examined chemopreventive polyphenol extract, green tea extract, Chinese bayberry extract, and coffee extract ameliorated the DMBA, caused repetitive long interspersed element-1 (LINE-1) DNA hypomethylation [9].
In this study, the preventive effects of several polyphenols, namely the green tea extract (catechin content of 80%), Chinese bayberry extract (myricetin content of 80%), polyphenol extract (with 4 g/100 mL added to resveratrol), and coffee extract were examined in a DMBA-treated mouse model to elucidate the effects of chemopreventive agents on the expression profile of the mentioned miRs and mTOR, in order to decide if their elevation caused by DMBA exposure can be mitigated or not.

2. Materials and Methods

2.1. Animal Treatment

The experimental setting in our study was similar to that described by Szabo et al. 2021 [9]. We utilized six groups of female CBA/Ca mice (n = 6) aged 12 weeks. Pre-feeding was not given to the untreated and DMBA-treated control groups; however, one group received 4 mg/day of the animal green tea (Camellia sinensis) excerpt (Xi’an Longze Biotechnology Co. Ltd., Xi’an, China); one group received 2.5 mg/day of the animal Chinese bayberry (Myrica Rubra) supplement (Xi’an Longze Biotechnology Co. Ltd., Xi’an, China); one group received 30 mg/day of the animal polyphenol extract (common grapevine (Vitis vinifera ‘Cabernet Sauvignon’) seed and peel, blackberry ‘thorn free’ (Rubus fruticosus ‘Thornfree’) seed and peel, and blackcurrants, plus an additional 4 g/100 mL of resveratrol, in particular, FruitCafeTM (Slimbios Ltd., Budapest, Hungary); and one group received a coffee (Coffea arabica) extract for two weeks (30 mg/day/animal, up to 150 mL) in addition to their regular feed. All other five classes of animals received 20 mg/bwkg DMBA intraperitoneally (Sigma-Aldrich, St. Louis, MO, USA), dissolved in 0.1 mL of corn oil, with the exception of the untreated control group. Animals were put to death by cervical dislocation after 24 h of DMBA exposure, and their kidneys, liver, and spleen were extracted. Table 1 summarizes the specifics of the experimental setup, as well as the substances used.
Tomesz et al.’s 2020 publication [36] utilized the same experimental procedure. Animal experimentation standards and criteria were followed when housing mice. All the measures have been taken to avoid unnecessary pain. The experiment was carried out in accordance with current ethical rules (the Animal Welfare Committee of the University of Pécs issued the ethical license no. BA02/2000-79/2017).

2.2. Collective Isolation of RNA

A TRIZOL reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used to isolate total cellular RNA, according to the manufacturer’s guidelines. The quality of the RNA was determined using NanoDrop absorption photometry, and only RNA fractions with A > 2.0 at 260/280 nm were utilized in the RT-PCR (reverse transcription polymerase chain reaction) procedure.

2.3. Polymerase Chain Reaction in Reverse Transcription (RT-PCR)

On a LightCycler 480 qPCR system (Roche Diagnostics, Indianapolis, IN, USA), one-step PCR, containing a reverse transcription and a target amplification, was done in a 96-well plate using Kapa SYBR FAST One-step qPCR equipment (Kapa Biosystems, Wilmington, MA, USA).
The following temperatures of the program were used:
After a 5-min incubation at 42 °C, a 3-min incubation at 95 °C, 45 cycles (95 °C for 5 s, 56 °C for 15 s, and 72 °C for 5 s) was executed, with a fluorescence reading taken at the finish of each cycle. To improve the specificity of the amplification, a melting curve analysis was done on each run (95 °C for 5 s, 65 °C for 60 s, and 97 °C). The following components were used in the reaction mixture: 10 μL of KAPA SYBR FASTqPCR Master Mix, 0.4 μL of KAPA RT Mix, 0.4 of dUTP, 0.4 μL of primers, and 5 μL of a miR template in a total amount of 20 μL of sterile double-distilled water.
Table 2 summarizes the primer sequences (5′-3′) of the mTORC1 gene, the studied miRs (miR-134, miR-132, miR-124-1, and miR-9-3), and the internal control (the mouse U6 gene). Integrated DNA Technologies (Integrated DNA Technologies Inc., Coralville, Iowa, USA) synthesized the primers, and the sequences were obtained from earlier publications [44,45].

2.4. Calculations and Statistical Analyses

The 2−ΔΔCT approach was used to determine and compare relative miR expression levels. The Kolmogorov–Smirnov test, Levene’s test, and the T-probe were used to compare averages and test distributions and variances throughout the statistical study. For computations and analyses, the IBM SPSS 21 statistical program (International Business Machines Corporation, Armonk, NY, USA) was utilized. The statistical standard of significance was set at p < 0.05.

3. Results

3.1. Effect of Flavonoid Extract and DMBA Treatment in the Liver, Spleen, and Kidneys, Compared to the DMBA Positive Control

In the livers of animals, the consumption of the polyphenol extract significantly reduced the expressions of miR-9-3 (−41%; p < 0.05; SD = 11.1%), miR-124-1 (−68%; p < 0.001; SD = 10.1%), miR-132 (−62.9%; p < 0.001; SD = 9.2%), miR-134 (−77.9%; p < 0.001; SD = 5.6%), and mTORC1 (−49%; p < 0.001; SD = 8.4%) when compared to the positive DMBA control group (Figure 1A). We also observed a significant decrease in the expression of miR-9-3 (−38%; p < 0.05; SD = 12.1%), miR-124-1 (−59%; p < 0.05; SD = 9.8%), miR-132 (−62.4%; p < 0.001; SD = 8%), miR-134 (−60.4%; p < 0.001; SD = 8%), and mTORC1 (−39%; p < 0.001; SD = 8.6%) in the spleens of animals, compared to the positive DMBA control (Figure 1B). In the kidneys of animals, miR-9-3 (−59%; p < 0.001; SD = 7.8%), miR-124-1 (−62%; p < 0.05; SD = 13.1%), miR-134 (−81.4%; p < 0.001; SD = 3.7%), and mTORC1 (−59%; p < 0.001; SD = 6.3%) expressions were significantly lower in response to the polyphenol extract, compared to the positive DMBA control (Figure 1C), while the values for miR-132 (−27.1%; p = 0.051; SD = 13.7%) were not statistically significant.

3.2. Effect of Green Tea Extract and DMBA Treatment in the Liver, Spleen, and Kidneys, Compared to the DMBA Positive Control

The consumption of the green tea extract significantly reduced the expression of miR-9-3 (−33%; p < 0.05; SD = 12.9%), miR-124-1 (−69%; p < 0.001; SD = 7.4%), miR-132 (−45.4%; p < 0.05; SD = 10.2%), miR-134 (−59.2%; p < 0.001; SD = 8.9%), and mTORC1 (−57%; p < 0.001; SD = 6.7%) in the livers of animals, compared to the positive DMBA control (Figure 2A). The green tea extract resulted in a decrease in the expression of miR-9-3 (−56%; p < 0.001; SD = 8.5%), miR-124-1 (−62%; p < 0.001; SD = 11.3%), miR-132 (−61.1%; p < 0.001; SD = 9.1%), miR-134 (−47.6%; p < 0.05; SD = 11.2%), and mTORC1 (−58%; p < 0.001; SD = 5.1%) in the spleens, compared to the positive DMBA control (Figure 2B). In the kidneys, we also observed a significant decrease in the expression of miR-9-3 (−48%; p < 0.05; SD = 11.4%), miR-124-1 (−36%; p < 0.05; SD = 16.6%), miR-132 (−59.6%; p < 0.001; SD = 10.8%), miR-134 (−53.3%; p < 0.001; SD = 11.1%), and mTORC1 (−57%; p < 0.001; SD = 5.6%) in the group consuming the green tea extract, compared to the positive DMBA control (Figure 2C).

3.3. Effect of Chinese Bayberry Extract and DMBA Treatment in the Liver, Spleen, and Kidneys, Compared to the DMBA Positive Control

In the liver, a statistically significant decrease was observed in miR-9-3 (−58%; p < 0.001; SD = 9.1%), miR-124-1 (−43%; p < 0.05; SD = 14.6%), miR-134 (−40.6%; p < 0.05; SD = 16.8%), and mTORC1 (−39%; p < 0.001; SD = 9.6%) in the Chinese bayberry extract group compared to the positive DMBA control, while the decrease in miR-132 (−19.1%; p = 0.14; SD = 14.9%) was not statistically significant (Figure 3A). There were statistically significant downward changes for miR-9-3 (−46%; p < 0.05; SD = 11.1%), miR-124-1 (−57%; p < 0.05; SD = 12.9%), miR-132 (−32.3%; p < 0.05; SD = 15.1%), miR-134 (−51.8%; p < 0.001; SD = 10.3%), and mTORC1 (−32%; p < 0.001; SD = 8.6%) in the spleens of the Chinese bayberry extract-consuming group, compared to the positive DMBA control (Figure 3B). In the kidneys, compared to the positive DMBA control, a statistically significant decrease could be observed for miR-9-3 (−40%; p < 0.05; SD = 13.2%), miR-124-1 (−51%; p < 0.05; SD = 14%), miR-132 (−57.9%; p < 0.001; SD = 10.5%), miR-134 (−28.8%; p < 0.05; SD = 12.8%), and mTORC1 (−22%; p < 0.05; SD = 11.9%) in the Chinese bayberry extract group (Figure 3C).

3.4. Effect of Coffee Extract and DMBA Treatment in the Liver, Spleen, and Kidneys, Compared to the DMBA Positive Control

In the livers, we observed a significant decrease in miR-9-3 (−37%; p < 0.05; SD = 19.8%) and mTORC1 (−37%; p < 0.05; SD = 14%) expressions in the group consuming the coffee extract, compared to the positive DMBA control, while the results for miR-124-1 (−21%; p = 0.21; SD = 23.6%), miR-132 (−16.7%; p = 0.24; SD = 19.4%), and miR-134 (−12.7%; p = 0.32; SD = 16.7%) were not statistically significant (Figure 4A). In the spleens, the expression of miR-9-3 (−46%; p < 0.05; SD = 10.7%), miR-134 (−38.9%; p < 0.05; SD = 12.7%), and mTORC1 (−20%; p < 0.05; SD = 8.9%) showed a statistically significant decrease in the coffee extract-consuming group, compared to the positive DMBA control, while the decrease in the expression of miR-124-1 (−15%; p = 0.37; SD = 22.9%) and the slight increase in the expression of miR-132 (13.1%; p = 0.40; SD = 23%) was not statistically significant (Figure 4B). In the kidneys, statistically significant decreases could be observed in miR-9-3 (−31%; p < 0.05; SD = 12.8%), miR-124-1 (−47%; p < 0.05; SD = 13.6%), miR-134 (−31.6%; p < 0.05; SD = 13.5%), and mTORC1 (−22%; p < 0.05; SD = 8.7%) in the coffee extract group, compared to the positive DMBA control, while the slight increase in miR-132 (22.1%; p = 0.18; SD = 25.4%) was not statistically significant (Figure 4C).
Table 3 shows the summary of expression changes caused by feeding in the observed DMBA pretreated organs.

4. Discussion

DMBA induces cellular damage by releasing reactive oxygen species (ROS), which triggers the production of cytokines (such as TNF, IL1, IL6) and transcription factors (such as NF-kB) [29,38,46], as well as lowering the protective glutathione (GSH) level [29,38,46,47]. These consequences result in redundantly activated inflammatory and proliferative secondary signal transduction pathways that are self-induced.
According to in vitro studies, resveratrol, EGCG, and myricetin inhibit CYP 1A1 and 1A2 enzymes [48,49,50], which activate DMBA [35]. If the DMBA activation is hindered, then the consequent HA-RAS and C-MYC oncogene overexpression is also blocked [32].
Polyphenol structures are generally ROS-scavenging antioxidants that also exert anti-inflammatory effects [51,52]. Thus, molecular features of flavonoids [53], chlorogenic acids, hydroxycinnamic acids, and the caffeine content of coffee [54] and melanoidins [17] exert antioxidant (ROS-quenching) effects, directly mitigating the ROS-induced cellular damage [55,56,57,58]. Moreover, resveratrol [59], myricetin [53,58], GTC [60], and chlorogenic acid [61] induce the protective superoxide-dismutase (SOD) and glutathione-S-transferase (GST) enzymes. Furthermore, both resveratrol, as well as chlorogenic acids, decrease IL-1β, IL-6, and TNF-α expressions [62,63] among others. Flavonoids thereby regulate the carcinogen and/or inflammatory effect-activated signal transduction pathways; for example, they inhibit protein tyrosine and focal adhesion kinases, as well as matrix metalloproteinases (MMPs) [57,64].
Resveratrol [62] and myricetin [65] up-regulate cAMP-response element-binding proteins (CREB) through the activated silent Information Regulator T1 (SIRT1)-dependent pathway [66,67] resulting in a decrease in miR-134, miR-124, and mTOR expressions [68]. In contrast, the EGCG inhibited SIRT1, and both EGCG and resveratrol inhibited NF-κB activity as well [62,63,69], while NF-κB generally decreases miR-124 [70] and miR-132 [71]. Theoretically, decreased NF-κB1 activity (in a seemingly mutually exclusive mechanism) increases the expression of the anticarcinogen miR-134 [72]. However, NF-κB, TNF-α, and IL-1β increase miR-9 expression, which downregulates NF-κB expression in a negative feedback loop [73].
Moreover, in the coffee consuming group, the chlorogenic acids exert a kidney protective effect by inducing miR-134 [74], which suppresses MMP-9 and MMP-7 [75], ultimately decreasing cyclin D1 [76], which is encoded by CCND1 and is in inverse correlation with miR-134 [74]. In addition, resveratrol [77], EGCG [78], and caffeine [79] induce phosphatase and tensin homolog (PTEN) gene activity, which decreases cyclin D1 cell cycle proteins [80] as well. Still, the stronger negative feedback regulation of miRs [36,37,81,82,83] prevail, ultimately decreasing miR-134 expression [36,38,81].
Resveratrol [13,63] and EGCG [84] inhibit antiapoptotic cascades by suppressing MAPK pathways [84]. This induces cell cycle arrest in the G0/G1 phase, which downregulates miR-132 and upregulates miR-9 [84]. In all examined groups, the presumably decreased cyclin D1 level led to the decrease in mTOR expression [85]. In addition, myricetin blocks phosphoinositide 3-kinase (PI3K) [86], ultimately decreasing mTOR expression [87].
MiR-132 inhibits the RAS p21 protein activator GTPase activating protein 1 (RASA1), which inhibits NRAS expression and HRAS activation [88]; thus, miR-132 ultimately supports the MAPK cascade in this context. Therefore, the silencing of miR-132 expression could mediate the chemopreventive effect of resveratrol and EGCG. However, miR-9 blocks neurofibromin, which inhibits NRAS activation [88]. Thus, the induction of miR-9 seems to contradict the chemopreventive effect of resveratrol and EGCG in this context. The same is true for the pro-inflammatory cytokines’ increased intercellular adhesion molecule-1 (ICAM1) expression [83], which is blocked by resveratrol [89]. Despite that, ICAM1 positively modulates anti-inflammatory miR-124 expression [83], which inhibits MAPK signal transduction [88]. The MAPK signaling pathway upregulates C-MYC, which activates AKT and cyclinD1 [90,91]. Still, CREB downregulates miR-9 strongly in a negative feedback minicircuitry [92], while miR-9 is also negatively correlated with NF-κB1 activity [93], which decreases miR-124 [69], corresponding to the results of this study.
Myricetin in liver cells as a pro-oxidant increases hydroxyl radicals (˙OH) if catalase (CAT) and SOD enzymes are blocked [94]. Aromatic hydrocarbons (such as DMBA) produce singlet molecular oxygen [95] that reacts with the histidine group of CAT and SOD, deteriorating these enzymes [96], leading to further increased ˙OH levels, which induces protective miR-132 expression [97] in coherence with the results of this study.
Moreover, in the coffee consuming group, the traces of acrylamide and furan exert antagonistic effects against the examined chemopreventive agents; namely, acrylamide (≤100 μmol/L) in vitro, which significantly increases the proliferation of human HCC HepG2 cells and induces the EGFR/PI3K/AKT/cyclin D1 pathway, leading to decreased PTEN levels [98]. The epigenetic carcinogen furan also alters relevant cell cycles, as well as the apoptosis regulator gene expression in the rat’s liver [99], and forms metabolites, which decreases GSH levels with chemical reactions [100].
The above-mentioned experimental materials and their decay products, substrates, enzymes, proteins, and signal transducer molecules orchestrate the observed expression patterns of miRs and mTORs, as well as influencing the cell proliferation (Figure 5).

5. Conclusions

In all the examined organs in the green tea, myricetin, and flavonoid extract-treated groups, the DMBA elevated expression levels of miR-134, miR-132, miR-124-1, miR-9-3, and mTOR decreased significantly—except for miR-132 in the liver of the Chinese bayberry extract-consuming group, and miR-132 in the kidneys of the flavonoid fed group. However, in the coffee consuming group, only miR-9-3 and mTOR decreased significantly in the liver, miR-134 decreased in the spleen, and additionally, miR-124-1 decreased in the kidneys (Table 3).
These experimental agents possess similar chemopreventive molecular mechanisms, including ROS scavenging, as well as signal transduction modulating effects; namely, both DMBA induced inflammatory and proliferative pathways were inhibited, presumably through deactivating TNF, IL1, IL6, and NF-κB [29,38,46,101]. According to the literature, chemopreventive agents presumably decrease all expressions of the examined miRs and mTOR [68,70,71,93] by induced CREB and decreased NF-κB activities [62,63,65,69]. However, miR-134 was expected to increase with decreased NF-κB activity [72,74] and anti-inflammatory mir-124 should have been positively modulated by ICAM1 [83], contradicting our results.
Individual molecular features were indicated also; for example, the liver-specific pro-oxidant effect of myricetin increased only in the liverthe ROS sensitive miR-132 expression, in comparison with other studied organs [97]. In the coffee consuming group, the effects of beneficial flavonoids, chlorogenic acids, and melanoidins [17] were most likely partly antagonized by the carcinogen acrylamide and furan content of coffee [98,99].
Moreover, the results could be deceptive, since in the late stages, malignant tumors mostly also downregulated anticarcinogen miRs, for example, miR-134 in invasive and metastatic HCC and RCC [102], or both miR-124 and miR-134 in glioblastoma, and miR-124 in squamous cell carcinoma [88]. However, miR-9 is upregulated in glioma [88]. Therefore, we can suppose that expression levels of mTOR and miRs are biomarkers, rather than relevant signal transductors, in this context [103].
In summary, the novel finding of this study is that the expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTOR, as molecular epidemiological biomarkers, indicated the early carcinogen effect of DMBA and the anticarcinogen effects of the polyphenol extract, green tea extract, Chinese bayberry extract, and coffee extract, which are chemopreventive agents against DMBA exposure, in accordance with the specific molecular features of the contained compounds. Our results contribute to the research of chemoprevention by assuming that the regular consumption of a diet abundant in polyphenols, as well as coffee, exerts anti-inflammatory and anti-cancer effects. These assumptions may form further investigations to improve our eating habits.

Author Contributions

Conceptualization, R.M., L.S., A.T. and I.K.; Data curation, R.M., L.S., T.V., Z.O. and I.K.; Investigation, R.M., L.S., A.T., A.D., R.D. and N.G.; Supervision, R.M., F.B. and I.K.; Visualization, R.M.; Writing—original draft, R.M. and I.K.; Writing—review & editing, R.M., B.L.R., T.V., B.N., Z.O., E.P., J.L.S., F.B. and I.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The experiment was approved by Regional Animal Ethical Committee Pécs and conducted according to the current ethical regulations. (Ethical permission no.: BA02/2000-79/2017).

Acknowledgments

This research was supported by the European Union’s Horizon 2020 OPEN FET RIA (NEURAM, No. 712821). The authors would like to emphasize their heartfelt gratitude to Péter Lajosházi for his invaluable technical assistance.

Conflicts of Interest

The note that they have no conflict of interest.

References

  1. Torre, L.A.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global Cancer Incidence and Mortality Rates and Trends—An Update. Cancer Epidemiol. Biomark. Prev. 2016, 25, 16–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Hashim, D.; Boffetta, P.; La Vecchia, C.; Rota, M.; Bertuccio, P.; Malvezzi, M.; Negri, E. The global decrease in cancer mortality: Trends and disparities. Ann. Oncol. 2016, 27, 926–933. [Google Scholar] [CrossRef] [PubMed]
  3. Danaei, G.; Vander Hoorn, S.; Lopez, A.D.; Murray, C.J.; Ezzati, M.; Comparative Risk Assessment Collaborating Group (Cancers). Causes of cancer in the world: Comparative risk assessment of nine behavioural and environmental risk factors. Lancet 2005, 366, 1784–1793. [Google Scholar] [CrossRef] [Green Version]
  4. Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424, Erratum in CA Cancer J. Clin. 2020, 70, 313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
  6. Budán, F.; Szabó, I.; Varjas, T.; Nowrasteh, G.; Dávid, T.; Gergely, P.; Varga, Z.; Molnár, K.; Kádár, B.; Orsós, Z.; et al. Mixtures of Uncaria and Tabebuia extracts are potentially chemopreventive in CBA/Ca mice: A long-term experiment. Phytother. Res. 2011, 25, 493–500. [Google Scholar] [CrossRef]
  7. Varjas, T.; Nowrasteh, G.; Budán, F.; Nadasi, E.; Horváth, G.; Makai, S.; Gracza, T.; Cseh, J.; Ember, I. Chemopreventive effect of Panax ginseng. Phytother. Res. 2009, 23, 1399–1403. [Google Scholar] [CrossRef]
  8. Varjas, T.; Nowrasteh, G.; Budán, F.; Horváth, G.; Cseh, J.; Gyöngyi, Z.; Makai, S.; Ember, I. The effect of fenugreek on the gene expression of arachidonic acid metabolizing enzymes. Phytother. Res. 2011, 25, 221–227. [Google Scholar] [CrossRef]
  9. Szabo, L.; Molnar, R.; Tomesz, A.; Deutsch, A.; Darago, R.; Nowrasteh, G.; Varjas, T.; Nemeth, B.; Budan, F.; Kiss, I. The effects of flavonoids, green tea polyphenols and coffee on DMBA induced LINE-1 DNA hypomethylation. PLoS ONE 2021, 16, e0250157. [Google Scholar] [CrossRef]
  10. Szabo, L.; Molnar, R.; Tomesz, A.; Deutsch, A.; Darago, R.; Varjas, T.; Ritter, Z.; Szentpeteri, J.L.; Andreidesz, K.; Mathe, D.; et al. Olive Oil Improves While Trans Fatty Acids Further Aggravate the Hypomethylation of LINE-1 Retrotransposon DNA in an Environmental Carcinogen Model. Nutrients 2022, 14, 908. [Google Scholar] [CrossRef]
  11. Cui, Y.; Morgenstern, H.; Greenland, S.; Tashkin, D.P.; Mao, J.T.; Cai, L.; Cozen, W.; Mack, T.M.; Lu, Q.Y.; Zhang, Z.F. Dietary flavonoid intake and lung cancer—A population-based case-control study. Cancer 2008, 112, 2241–2248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Aggarwal, B.B.; Bhardwaj, A.; Aggarwal, R.S.; Seeram, N.P.; Shishodia, S.; Takada, Y. Role of resveratrol in prevention and therapy of cancer: Preclinical and clinical studies. Anticancer Res. 2004, 24, 2783–2840. [Google Scholar] [PubMed]
  13. Narayanan, B.A. Chemopreventive agents alters global gene expression pattern: Predicting their mode of action and targets. Curr. Cancer Drug Targets 2006, 6, 711–727. [Google Scholar] [CrossRef] [PubMed]
  14. Landis-Piwowar, K.R.; Huo, C.; Chen, D.; Milacic, V.; Shi, G.; Chan, T.H.; Dou, Q.P. A novel prodrug of the green tea polyphenol (-)-epigallocatechin-3-gallate as a potential anticancer agent. Cancer Res. 2007, 67, 4303–4310. [Google Scholar] [CrossRef] [Green Version]
  15. Knekt, P.; Kumpulainen, J.; Järvinen, R.; Rissanen, H.; Heliövaara, M.; Reunanen, A.; Hakulinen, T.; Aromaa, A. Flavonoid intake and risk of chronic diseases. Am. J. Clin. Nutr. 2002, 76, 560–568. [Google Scholar] [CrossRef] [Green Version]
  16. Gaascht, F.; Dicato, M.; Diederich, M. Coffee provides a natural multitarget pharmacopeia against the hallmarks of cancer. Genes Nutr. 2015, 10, 51. [Google Scholar] [CrossRef]
  17. Hu, G.L.; Wang, X.; Zhang, L.; Qiu, M.H. The sources and mechanisms of bioactive ingredients in coffee. Food Funct. 2019, 10, 3113–3126. [Google Scholar] [CrossRef]
  18. Blank, I. Current status of acrylamide research in food: Measurement, safety assessment, and formation. Ann. N. Y. Acad. Sci. 2005, 1043, 30–40. [Google Scholar] [CrossRef]
  19. Xia, E.Q.; Deng, G.F.; Guo, Y.J.; Li, H.B. Biological activities of polyphenols from grapes. Int. J. Mol. Sci. 2010, 11, 622–646. [Google Scholar] [CrossRef]
  20. Smoliga, J.M.; Baur, J.A.; Hausenblas, H.A. Resveratrol and health—A comprehensive review of human clinical trials. Mol. Nutr. Food Res. 2011, 55, 1129–1141. [Google Scholar] [CrossRef]
  21. Nguyen, A.V.; Martinez, M.; Stamos, M.J.; Moyer, M.P.; Planutis, K.; Hope, C.; Holcombe, R.F. Results of a phase I pilot clinical trial examining the effect of plant-derived resveratrol and grape powder on Wnt pathway target gene expression in colonic mucosa and colon cancer. Cancer Manag. Res. 2009, 1, 25–37. [Google Scholar] [PubMed]
  22. Huang, Y.Q.; Lu, X.; Min, H.; Wu, Q.Q.; Shi, X.T.; Bian, K.Q.; Zou, X.P. Green tea and liver cancer risk: A meta-analysis of prospective cohort studies in Asian populations. Nutrition 2016, 32, 3–8. [Google Scholar] [CrossRef] [PubMed]
  23. Iso, H.; Kubota, Y.; Japan Collaborative Cohort Study for Evaluation of Cancer. Nutrition and disease in the Japan Collaborative Cohort Study for Evaluation of Cancer (JACC). Asian Pac. J. Cancer Prev. 2007, 8, 35–80. [Google Scholar]
  24. Xing, M.; Cao, Y.; Ren, C.; Liu, Y.; Li, J.; Grierson, D.; Martin, C.; Sun, C.; Chen, K.; Xu, C.; et al. Elucidation of myricetin biosynthesis in Morella rubra of the Myricaceae. Plant J. 2021, 108, 411–425. [Google Scholar] [CrossRef] [PubMed]
  25. Ferrucci, L.M.; Cartmel, B.; Molinaro, A.M.; Leffell, D.J.; Bale, A.E.; Mayne, S.T. Tea, coffee, and caffeine and early-onset basal cell carcinoma in a case-control study. Eur. J. Cancer Prev. 2014, 23, 296–302. [Google Scholar] [CrossRef] [Green Version]
  26. Ember, I.; Kiss, I.; Pusztai, Z. Effect of 7,12-dimethylbenz(a)anthracene on onco/suppressor gene action in vivo: A short-term experiment. Anticancer Res. 1998, 18, 445–447. [Google Scholar] [PubMed]
  27. Stowers, S.J.; Anderson, M.W. Formation and persistence of benzo(a)pyrene metabolite-DNA adducts. Environ. Health Perspect. 1985, 62, 31–39. [Google Scholar] [CrossRef]
  28. Fuller-Espie, S.L.; Bearoff, F.M.; Minutillo, M.A. Exposure of coelomocytes from the earthworm Eisenia hortensis to Cu, Cd, and dimethylbenz[a]anthracene: An in vitro study examining reactive oxygen species production and immune response inhibition. Pedobiologia 2011, 54, S31–S36. [Google Scholar] [CrossRef]
  29. Storz, P. Reactive oxygen species in tumor progression. Front. Biosci. 2005, 10, 1881–1896. [Google Scholar] [CrossRef] [Green Version]
  30. Dreher, D.; Junod, A.F. Role of oxygen free radicals in cancer development. Eur. J. Cancer 1996, 32A, 30–38. [Google Scholar] [CrossRef]
  31. El-Sohemy, A.; Archer, M.C. Inhibition of N-methyl-N-nitrosourea- and 7,12-dimethylbenz[a] anthracene-induced rat mammary tumorigenesis by dietary cholesterol is independent of Ha-Ras mutations. Carcinogenesis 2000, 21, 827–831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Perjési, P.; Bayer, Z.; Ember, I. Effect of E-2-(4′-methoxybenzylidene)-1-benzosuberone on the 7,12-dimethylbenz[alpha]anthracene-induced onco/suppressor gene action in vivo. I: A 24-hour experiment. Anticancer Res. 2000, 20, 475–481. [Google Scholar] [PubMed]
  33. Monostory, K.; Tamási, V.; Vereczkey, L.; Perjési, P. A study on CYP1A inhibitory action of E-2-(4′-methoxybenzylidene)-1-benzosuberone and some related chalcones and cyclic chalcone analogues. Toxicology 2003, 184, 203–210. [Google Scholar] [CrossRef]
  34. Budán, F.; Varjas, T.; Nowrasteh, G.; Varga, Z.; Boncz, I.; Cseh, J.; Prantner, I.; Antal, T.; Pázsit, E.; Gobel, G.; et al. Early modification of c-myc, Ha-ras and p53 expressions by N-methyl-N-nitrosourea. In Vivo 2008, 22, 793–797. [Google Scholar]
  35. Budán, F.; Varjas, T.; Nowrasteh, G.; Prantner, I.; Varga, Z.; Ember, A.; Cseh, J.; Gombos, K.; Pázsit, E.; Gobel, G.; et al. Early modification of c-myc, Ha-ras and p53 expressions by chemical carcinogens (DMBA, MNU). In Vivo 2009, 23, 591–598. [Google Scholar] [PubMed]
  36. Tomesz, A.; Szabo, L.; Molnar, R.; Deutsch, A.; Darago, R.; Mathe, D.; Budan, F.; Ghodratollah, N.; Varjas, T.; Nemeth, B.; et al. Effect of 7,12-Dimethylbenz(α)anthracene on the Expression of miR-330, miR-29a, miR-9-1, miR-9-3 and the mTORC1 Gene in CBA/Ca Mice. In Vivo 2020, 34, 2337–2343. [Google Scholar] [CrossRef] [PubMed]
  37. Tomesz, A.; Szabo, L.; Molnar, R.; Deutsch, A.; Darago, R.; Raposa, L.B.; Ghodratollah, N.; Varjas, T.; Nemeth, B.; Orsos, Z.; et al. Changes in miR-124-1, miR-212, miR-132, miR-134, and miR-155 Expression Patterns after 7,12-Dimethylbenz(a)anthracene Treatment in CBA/Ca Mice. Cells 2022, 11, 1020. [Google Scholar] [CrossRef]
  38. Molnar, R.; Szabo, L.; Tomesz, A.; Deutsch, A.; Darago, R.; Ghodratollah, N.; Varjas, T.; Nemeth, B.; Budan, F.; Kiss, I. In vivo effects of olive oil and trans-fatty acids on miR-134, miR-132, miR-124-1, miR-9-3 and mTORC1 gene expression in a DMBA-treated mouse model. PLoS ONE 2021, 16, e0246022. [Google Scholar] [CrossRef]
  39. Vannini, I.; Fanini, F.; Fabbri, M. MicroRNAs as lung cancer biomarkers and key players in lung carcinogenesis. Clin. Biochem. 2013, 46, 918–925, Erratum in Clin. Biochem. 2019, 63, 162Erratum in Clin. Biochem. 2019, 68, 58. [Google Scholar] [CrossRef]
  40. Luk, J.M.; Burchard, J.; Zhang, C.; Liu, A.M.; Wong, K.F.; Shek, F.H.; Lee, N.P.; Fan, S.T.; Poon, R.T.; Ivanovska, I.; et al. DLK1-DIO3 genomic imprinted microRNA cluster at 14q32.2 defines a stemlike subtype of hepatocellular carcinoma associated with poor survival. J. Biol. Chem. 2011, 286, 30706–30713. [Google Scholar] [CrossRef] [Green Version]
  41. Li, M.; Huo, X.; Davuljigari, C.B.; Dai, Q.; Xu, X. MicroRNAs and their role in environmental chemical carcinogenesis. Environ. Geochem. Health 2019, 41, 225–247. [Google Scholar] [CrossRef] [PubMed]
  42. Oliveto, S.; Mancino, M.; Manfrini, N.; Biffo, S. Role of microRNAs in translation regulation and cancer. World J. Biol. Chem. 2017, 8, 45–56. [Google Scholar] [CrossRef] [PubMed]
  43. Shi, L.; Middleton, J.; Jeon, Y.J.; Magee, P.; Veneziano, D.; Laganà, A.; Leong, H.S.; Sahoo, S.; Fassan, M.; Booton, R.; et al. KRAS induces lung tumorigenesis through microRNAs modulation. Cell Death Dis. 2018, 9, 219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Shor, B.; Cavender, D.; Harris, C. A kinase-dead knock-in mutation in mTOR leads to early embryonic lethality and is dispensable for the immune system in heterozygous mice. BMC Immunol. 2009, 10, 28. [Google Scholar] [CrossRef] [Green Version]
  45. Uchida, S.; Hara, K.; Kobayashi, A.; Funato, H.; Hobara, T.; Otsuki, K.; Yamagata, H.; McEwen, B.S.; Watanabe, Y. Early life stress enhances behavioral vulnerability to stress through the activation of REST4-mediated gene transcription in the medial prefrontal cortex of rodents. J. Neurosci. 2010, 30, 15007–15018. [Google Scholar] [CrossRef]
  46. Reuter, S.; Gupta, S.C.; Chaturvedi, M.M.; Aggarwal, B.B. Oxidative stress, inflammation, and cancer: How are they linked? Free Radic. Biol. Med. 2010, 49, 1603–1616. [Google Scholar] [CrossRef] [Green Version]
  47. Lu, S.C. Regulation of glutathione synthesis. Mol. Asp. Med. 2009, 30, 42–59. [Google Scholar] [CrossRef] [Green Version]
  48. Ciolino, H.P.; Daschner, P.J.; Yeh, G.C. Resveratrol inhibits transcription of CYP1A1 in vitro by preventing activation of the aryl hydrocarbon receptor. Cancer Res. 1998, 58, 5707–5712. [Google Scholar]
  49. Satoh, T.; Fujisawa, H.; Nakamura, A.; Takahashi, N.; Watanabe, K. Inhibitory Effects of Eight Green Tea Catechins on Cytochrome P450 1A2, 2C9, 2D6, and 3A4 Activities. J. Pharm. Pharm. Sci. 2016, 19, 188–197. [Google Scholar] [CrossRef] [Green Version]
  50. Santes-Palacios, R.; Marroquín-Pérez, A.L.; Hernández-Ojeda, S.L.; Camacho-Carranza, R.; Govezensky, T.; Espinosa-Aguirre, J.J. Human CYP1A1 inhibition by flavonoids. Toxicol. In Vitro 2020, 62, 104681. [Google Scholar] [CrossRef]
  51. Lieke, T.; Steinberg, C.E.W.; Pan, B.; Perminova, I.V.; Meinelt, T.; Knopf, K.; Kloas, W. Phenol-rich fulvic acid as a water additive enhances growth, reduces stress, and stimulates the immune system of fish in aquaculture. Sci. Rep. 2021, 11, 174. [Google Scholar] [CrossRef]
  52. Hajdrik, P.; Pályi, B.; Kis, Z.; Kovács, N.; Veres, D.S.; Szigeti, K.; Budán, F.; Hegedüs, I.; Kovács, T.; Bergmann, R.; et al. In Vitro Determination of Inhibitory Effects of Humic Substances Complexing Zn and Se on SARS-CoV-2 Virus Replication. Foods 2022, 11, 694. [Google Scholar] [CrossRef] [PubMed]
  53. Ross, J.A.; Kasum, C.M. Dietary flavonoids: Bioavailability, metabolic effects, and safety. Annu. Rev. Nutr. 2002, 22, 19–34. [Google Scholar] [CrossRef]
  54. Capek, P.; Paulovičová, E.; Matulová, M.; Mislovičová, D.; Navarini, L.; Suggi-Liverani, F. Coffea arabica instant coffee—Chemical view and immunomodulating properties. Carbohydr. Polym. 2014, 103, 418–426. [Google Scholar] [CrossRef] [PubMed]
  55. Kandaswami, C.; Middleton, E., Jr. Free radical scavenging and antioxidant activity of plant flavonoids. Adv. Exp. Med. Biol. 1994, 366, 351–376. [Google Scholar] [CrossRef] [PubMed]
  56. Rice-Evans, C.A.; Miller, N.J.; Paganga, G. Structure-antioxidant activity relationships of flavonoids and phenolic acids. Free Radic. Biol. Med. 1996, 20, 933–956, Erratum in Free Radic. Biol. Med. 1996, 21, 417. [Google Scholar] [CrossRef]
  57. Middleton, E., Jr.; Kandaswami, C.; Theoharides, T.C. The effects of plant flavonoids on mammalian cells: Implications for inflammation, heart disease, and cancer. Pharmacol. Rev. 2000, 52, 673–751. [Google Scholar]
  58. Fiander, H.; Schneider, H. Dietary ortho phenols that induce glutathione S-transferase and increase the resistance of cells to hydrogen peroxide are potential cancer chemopreventives that act by two mechanisms: The alleviation of oxidative stress and the detoxification of mutagenic xenobiotics. Cancer Lett. 2000, 156, 117–124. [Google Scholar] [CrossRef]
  59. Gerszon JRodacka, A.; Puchała, M. Antioxidant Properties of Resveratrol and its Protective Effects in Neurodegenerative Diseases. Med. J. Cell Biol. 2014, 4, 97–117. [Google Scholar]
  60. Pastore, R.L.; Fratellone, P. Potential health benefits of green tea (Camellia sinensis): A narrative review. Explore 2006, 2, 531–539. [Google Scholar] [CrossRef]
  61. Liang, N.; Kitts, D.D. Role of Chlorogenic Acids in Controlling Oxidative and Inflammatory Stress Conditions. Nutrients 2015, 8, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Yeung, F.; Hoberg, J.E.; Ramsey, C.S.; Keller, M.D.; Jones, D.R.; Frye, R.A.; Mayo, M.W. Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J. 2004, 23, 2369–2380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Zhang, G.; Liu, Y.; Xu, L.; Sha, C.; Zhang, H.; Xu, W. Resveratrol alleviates lipopolysaccharide-induced inflammation in PC-12 cells and in rat model. BMC Biotechnol. 2019, 19, 10. [Google Scholar] [CrossRef] [PubMed]
  64. Kandaswami, C.; Lee, L.T.; Lee, P.P.; Hwang, J.J.; Ke, F.C.; Huang, Y.T.; Lee, M.T. The antitumor activities of flavonoids. In Vivo 2005, 19, 895–909, Erratum in In Vivo 2007, 21, 553Erratum in In Vivo 2007, 21, 1172. [Google Scholar]
  65. Jung, H.Y.; Lee, D.; Ryu, H.G.; Choi, B.H.; Go, Y.; Lee, N.; Lee, D.; Son, H.G.; Jeon, J.; Kim, S.H.; et al. Myricetin improves endurance capacity and mitochondrial density by activating SIRT1 and PGC-1α. Sci. Rep. 2017, 7, 6237. [Google Scholar] [CrossRef]
  66. Zhao, Y.N.; Li, W.F.; Li, F.; Zhang, Z.; Dai, Y.D.; Xu, A.L.; Qi, C.; Gao, J.M.; Gao, J. Resveratrol improves learning and memory in normally aged mice through microRNA-CREB pathway. Biochem. Biophys. Res. Commun. 2013, 435, 597–602. [Google Scholar] [CrossRef] [Green Version]
  67. Shen, J.; Xu, L.; Qu, C.; Sun, H.; Zhang, J. Resveratrol prevents cognitive deficits induced by chronic unpredictable mild stress: Sirt1/miR-134 signalling pathway regulates CREB/BDNF expression in hippocampus in vivo and in vitro. Behav. Brain Res. 2018, 349, 1–7. [Google Scholar] [CrossRef]
  68. Ghosh, H.S.; McBurney, M.; Robbins, P.D. SIRT1 negatively regulates the mammalian target of rapamycin. PLoS ONE 2010, 5, e9199. [Google Scholar] [CrossRef] [Green Version]
  69. Chung, S.; Yao, H.; Caito, S.; Hwang, J.W.; Arunachalam, G.; Rahman, I. Regulation of SIRT1 in cellular functions: Role of polyphenols. Arch. Biochem. Biophys. 2010, 501, 79–90. [Google Scholar] [CrossRef] [Green Version]
  70. Sun, Y.; Ai, X.; Shen, S.; Lu, S. NF-κB-mediated miR-124 suppresses metastasis of non-small-cell lung cancer by targeting MYO10. Oncotarget 2015, 6, 8244–8254. [Google Scholar] [CrossRef] [Green Version]
  71. De la Rica, L.; García-Gómez, A.; Comet, N.R.; Rodríguez-Ubreva, J.; Ciudad, L.; Vento-Tormo, R.; Company, C.; Álvarez-Errico, D.; García, M.; Gómez-Vaquero, C.; et al. NF-κB-direct activation of microRNAs with repressive effects on monocyte-specific genes is critical for osteoclast differentiation. Genome Biol. 2015, 16, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Shuang, T.; Wang, M.; Zhou, Y.; Shi, C.; Wang, D. NF-κB1, c-Rel, and ELK1 inhibit miR-134 expression leading to TAB1 upregulation in paclitaxel-resistant human ovarian cancer. Oncotarget 2017, 8, 24853–24868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Bazzoni, F.; Rossato, M.; Fabbri, M.; Gaudiosi, D.; Mirolo, M.; Mori, L.; Tamassia, N.; Mantovani, A.; Cassatella, M.A.; Locati, M. Induction and regulatory function of miR-9 in human monocytes and neutrophils exposed to proinflammatory signals. Proc. Natl. Acad. Sci. USA 2009, 106, 5282–5287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Sun, C.C.; Li, S.J.; Li, D.J. Hsa-miR-134 suppresses non-small cell lung cancer (NSCLC) development through down-regulation of CCND1. Oncotarget 2016, 7, 35960–35978. [Google Scholar] [CrossRef] [Green Version]
  75. Merchant, N.; Nagaraju, G.P.; Rajitha, B.; Lammata, S.; Jella, K.K.; Buchwald, Z.S.; Lakka, S.S.; Ali, A.N. Matrix metalloproteinases: Their functional role in lung cancer. Carcinogenesis 2017, 38, 766–780. [Google Scholar] [CrossRef] [Green Version]
  76. Domitrović, R.; Cvijanović, O.; Šušnić, V.; Katalinić, N. Renoprotective mechanisms of chlorogenic acid in cisplatin-induced kidney injury. Toxicology 2014, 324, 98–107. [Google Scholar] [CrossRef]
  77. Shankar, S.; Singh, G.; Srivastava, R.K. Chemoprevention by resveratrol: Molecular mechanisms and therapeutic potential. Front. Biosci. 2007, 12, 4839–4854. [Google Scholar] [CrossRef] [Green Version]
  78. Liu, S.; Wang, X.J.; Liu, Y.; Cui, Y.F. PI3K/AKT/mTOR signaling is involved in (-)-epigallocatechin-3-gallate-induced apoptosis of human pancreatic carcinoma cells. Am. J. Chin. Med. 2013, 41, 629–642. [Google Scholar] [CrossRef]
  79. Miwa, S.; Sugimoto, N.; Shirai, T.; Hayashi, K.; Nishida, H.; Ohnari, I.; Takeuchi, A.; Yachie, A.; Tsuchiya, H. Caffeine activates tumor suppressor PTEN in sarcoma cells. Int. J. Oncol. 2011, 39, 465–472. [Google Scholar] [CrossRef] [Green Version]
  80. Radu, A.; Neubauer, V.; Akagi, T.; Hanafusa, H.; Georgescu, M.M. PTEN induces cell cycle arrest by decreasing the level and nuclear localization of cyclin D1. Mol. Cell. Biol. 2003, 23, 6139–6149. [Google Scholar] [CrossRef] [Green Version]
  81. Szpechcinski, A.; Florczuk, M.; Duk, K.; Zdral, A.; Rudzinski, S.; Bryl, M.; Czyzewicz, G.; Rudzinski, P.; Kupis, W.; Wojda, E.; et al. The expression of circulating miR-504 in plasma is associated with EGFR mutation status in non-small-cell lung carcinoma patients. Cell Mol. Life Sci. 2019, 76, 3641–3656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Cao, J.; Qiu, J.; Wang, X.; Lu, Z.; Wang, D.; Feng, H.; Li, X.; Liu, Q.; Pan, H.; Han, X.; et al. Identification of microRNA-124 in regulation of Hepatocellular carcinoma through BIRC3 and the NF-κB pathway. J. Cancer 2018, 9, 3006–3015. [Google Scholar] [CrossRef]
  83. Gu, W.; Yao, L.; Li, L.; Zhang, J.; Place, A.T.; Minshall, R.D.; Liu, G. ICAM-1 regulates macrophage polarization by suppressing MCP-1 expression via miR-124 upregulation. Oncotarget 2017, 8, 111882–111901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  84. Bhardwaj, V.; Mandal, A.K.A. Next-Generation Sequencing Reveals the Role of Epigallocatechin-3-Gallate in Regulating Putative Novel and Known microRNAs Which Target the MAPK Pathway in Non-Small-Cell Lung Cancer A549 Cells. Molecules 2019, 24, 368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  85. Hall, M.N. mTOR-what does it do? Transpl. Proc. 2008, 40 (Suppl. 10), S5–S8. [Google Scholar] [CrossRef]
  86. Walker, E.H.; Pacold, M.E.; Perisic, O.; Stephens, L.; Hawkins, P.T.; Wymann, M.P.; Williams, R.L. Structural determinants of phosphoinositide 3-kinase inhibition by wortmannin, LY294002, quercetin, myricetin, and staurosporine. Mol. Cell 2000, 6, 909–919. [Google Scholar] [CrossRef]
  87. Chappell, W.H.; Steelman, L.S.; Long, J.M.; Kempf, R.C.; Abrams, S.L.; Franklin, R.A.; Bäsecke, J.; Stivala, F.; Donia, M.; Fagone, P.; et al. Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR inhibitors: Rationale and importance to inhibiting these pathways in human health. Oncotarget 2011, 2, 135–164. [Google Scholar] [CrossRef] [Green Version]
  88. Masliah-Planchon, J.; Garinet, S.; Pasmant, E. RAS-MAPK pathway epigenetic activation in cancer: miRNAs in action. Oncotarget 2016, 7, 38892–38907. [Google Scholar] [CrossRef] [Green Version]
  89. Liu, C.W.; Sung, H.C.; Lin, S.R.; Wu, C.W.; Lee, C.W.; Lee, I.T.; Yang, Y.F.; Yu, I.S.; Lin, S.W.; Chiang, M.H.; et al. Resveratrol attenuates ICAM-1 expression and monocyte adhesiveness to TNF-α-treated endothelial cells: Evidence for an anti-inflammatory cascade mediated by the miR-221/222/AMPK/p38/NF-κB pathway. Sci. Rep. 2017, 7, 44689. [Google Scholar] [CrossRef]
  90. Pathria, G.; Verma, S.; Yin, J.; Scott, D.A.; Ronai, Z.A. MAPK signaling regulates c-MYC for melanoma cell adaptation to asparagine restriction. EMBO Rep. 2021, 22, e51436. [Google Scholar] [CrossRef]
  91. Zhao, Q.; Assimopoulou, A.N.; Klauck, S.M.; Damianakos, H.; Chinou, I.; Kretschmer, N.; Rios, J.L.; Papageorgiou, V.P.; Bauer, R.; Efferth, T. Inhibition of c-MYC with involvement of ERK/JNK/MAPK and AKT pathways as a novel mechanism for shikonin and its derivatives in killing leukemia cells. Oncotarget 2015, 6, 38934–38951. [Google Scholar] [CrossRef] [PubMed]
  92. Tan, X.; Wang, S.; Yang, B.; Zhu, L.; Yin, B.; Chao, T.; Zhao, J.; Yuan, J.; Qiang, B.; Peng, X. The CREB-miR-9 negative feedback minicircuitry coordinates the migration and proliferation of glioma cells. PLoS ONE 2012, 7, e49570. [Google Scholar] [CrossRef] [PubMed]
  93. Aires, V.; Delmas, D.; Djouadi, F.; Bastin, J.; Cherkaoui-Malki, M.; Latruffe, N. Resveratrol-Induced Changes in MicroRNA Expression in Primary Human Fibroblasts Harboring Carnitine-Palmitoyl Transferase-2 Gene Mutation, Leading to Fatty Acid Oxidation Deficiency. Molecules 2017, 23, 7. [Google Scholar] [CrossRef] [Green Version]
  94. Laughton, M.J.; Halliwell, B.; Evans, P.J.; Hoult, J.R. Antioxidant and pro-oxidant actions of the plant phenolics quercetin, gossypol and myricetin. Effects on lipid peroxidation, hydroxyl radical generation and bleomycin-dependent damage to DNA. Biochem. Pharmacol. 1989, 38, 2859–2865. [Google Scholar] [CrossRef]
  95. Stevens, B.; Algar, B.E. Photoperoxidation of unsaturated organic molecules. II. Autoperoxidation of aromatic hydrocarbons. J. Phys. Chem. 1968, 72, 3468–3474. [Google Scholar] [CrossRef]
  96. Ma, X.; Deng, D.; Chen, W. Inhibitors and Activators of SOD, GSH-Px, and CAT. In Enzyme Inhibitors and Activators; Senturk, M., Ed.; IntechOpen: London, UK; Available online: https://www.intechopen.com/books/enzyme-inhibitors-and-activators/inhibitors-and-activators-of-sod-gsh-px-and-cat (accessed on 29 March 2017). [CrossRef] [Green Version]
  97. Zhou, Y.; Li, K.S.; Liu, L.; Li, S.L. MicroRNA 132 promotes oxidative stress induced pyroptosis by targeting sirtuin 1 in myocardial ischaemia reperfusion injury. Int. J. Mol. Med. 2020, 45, 1942–1950. [Google Scholar] [CrossRef]
  98. Xu, Y.; Wang, P.; Xu, C.; Shan, X.; Feng, Q. Acrylamide induces HepG2 cell proliferation through upregulation of miR-21 expression. J. Biomed. Res. 2019, 33, 181–191. [Google Scholar] [CrossRef]
  99. Chen, T.; Mally, A.; Ozden, S.; Chipman, J.K. Low doses of the carcinogen furan alter cell cycle and apoptosis gene expression in rat liver independent of DNA methylation. Environ. Health Perspect. 2010, 118, 1597–1602. [Google Scholar] [CrossRef] [Green Version]
  100. Peterson, L.A. Reactive metabolites in the biotransformation of molecules containing a furan ring. Chem. Res. Toxicol. 2013, 26, 6–25. [Google Scholar] [CrossRef] [Green Version]
  101. Pikarsky, E.; Porat, R.M.; Stein, I.; Abramovitch, R.; Amit, S.; Kasem, S.; Gutkovich-Pyest, E.; Urieli-Shoval, S.; Galun, E.; Ben-Neriah, Y. NF-kappaB functions as a tumour promoter in inflammation-associated cancer. Nature 2004, 431, 461–466. [Google Scholar] [CrossRef]
  102. Pan, J.Y.; Zhang, F.; Sun, C.C.; Li, S.J.; Li, G.; Gong, F.Y.; Bo, T.; He, J.; Hua, R.X.; Hu, W.D.; et al. miR-134: A Human Cancer Suppressor? Mol. Ther. Nucleic Acids 2017, 6, 140–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  103. Park, E.J.; Pezzuto, J.M. The pharmacology of resveratrol in animals and humans. Biochim. Biophys. Acta 2015, 1852, 1071–1113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and polyphenol extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05; *** p < 0.001).
Figure 1. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and polyphenol extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05; *** p < 0.001).
Cells 11 01300 g001aCells 11 01300 g001b
Figure 2. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and green tea extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05; *** p < 0.001).
Figure 2. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and green tea extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05; *** p < 0.001).
Cells 11 01300 g002aCells 11 01300 g002b
Figure 3. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and Chinese bayberry extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05; *** p < 0.001).
Figure 3. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and Chinese bayberry extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05; *** p < 0.001).
Cells 11 01300 g003aCells 11 01300 g003b
Figure 4. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and coffee extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05).
Figure 4. Expression patterns of miR-9-3, miR-124-1, miR-132, miR-134, and mTORC1 in the liver (A), spleen (B), and kidneys (C) of mice treated with DMBA and coffee extract (n = 6), compared to the DMBA-induced (n = 6) expression (* p < 0.05).
Cells 11 01300 g004aCells 11 01300 g004b
Figure 5. Summary of the relevant factors influencing miRs and mTOR expression.
Figure 5. Summary of the relevant factors influencing miRs and mTOR expression.
Cells 11 01300 g005
Table 1. The details of the experimental arrangement and applied compounds.
Table 1. The details of the experimental arrangement and applied compounds.
GroupIp.
DMBA
Daily Dose
(of 1 Animal)
ProducerProduct and
Main Components
Latin/Scientific NamesQuantity
Negative
Control
(n = 6)
-
DMBA
Control
(n = 6)
+
Flavonoid
Extract
+ DMBA
(n = 6)
+30 mgSlimbios Ltd.FruitCafeTM
Common grape vine seed, peelVitis viniferaCabernet Sauvignon20 g/100 mL
Erithritol(2R,3S)-Butane-1,2,3,4-tetrol12 g/100 mL
Resveratroltrans-3,5,4′-Trihydroxystilbenetrans-3,5,4′-trihydroxystilbene4 g/100 mL
Blackberry ‘thornfree’ seed, peelRubus fruticosusthorn-free2 g/100 mL
Blackcurrant seed, peelRibes nigrum2 g/100 mL
Total polyphenol 4000–5000 mg/100 mL
Green Tea
Extract
+ DMBA
(n = 6)
+4 mgXi’an Longze
Biotechnology
Co. Ltd.
Green teaCamellia sinensis
Total polyphenol 98.53%
Total catechins 80.42%
EGCGEpigallocatechin-3-gallate50.45%
Caffeine1,3,7-Trimethylxanthine0.28%
CoffeeExtract
+ DMBA
(n = 6)
+30 mgXi’an Longze
Biotechnology
Co. Ltd.
Coffee arabica
Chlorogenic acid3-Caffeoylquinic acid5.03%
Caffeine1,3,7-Trimethylxanthine1.21%
Chinese Bayberry
Extract
+ DMBA
(n = 6)
+2.5 mgXi’an Longze
Biotechnology
Co. Ltd.
Chinese bayberryMyrica rubra
Myricetin3,5,7,3′,4′,5′-Hexahydroxyflavone80.42%
Table 2. Displays of the mTORC1 gene primer sequences (5′-3′), as well as miR-134, miR-132, miR-124-1, miR-9-3, and the internal control (mouse U6 gene).
Table 2. Displays of the mTORC1 gene primer sequences (5′-3′), as well as miR-134, miR-132, miR-124-1, miR-9-3, and the internal control (mouse U6 gene).
miRForwardReverse
miR-134TGTGACTGGTTGACCAGAGGGTGACTAGGTGGCCCACAG
miR-132ACCGTGGCTTTCGATTGTTACGACCATGGCTGTAGACTGTT
miR-124-1TCTCTCTCCGTGTTCACAGCACCGCGTGCCTTAATTGTAT
miR-9-3GCCCGTTTCTCTCTTTGGTTTCTAGCTTTATGACGGCTCTGTGG
mTORC1AAGGCCTGATGGGATTTGGTGTCAAGTACACGGGGCAAG
mouse U6CGCTTCGGCAGCACATATACTTCACGAATTTGCGTGTCAT
Table 3. Summary table of expression changes caused by feeding in the observed DMBA pretreated organs (* decreasing significantly p < 0.05; *** decreasing significantly p < 0.001; D decrease was not significant; O decrease was questionably; I increase was questionably).
Table 3. Summary table of expression changes caused by feeding in the observed DMBA pretreated organs (* decreasing significantly p < 0.05; *** decreasing significantly p < 0.001; D decrease was not significant; O decrease was questionably; I increase was questionably).
miR-9-3miR-124-1miR-132miR-134mTORC1
Polyphenol extract
Liver*************
Spleen***********
Kidneys****D******
Green tea
Liver***********
Spleen*************
Kidneys***********
Chinese bayberry
Liver****D****
Spleen*********
Kidneys*******
Coffee extract
Liver*OOO*
Spleen*OI**
Kidneys**I**
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Molnar, R.; Szabo, L.; Tomesz, A.; Deutsch, A.; Darago, R.; Raposa, B.L.; Ghodratollah, N.; Varjas, T.; Nemeth, B.; Orsos, Z.; et al. The Chemopreventive Effects of Polyphenols and Coffee, Based upon a DMBA Mouse Model with microRNA and mTOR Gene Expression Biomarkers. Cells 2022, 11, 1300. https://doi.org/10.3390/cells11081300

AMA Style

Molnar R, Szabo L, Tomesz A, Deutsch A, Darago R, Raposa BL, Ghodratollah N, Varjas T, Nemeth B, Orsos Z, et al. The Chemopreventive Effects of Polyphenols and Coffee, Based upon a DMBA Mouse Model with microRNA and mTOR Gene Expression Biomarkers. Cells. 2022; 11(8):1300. https://doi.org/10.3390/cells11081300

Chicago/Turabian Style

Molnar, Richard, Laszlo Szabo, Andras Tomesz, Arpad Deutsch, Richard Darago, Bence L. Raposa, Nowrasteh Ghodratollah, Timea Varjas, Balazs Nemeth, Zsuzsanna Orsos, and et al. 2022. "The Chemopreventive Effects of Polyphenols and Coffee, Based upon a DMBA Mouse Model with microRNA and mTOR Gene Expression Biomarkers" Cells 11, no. 8: 1300. https://doi.org/10.3390/cells11081300

APA Style

Molnar, R., Szabo, L., Tomesz, A., Deutsch, A., Darago, R., Raposa, B. L., Ghodratollah, N., Varjas, T., Nemeth, B., Orsos, Z., Pozsgai, E., Szentpeteri, J. L., Budan, F., & Kiss, I. (2022). The Chemopreventive Effects of Polyphenols and Coffee, Based upon a DMBA Mouse Model with microRNA and mTOR Gene Expression Biomarkers. Cells, 11(8), 1300. https://doi.org/10.3390/cells11081300

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop