Effects of Different Light Wavelengths on Fruit Quality and Gene Expression of Anthocyanin Biosynthesis in Blueberry (Vaccinium corymbosm)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Light Treatments
2.2. Measurement of Fruit Appearance Indexes and Firmness, Soluble Solids and Total Acid
2.3. Determination of Total Phenol and Total Anthocyanin Content
2.4. Determination of Antioxidant System-Related Indexes
2.5. Gene Expression Analysis
2.6. Statistical Analysis
3. Results
3.1. Fruit Appearance Indexes
3.2. Generation Rate of O2·−, H2O2 and MDA Contents
3.3. Antioxidant Capacity
3.4. Flavor Indexes and Bioactive Substances
3.5. Expression Analysis of Genes Related to the Anthocyanins Biosynthesis Pathway
3.6. Correlation and Principal Component Analysis (PCA)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Milivojević, J.; Radivojević, D.; Ruml, M.; Dimitrijević, M.; Maksimović, J.D. Does microclimate under grey hail protection net affect biological and nutritional properties of ‘Duke’ highbush blueberry (Vaccinium corymbosum L.)? Fruits 2016, 71, 161–170. [Google Scholar] [CrossRef]
- Petridis, A.; van der Kaay, J.; Archibald, I.W.; McCallum, S.; Graham, J.; Hancock, R.D. Reflective mulch increases fruit yield of highbush blueberry (Vaccinium corymbosum L. cv. Darrow) grown in a northern maritime environment while maintaining key fruit quality traits. J. Sci. Food Agric. 2021, 101, 3376–3385. [Google Scholar] [CrossRef] [PubMed]
- Sandoval-Ramírez, B.A.; Catalan, U.; Fernandez-Castillejo, S.; Rubio, L.; Macia, A.; Sola, R. Anthocyanin tissue bioavailability in animals: Possible implications for human health. A systematic review. J. Agric. Food Chem. 2018, 66, 11531–11543. [Google Scholar] [CrossRef] [PubMed]
- Martens, S.; Preuß, A.; Matern, U. Multifunctional flavonoid dioxygenases: Flavonol and anthocyanin biosynthesis in Arabidopsis thaliana L. Phytochemistry 2010, 71, 1040–1049. [Google Scholar] [CrossRef]
- Kadomura-Ishikawa, Y.; Miyawaki, K.; Noji, S.; Takahashi, A. Phototropin 2 is involved in blue light-induced anthocyanin accumulation in Fragaria x ananassa fruits. J. Plant Res. 2013, 126, 847–857. [Google Scholar] [CrossRef]
- Samkumar, A.; Jones, D.; Karppinen, K.; Dare, A.P.; Sipari, N.; Espley, R.V.; Martinussen, I.; Jaakola, L. Red and blue light treatments of ripening bilberry fruits reveal differences in signalling through abscisic acid-regulated anthocyanin biosynthesis. Plant Cell Environ. 2021, 44, 3227–3245. [Google Scholar] [CrossRef]
- Song, Y.; Ma, B.; Guo, Q.; Zhou, L.; Zhou, X.; Ming, Z.; You, H.; Zhang, C. MYB pathways that regulate UV-B-induced anthocyanin biosynthesis in blueberry (Vaccinium corymbosum). Front. Plant Sci. 2023, 14, 1125382. [Google Scholar] [CrossRef]
- Zhang, J.; Li, S.; An, H.; Zhang, X.; Zhou, B. Integrated transcriptome and metabolome analysis reveals the anthocyanin biosynthesis mechanisms in blueberry (Vaccinium corymbosum L.) leaves under different light qualities. Front. Plant Sci. 2022, 13, 1073332. [Google Scholar] [CrossRef]
- Ni, J.; Liao, Y.; Zhang, M.; Pan, C.; Yang, Q.; Bai, S.; Teng, Y. Blue Light Simultaneously Induces Peel Anthocyanin Biosynthesis and Flesh Carotenoid/Sucrose Biosynthesis in Mango Fruit. J. Agric. Food Chem. 2022, 70, 16021–16035. [Google Scholar] [CrossRef]
- Li, T.; Yamane, H.; Tao, R. Preharvest long-term exposure to UV-B radiation promotes fruit ripening and modifies stage-specific anthocyanin metabolism in highbush blueberry. Hortic. Res. 2021, 8, 67. [Google Scholar] [CrossRef]
- Wu, Y.; Yang, H.; Yang, H.; Zhang, C.; Lyu, L.; Li, W.; Wu, W. A physiological and metabolomic analysis reveals the effect of shading intensity on blueberry fruit quality. Food Chem. X 2022, 15, 100367. [Google Scholar] [CrossRef]
- Guo, X.; Wang, D.; Shakeel, M. Transcriptome analysis reveals light-induced anthocyanin synthesis candidate genes in rabbiteye blueberry (Vaccinium ashei: Reade). Biotechnol. Biotechnol. Equip. 2021, 35, 747–758. [Google Scholar] [CrossRef]
- Zhang, P.; Lu, S.; Liu, Z.; Zheng, T.; Dong, T.; Jin, H.; Jia, H.; Fang, J. Transcriptomic and metabolomic profiling reveals the effect of LED light quality on fruit ripening and anthocyanin accumulation in cabernet sauvignon grape. Front. Nutr. 2021, 1014, 790697. [Google Scholar] [CrossRef]
- Briggs, W.R.; Olney, M.A. Photoreceptors in plant photomorphogenesis to date. Five phytochromes, two cryptochromes, one phototropin, and one superchrome. Plant Physiol. 2001, 125, 85–88. [Google Scholar] [CrossRef]
- Zoratti, L.; Karppinen, K.; Luengo Escobar, A.; Häggman, H.; Jaakola, L. Light-controlled flavonoid biosynthesis in fruits. Front. Plant Sci. 2014, 5, 534. [Google Scholar] [CrossRef]
- Möglich, A.; Yang, X.; Ayers, R.A.; Moffat, K. Structure and function of plant photoreceptors. Annu. Rev. Plant Biol. 2010, 61, 21–47. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.Y.; Chen, C.-T.; Wang, C.Y. The influence of light and maturity on fruit quality and flavonoid content of red raspberries. Food Chem. 2009, 112, 676–684. [Google Scholar] [CrossRef]
- Chen, Z.; Yu, L.; Liu, W.; Zhang, J.; Wang, N.; Chen, X. Research progress of fruit color development in apple (Malus domestica Borkh.). Plant Physiol. Biochem. 2021, 162, 267–279. [Google Scholar] [CrossRef]
- Ma, Y.; Ma, X.; Gao, X.; Wu, W.; Zhou, B. Light induced regulation pathway of anthocyanin biosynthesis in plants. Int. J. Mol. Sci. 2021, 22, 11116. [Google Scholar] [CrossRef]
- Cox, S.; Stushnoff, C.; Sampson, D. Relationship of fruit color and light exposure to lycopene content and antioxidant properties of tomato. Can. J. Plant Sci. 2003, 83, 913–919. [Google Scholar] [CrossRef]
- Tao, J.; Zhang, S.; An, X.; Zhao, Z. Effects of light on carotenoid biosynthesis and color formation of citrus fruit peel. Ying Yong Sheng Tai Xue Bao J. Appl. Ecol. 2003, 14, 1833–1836. [Google Scholar]
- Feng, F.; Li, M.; Ma, F.; Cheng, L. Phenylpropanoid metabolites and expression of key genes involved in anthocyanin biosynthesis in the shaded peel of apple fruit in response to sun exposure. Plant Physiol. Biochem. 2013, 69, 54–61. [Google Scholar] [CrossRef]
- Lin, K.-H.; Huang, M.-Y.; Huang, W.-D.; Hsu, M.-H.; Yang, Z.-W.; Yang, C.-M. The effects of red, blue, and white light-emitting diodes on the growth, development, and edible quality of hydroponically grown lettuce (Lactuca sativa L. var. capitata). Sci. Hortic. 2013, 150, 86–91. [Google Scholar] [CrossRef]
- Lekkham, P.; Srilaong, V.; Pongprasert, N.; Kondo, S. Anthocyanin concentration and antioxidant activity in light-emitting diode (LED)-treated apples in a greenhouse environmental control system. Fruits 2016, 71, 269–274. [Google Scholar] [CrossRef]
- Huang, J.Y.; Xu, F.; Zhou, W. Effect of LED irradiation on the ripening and nutritional quality of postharvest banana fruit. J. Sci. Food Agric. 2018, 98, 5486–5493. [Google Scholar] [CrossRef]
- Elisia, I.; Hu, C.; Popovich, D.G.; Kitts, D.D. Antioxidant assessment of an anthocyanin-enriched blackberry extract. Food Chem. 2007, 101, 1052–1058. [Google Scholar] [CrossRef]
- Ainsworth, E.A.; Gillespie, K.M. Estimation of total phenolic content and other oxidation substrates in plant tissues using Folin–Ciocalteu reagent. Nat. Protoc. 2007, 2, 875–877. [Google Scholar] [CrossRef] [PubMed]
- Wang, A.-G. Quantitative relation between the reaction of hydroxylamine and superoxi-de anion radicals in plants. Plant Physiol. Commun. 1990, 26, 55–57. [Google Scholar]
- Zeng, P.; Huang, F.; Guo, Z.; Xiao, X.; Peng, C. Physiological responses of Morus alba L. in heavy metal (loid)–contaminated soil and its associated improvement of the microbial diversity. Environ. Sci. Pollut. Res. 2020, 27, 4294–4308. [Google Scholar] [CrossRef]
- Stewart, R.R.; Bewley, J.D. Lipid peroxidation associated with accelerated aging of soybean axes. Plant Physiol. 1980, 65, 245–248. [Google Scholar] [CrossRef]
- Godoy, C.A.; Monterubbianesi, G.; Sanchez, E.; Tognetti, J.A. Cluster illumination differentially affects growth of fruits along their ontogeny in highbush blueberry (Vaccinium corymbosum L.). Sci. Hortic. 2018, 230, 1–10. [Google Scholar] [CrossRef]
- Wang, S.; Jin, N.; Jin, L.; Xiao, X.; Hu, L.; Liu, Z.; Wu, Y.; Xie, Y.; Zhu, W.; Lyu, J. Response of tomato fruit quality depends on period of LED supplementary light. Front. Nutr. 2022, 9, 45. [Google Scholar] [CrossRef]
- Dong, F.; Wang, C.; Sun, X.; Bao, Z.; Dong, C.; Sun, C.; Ren, Y.; Liu, S. Sugar metabolic changes in protein expression associated with different light quality combinations in tomato fruit. Plant Growth Regul. 2019, 88, 267–282. [Google Scholar] [CrossRef]
- Thwe, A.A.; Kasemsap, P.; Vercambre, G.; Gay, F.; Phattaralerphong, J.; Gautier, H. Impact of red and blue nets on physiological and morphological traits, fruit yield and quality of tomato (Solanum lycopersicum Mill.). Sci. Hortic. 2020, 264, 109185. [Google Scholar] [CrossRef]
- Gilbert, J.L.; Guthart, M.J.; Gezan, S.A.; de Carvalho, M.P.; Schwieterman, M.L.; Colquhoun, T.A.; Bartoshuk, L.M.; Sims, C.A.; Clark, D.G.; Olmstead, J.W. Identifying breeding priorities for blueberry flavor using biochemical, sensory, and genotype by environment analyses. PLoS ONE 2015, 10, e0138494. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, J.L.; Olmstead, J.W.; Colquhoun, T.A.; Levin, L.A.; Clark, D.G.; Moskowitz, H.R. Consumer-assisted selection of blueberry fruit quality traits. HortScience 2014, 49, 864–873. [Google Scholar] [CrossRef]
- Kong, D.; Zhao, W.; Ma, Y.; Liang, H.; Zhao, X. Effects of light-emitting diode illumination on the quality of fresh-cut cherry tomatoes during refrigerated storage. Int. J. Food Sci. Technol. 2021, 56, 2041–2052. [Google Scholar] [CrossRef]
- Nadalini, S.; Zucchi, P.; Andreotti, C. Effects of blue and red LED lights on soilless cultivated strawberry growth performances and fruit quality. Eur. J. Hortic. Sci 2017, 82, 12–20. [Google Scholar] [CrossRef]
- Peng, X.; Wang, B.; Wang, X.; Ni, B.; Zuo, Z. Variations in aroma and specific flavor in strawberry under different colored light-quality selective plastic film. Flavour Fragr. J. 2020, 35, 350–359. [Google Scholar] [CrossRef]
- Cope, K.R.; Snowden, M.C.; Bugbee, B. Photobiological interactions of blue light and photosynthetic photon flux: Effects of monochromatic and broad-spectrum light sources. Photochem. Photobiol. 2014, 90, 574–584. [Google Scholar] [CrossRef]
- Lobos, G.A.; Retamales, J.B.; Hancock, J.F.; Flore, J.A.; Cobo, N.; del Pozo, A. Spectral irradiance, gas exchange characteristics and leaf traits of Vaccinium corymbosum L.‘Elliott’grown under photo-selective nets. Environ. Exp. Bot. 2012, 75, 142–149. [Google Scholar] [CrossRef]
- Wu, Y.; Huang, Z.; Zhang, C.; Shi, C.; Lyu, L.; Li, W.; Wu, W. Comparative analysis of the morphological, physiological, proteomic, and metabolic mechanisms of the “Biloxi” blueberry response to shade stress. Front. Plant Sci. 2022, 13, 877789. [Google Scholar] [CrossRef]
- Lanoue, J.; Leonardos, E.D.; Grodzinski, B. Effects of light quality and intensity on diurnal patterns and rates of photo-assimilate translocation and transpiration in tomato leaves. Front. Plant Sci. 2018, 9, 756. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Liu, C.; Shi, Q.; Yang, F.; Wei, M. Mixed red and blue light promotes ripening and improves quality of tomato fruit by influencing melatonin content. Environ. Exp. Bot. 2021, 185, 104407. [Google Scholar] [CrossRef]
- Xu, F.; Shi, L.; Chen, W.; Cao, S.; Su, X.; Yang, Z. Effect of blue light treatment on fruit quality, antioxidant enzymes and radical-scavenging activity in strawberry fruit. Sci. Hortic. 2014, 175, 181–186. [Google Scholar] [CrossRef]
- Matamoros, M.A.; Loscos, J.; Dietz, K.-J.; Aparicio-Tejo, P.M.; Becana, M. Function of antioxidant enzymes and metabolites during maturation of pea fruits. J. Exp. Bot. 2010, 61, 87–97. [Google Scholar] [CrossRef] [PubMed]
- He, R.; Wei, J.; Zhang, J.; Tan, X.; Li, Y.; Gao, M.; Liu, H. Supplemental Blue Light Frequencies Improve Ripening and Nutritional Qualities of Tomato Fruits. Front. Plant Sci. 2022, 13, 888976. [Google Scholar] [CrossRef]
- Zhang, L.; Ma, G.; Yamawaki, K.; Ikoma, Y.; Matsumoto, H.; Yoshioka, T.; Ohta, S.; Kato, M. Regulation of ascorbic acid metabolism by blue LED light irradiation in citrus juice sacs. Plant Sci. 2015, 233, 134–142. [Google Scholar] [CrossRef]
- Li, Y.; Zheng, Y.; Zheng, D.; Zhang, Y.; Song, S.; Su, W.; Liu, H. Effects of supplementary blue and UV-A LED lights on morphology and phytochemicals of Brassicaceae baby-leaves. Molecules 2020, 25, 5678. [Google Scholar] [CrossRef]
- Kokalj, D.; Zlatić, E.; Cigić, B.; Vidrih, R. Postharvest light-emitting diode irradiation of sweet cherries (Prunus avium L.) promotes accumulation of anthocyanins. Postharvest Biol. Technol. 2019, 148, 192–199. [Google Scholar] [CrossRef]
- Zou, L.; Zhong, G.-Y.; Wu, B.; Yang, Y.; Li, S.; Liang, Z. Effects of sunlight on anthocyanin accumulation and associated co-expression gene networks in developing grape berries. Environ. Exp. Bot. 2019, 166, 103811. [Google Scholar] [CrossRef]
- Guo, X.; Shakeel, M.; Wang, D.; Qu, C.; Yang, S.; Ahmad, S.; Song, Z. Metabolome and transcriptome profiling unveil the mechanisms of light-induced anthocyanin synthesis in rabbiteye blueberry (Vaccinium ashei: Reade). BMC Plant Biol. 2022, 22, 223. [Google Scholar] [CrossRef]
- Bian, Z.H.; Yang, Q.C.; Liu, W.K. Effects of light quality on the accumulation of phytochemicals in vegetables produced in controlled environments: A review. J. Sci. Food Agric. 2015, 95, 869–877. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Jiang, L.; Li, Y.; Chen, Q.; Ye, Y.; Zhang, Y.; Luo, Y.; Sun, B.; Wang, X.; Tang, H. Effect of red and blue light on anthocyanin accumulation and differential gene expression in strawberry (Fragaria× ananassa). Molecules 2018, 23, 820. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Singh, B.R. Red light stimulates flowering and anthocyanin biosynthesis in American cranberry. Plant Growth Regul. 2002, 38, 165–171. [Google Scholar] [CrossRef]
- Tao, R.; Bai, S.; Ni, J.; Yang, Q.; Zhao, Y.; Teng, Y. The blue light signal transduction pathway is involved in anthocyanin accumulation in ‘Red Zaosu’ pear. Planta 2018, 248, 37–48. [Google Scholar] [CrossRef]
- Kondo, S.; Tomiyama, H.; Rodyoung, A.; Okawa, K.; Ohara, H.; Sugaya, S.; Terahara, N.; Hirai, N. Abscisic acid metabolism and anthocyanin synthesis in grape skin are affected by light emitting diode (LED) irradiation at night. J. Plant Physiol. 2014, 171, 823–829. [Google Scholar] [CrossRef]
- Zipor, G.; Duarte, P.; Carqueijeiro, I.; Shahar, L.; Ovadia, R.; Teper-Bamnolker, P.; Eshel, D.; Levin, Y.; Doron-Faigenboim, A.; Sottomayor, M. In planta anthocyanin degradation by a vacuolar class III peroxidase in Brunfelsia calycina flowers. New Phytol. 2015, 205, 653–665. [Google Scholar] [CrossRef]
- Dong, B.; Luo, H.; Liu, B.; Li, W.; Ou, S.; Wu, Y.; Zhang, X.; Pang, X.; Zhang, Z. BcXyl, a β-xylosidase Isolated from Brunfelsia Calycina Flowers with Anthocyanin-β-glycosidase Activity. Int. J. Mol. Sci. 2019, 20, 1423. [Google Scholar] [CrossRef] [PubMed]
- Feinbaum, R.L.; Storz, G.; Ausubel, F.M. High intensity and blue light regulated expression of chimeric chalcone synthase genes in transgenic Arabidopsis thaliana plants. Mol. Gen. Genet. MGG 1991, 226, 449–456. [Google Scholar] [CrossRef] [PubMed]
- Batschauer, A.; Rocholl, M.; Kaiser, T.; Nagatani, A.; Furuya, M.; Schäfer, E. Blue and UV-A light-regulated CHS expression in Arabidopsis independent of phytochrome A and phytochrome B. Plant J. 1996, 9, 63–69. [Google Scholar] [CrossRef]
- Noh, B.; Spalding, E.P. Anion channels and the stimulation of anthocyanin accumulation by blue light in Arabidopsis seedlings. Plant Physiol. 1998, 116, 503–509. [Google Scholar] [CrossRef] [PubMed]
- Xie, B.-X.; Wei, J.-J.; Zhang, Y.-T.; Song, S.-W.; Wei, S.; Sun, G.-W.; Hao, Y.-W.; Liu, H.-C. Supplemental blue and red light promote lycopene synthesis in tomato fruits. J. Integr. Agric. 2019, 18, 590–598. [Google Scholar] [CrossRef]
- Ma, L.; Li, J.; Qu, L.; Hager, J.; Chen, Z.; Zhao, H.; Deng, X.W. Light control of Arabidopsis development entails coordinated regulation of genome expression and cellular pathways. Plant Cell 2001, 13, 2589–2607. [Google Scholar] [CrossRef] [PubMed]
- Giliberto, L.; Perrotta, G.; Pallara, P.; Weller, J.L.; Fraser, P.D.; Bramley, P.M.; Fiore, A.; Tavazza, M.; Giuliano, G. Manipulation of the blue light photoreceptor cryptochrome 2 in tomato affects vegetative development, flowering time, and fruit antioxidant content. Plant Physiol. 2005, 137, 199–208. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Gene ID | Primer Sequence (5′ to 3′) |
---|---|---|
VcC4H | VaccDscaff24-augustus-gene-58.38 | F: TTGGTGTCGGTAGGAGGAGTTG |
R: TCAGAACGATGGTAGAGTGCTTCA | ||
Vc4CL | VaccDscaff34-processed-gene-57.9 | F: TTGTGAGGAACGCCGAGATGAA |
R: AATGTAGCCTATGTCGCCAGTGT | ||
VcCHI | VaccDscaff29-processed-gene-189.2 | F: GGCACCACCAATTCCTTCTTCC |
R: TAACGGCGAGCGACTCTACG | ||
VcLDOX | VaccDscaff43-augustus-gene-236.29 | F: CCGTGGAGGAGAAGGAGAAGT |
R: GGTGATTCGCATACTCGCTTGT | ||
VcDFR | VaccDscaff1613-processed-gene-0.0 | F: CATTCAAGGTTGTGCTGGTGTCT |
R: ACGGTTCCTGTGGTTGAAGTGTA | ||
VcUFGT | VaccDscaff1-augustus-gene-318.39 | F: GCTGGAATCCTATGCGGTCAAG |
R: ATCTCCTCCTCCTCCTCCTCATT |
Parameter | Treatment | Days after Treatment/(d) | ||||
---|---|---|---|---|---|---|
0 | 15 | 30 | 45 | 60 | ||
Fruit weight/(g) | W | 0.16 ± 0.03 a | 0.60 ± 0.08 b | 0.61 ± 0.10 bc | 0.86 ± 0.11 b | 2.28 ± 0.25 a |
R | 0.14 ± 0.03 a | 0.63 ± 0.09 ab | 0.56 ± 0.06 c | 0.64 ± 0.08 c | 1.21 ± 0.46 c | |
B | 0.15 ± 0.02 a | 0.57 ± 0.09 b | 0.66 ± 0.08 b | 0.80 ± 0.06 b | 2.31 ± 0.32 a | |
Y | 0.16 ± 0.05 a | 0.68 ± 0.11 a | 0.75 ± 0.14 a | 1.04 ± 0.15 a | 1.77 ± 0.17 b | |
Fruit width/(mm) | W | 6.78 ± 0.53 a | 10.18 ± 0.50 b | 10.84 ± 0.64 bc | 12.35 ± 0.59 b | 16.79 ± 0.76 a |
R | 6.45 ± 0.42 a | 10.06 ± 0.88 b | 10.73 ± 0.41 c | 11.09 ± 0.47 c | 13.32 ± 1.31 c | |
B | 6.64 ± 0.50 a | 10.54 ± 0.81 ab | 11.31 ± 0.53 ab | 11.97 ± 0.43 b | 16.90 ± 0.93 a | |
Y | 6.64 ± 0.44 a | 10.92 ± 0.64 a | 11.83 ± 0.69 a | 13.23 ± 0.75 a | 15.18 ± 0.55 b | |
Fruit height/(mm) | W | 5.58 ± 0.58 a | 8.32 ± 0.75 a | 8.62 ± 0.52 ab | 9.02 ± 0.65 b | 13.72 ± 0.60 a |
R | 5.09 ± 0.40 a | 7.52 ± 0.61 b | 7.89 ± 0.38 c | 8.50 ± 0.28 c | 10.48 ± 1.56 c | |
B | 5.28 ± 0.47 a | 8.30 ± 0.71 a | 8.40 ± 0.44 b | 8.86 ± 0.48 bc | 13.23 ± 0.76 ab | |
Y | 5.28 ± 0.61 a | 8.71 ± 0.77 a | 9.00 ± 0.47 a | 9.67 ± 0.71 a | 12.41 ± 0.61 b | |
Fruit shape index | W | 0.82 ± 0.07 a | 0.82 ± 0.04 a | 0.80 ± 0.05 a | 0.73 ± 0.06 b | 0.82 ± 0.02 a |
R | 0.79 ± 0.04 a | 0.75 ± 0.03 b | 0.74 ± 0.04 b | 0.77 ± 0.03 a | 0.78 ± 0.06 a | |
B | 0.80 ± 0.09 a | 0.79 ± 0.03 ab | 0.74 ± 0.05 b | 0.74 ± 0.04 ab | 0.78 ± 0.04 a | |
Y | 0.80 ± 0.07 a | 0.80 ± 0.05 ab | 0.76 ± 0.04 ab | 0.73 ± 0.03 b | 0.82 ± 0.04 a |
Trait | Component | ||
---|---|---|---|
1 | 2 | 3 | |
SFW | 1.50 ** | 0.13 | −0.40 |
TD | 1.51 ** | 0.15 | −0.37 |
LD | 1.44 ** | 0.43 | −0.58 |
Firmness | 1.18 ** | 0.83 | 0.18 |
O2·− | 1.18 ** | −0.65 | 0.95 |
H2O2 | 1.34 ** | −0.02 | −0.96 |
MDA | 1.10 ** | 0.28 | −1.62 ** |
SOD | −1.13 ** | 0.79 | −0.98 |
POD | −1.52 ** | 0.14 | 0.47 |
AsA | 0.22 | 1.38 ** | 0.57 |
GSH | −0.03 | 1.33 ** | 0.81 |
SS | 1.52 ** | 0.00 | 0.12 |
TA | −1.44 ** | 0.21 | −0.03 |
Anthocyanin | 1.24 ** | −0.63 | 1.07 ** |
TP | 0.93 | 0.44 | 1.81 ** |
Total | 9.05 | 4.78 | 1.04 |
% of variance | 62.56 | 20.65 | 11.34 |
Cumulative % | 62.56 | 83.21 | 94.55 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wei, Z.; Yang, H.; Shi, J.; Duan, Y.; Wu, W.; Lyu, L.; Li, W. Effects of Different Light Wavelengths on Fruit Quality and Gene Expression of Anthocyanin Biosynthesis in Blueberry (Vaccinium corymbosm). Cells 2023, 12, 1225. https://doi.org/10.3390/cells12091225
Wei Z, Yang H, Shi J, Duan Y, Wu W, Lyu L, Li W. Effects of Different Light Wavelengths on Fruit Quality and Gene Expression of Anthocyanin Biosynthesis in Blueberry (Vaccinium corymbosm). Cells. 2023; 12(9):1225. https://doi.org/10.3390/cells12091225
Chicago/Turabian StyleWei, Zhiwen, Haiyan Yang, Jie Shi, Yongkang Duan, Wenlong Wu, Lianfei Lyu, and Weilin Li. 2023. "Effects of Different Light Wavelengths on Fruit Quality and Gene Expression of Anthocyanin Biosynthesis in Blueberry (Vaccinium corymbosm)" Cells 12, no. 9: 1225. https://doi.org/10.3390/cells12091225
APA StyleWei, Z., Yang, H., Shi, J., Duan, Y., Wu, W., Lyu, L., & Li, W. (2023). Effects of Different Light Wavelengths on Fruit Quality and Gene Expression of Anthocyanin Biosynthesis in Blueberry (Vaccinium corymbosm). Cells, 12(9), 1225. https://doi.org/10.3390/cells12091225