Adipose Tissue-Derived Stem Cell Extracellular Vesicles Suppress Glioblastoma Proliferation, Invasiveness and Angiogenesis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures
2.2. Extracellular Vesicle Isolation and Characterization
2.3. Extracellular Vesicle Uptake Assay
2.4. Cell Proliferation Assessment
2.5. GBM Model on Chicken Embryo Chorioallantoic Membrane
2.6. Gene Expression Analysis
2.7. Statistical Analysis
3. Results
3.1. Identification and Characterisation of ASC-Derived EVs
3.2. Tracking of ASC-Derived EVs in GBM Cultures
3.3. Biomicroscopy of GBM Xenografts on CAM
3.4. Histological Examination of CAM
3.5. Gene Expression Changes in GBM Cells after Treatment with ASC-Derived EVs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Target | Sequence |
---|---|
β-Actin | F: AGAGCTACGAGCTGCCTGAC R: AGCACTGTGTTGGCGTACAG |
GAPDH | F: TCAAGATCATCAGCAATGCCT R: CATGAGTCCCACGATACC |
ITGα5 | F: GTGGCCTGCATCAACCTTAGC R: TTCTGGATGAGCAGGGTCTGG |
ITGβ1 | F: GCGTGCAGGTGCAATGAAGG R: ACAAACACACTGTCCGCAGACG |
ITGαV | F: GCGTATCTGCGGGATGAATCTG R: AATGTTAGCAGGCGTGAACTGG |
ITGβ3 | F: TTGGAGACACGGTGAGCTTCAG R: CTGGCAGGCACAGTCACAATC |
VEGFA | F: AGGAGTCCAACATCACCATGCA R: CAAGGCCCACAGGGATTTTCTTG |
KDR | F: CATCGCGAAAGTGTATCCACAGG R: TTCAAAGGGAGGCGAGCATC |
Gene Name | Gene Symbol | MiRNAs Carried by ASC-EVs | TarBase v8 Prediction Score | MiRNAs Carried by ASC-EVs | TarBase v8 Prediction Score |
---|---|---|---|---|---|
Integrin alpha subunit 5 | ITGα5 | hsa-miR-98-5p | 0.616 | hsa-miR-92b-3p | 0.999 |
hsa-miR-130a-3p | 0.777 | hsa-miR-29b-3p | 0.508 | ||
hsa-miR-148a-3p | 0.998 | hsa-miR-29c-3p | 0.53 | ||
hsa-miR-148b-3p | 0.998 | hsa-miR-32-5p | 0.996 | ||
hsa-miR-152-3p | 0.998 | hsa-miR-326 | 0.968 | ||
hsa-miR-181a-2-3p | 0.462 | hsa-miR-330-5p | 0.999 | ||
hsa-miR-22-3p b | 0.704 | hsa-miR-423-5p | 0.853 | ||
hsa-miR-22-5p | 0.828 | hsa-miR-425-5p | 0.667 | ||
hsa-miR-25-3p | 0.992 | hsa-miR-766-3p | 0.473 | ||
hsa-miR-92a-3p | 0.999 | ||||
Integrin alpha subunit V | ITGαV | hsa-let-7a-3p | 0.999 | hsa-miR-30d-5p | 0.519 |
hsa-let-7a-5p | 0.999 | hsa-miR-30e-5p | 0.52 | ||
hsa-let-7b-5p | 0.472 | hsa-miR-32-5p | 0.995 | ||
hsa-let-7c-5p | 0.472 | hsa-miR-320b | 0.464 | ||
hsa-let-7d-5p | 0.547 | hsa-miR-320c | 0.464 | ||
hsa-let-7e-5p | 0.512 | hsa-miR-34a-3p | 0.621 | ||
hsa-let-7f-5p | 0.477 | hsa-miR-361-5p | 0.913 | ||
hsa-let-7g-5p | 0.477 | hsa-miR-374a-5p | 0.823 | ||
hsa-miR-98-5p | 0.477 | hsa-miR-493-3p | 0.586 | ||
hsa-miR-132-3p | 0.682 | hsa-miR-501-3p | 0.459 | ||
hsa-miR-142-5p | 0.997 | hsa-miR-501-5p | 0.459 | ||
hsa-miR-192-3p | 0.829 | hsa-miR-502-3p | 0.455 | ||
hsa-miR-192-5p | 0.613 | hsa-miR-548d-5p | 0.863 | ||
hsa-miR-23a-3p b | 0.503 | hsa-miR-582-3p | 0.717 | ||
hsa-miR-25-3p | 0.989 | hsa-miR-200b-3p | 0.805 | ||
hsa-miR-92a-3p | 0.999 | hsa-miR-200c-3p | 0.798 | ||
hsa-miR-30a-5p | 0.517 | hsa-miR-429 a | 0.798 | ||
hsa-miR-30b-5p | 0.529 | hsa-miR-545-5p a | 0.867 | ||
hsa-miR-30c-5p | 0.528 | ||||
Kinase Insert Domain Receptor | KDR | hsa-miR-16-5p | 0.873 | hsa-miR-23a-3p b | 0.61 |
hsa-miR-21-3p | 0.732 | hsa-miR-200c-3p | 0.999 | ||
Vascular Endothelial Growth Factor A | VEGFA | hsa-miR-15a-5p | 0.848 | hsa-miR-9-5p a | 0.55 |
hsa-miR-205-5p | 0.752 | hsa-miR-23b-3p c | 0.613 |
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer Statistics, 2020. CA. Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Prager, B.C.; Bhargava, S.; Mahadev, V.; Hubert, C.G.; Rich, J.N. Glioblastoma Stem Cells: Driving Resilience through Chaos. Trends Cancer 2020, 6, 223–235. [Google Scholar] [CrossRef] [PubMed]
- Hanif, F.; Muzaffar, K.; Perveen, K.; Malhi, S.M.; Simjee, S.U. Glioblastoma Multiforme: A Review of Its Epidemiology and Pathogenesis through Clinical Presentation and Treatment. Asian Pac. J. Cancer Prev. 2017, 18, 3–9. [Google Scholar] [CrossRef]
- Sterner, R.C.; Sterner, R.M. CAR-T Cell Therapy: Current Limitations and Potential Strategies. Blood Cancer J. 2021, 11, 69. [Google Scholar] [CrossRef]
- Choi, B.D.; Yu, X.; Castano, A.P.; Darr, H.; Henderson, D.B.; Bouffard, A.A.; Larson, R.C.; Scarfò, I.; Bailey, S.R.; Gerhard, G.M.; et al. CRISPR-Cas9 Disruption of PD-1 Enhances Activity of Universal EGFRvIII CAR T Cells in a Preclinical Model of Human Glioblastoma. J. Immunother. Cancer 2019, 7, 304. [Google Scholar] [CrossRef] [PubMed]
- Qu, C.; Zhang, H.; Cao, H.; Tang, L.; Mo, H.; Liu, F.; Zhang, L.; Yi, Z.; Long, L.; Yan, L.; et al. Tumor Buster—Where Will the CAR-T Cell Therapy ‘Missile’ Go? Mol. Cancer 2022, 21, 201. [Google Scholar] [CrossRef]
- Maggs, L.; Cattaneo, G.; Dal, A.E.; Moghaddam, A.S.; Ferrone, S. CAR T Cell-Based Immunotherapy for the Treatment of Glioblastoma. Front. Neurosci. 2021, 15, 535. [Google Scholar] [CrossRef]
- Stupp, R.; Hegi, M.E.; Mason, W.P.; van den Bent, M.J.; Taphoorn, M.J.; Janzer, R.C.; Ludwin, S.K.; Allgeier, A.; Fisher, B.; Belanger, K.; et al. Effects of Radiotherapy with Concomitant and Adjuvant Temozolomide versus Radiotherapy Alone on Survival in Glioblastoma in a Randomised Phase III Study: 5-Year Analysis of the EORTC-NCIC Trial. Lancet Oncol. 2009, 10, 459–466. [Google Scholar] [CrossRef]
- Ding, D.-C.; Shyu, W.-C.; Lin, S.-Z. Mesenchymal Stem Cells. Cell Transplant. 2011, 20, 5–14. [Google Scholar] [CrossRef]
- Ridge, S.M.; Sullivan, F.J.; Glynn, S.A. Mesenchymal Stem Cells: Key Players in Cancer Progression. Mol. Cancer 2017, 16, 31. [Google Scholar] [CrossRef]
- Vakhshiteh, F.; Atyabi, F.; Ostad, S.N. Mesenchymal Stem Cell Exosomes: A Two-Edged Sword in Cancer Therapy. Int. J. Nanomed. 2019, 14, 2847–2859. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Wu, Y.; Xu, Y.; Li, G.; Li, Z.; Liu, T. Mesenchymal Stem Cell-Derived Exosomes in Cancer Therapy Resistance: Recent Advances and Therapeutic Potential. Mol. Cancer 2022, 21, 179. [Google Scholar] [CrossRef] [PubMed]
- Keerthikumar, S.; Chisanga, D.; Ariyaratne, D.; Al Saffar, H.; Anand, S.; Zhao, K.; Samuel, M.; Pathan, M.; Jois, M.; Chilamkurti, N.; et al. ExoCarta: A Web-Based Compendium of Exosomal Cargo. J. Mol. Biol. 2016, 428, 688–692. [Google Scholar] [CrossRef]
- Maia, J.; Caja, S.; Strano Moraes, M.C.; Couto, N.; Costa-Silva, B. Exosome-Based Cell-Cell Communication in the Tumor Microenvironment. Front. Cell Dev. Biol. 2018, 6, 18. [Google Scholar] [CrossRef]
- Alvarez-erviti, L.; Seow, Y.; Yin, H.; Betts, C.; Lakhal, S.; Wood, M.J.A. Delivery of SiRNA to the Mouse Brain by Systemic Injection of Targeted Exosomes. Nat. Biotechnol. 2011, 29, 341–345. [Google Scholar] [CrossRef] [PubMed]
- Jong, A.Y.; Wu, C.H.; Li, J.; Sun, J.; Fabbri, M.; Wayne, A.S.; Seeger, R.C. Large-Scale Isolation and Cytotoxicity of Extracellular Vesicles Derived from Activated Human Natural Killer Cells. J. Extracell. Vesicles 2017, 6, 1294368. [Google Scholar] [CrossRef]
- Luan, X.; Sansanaphongpricha, K.; Myers, I.; Chen, H.; Yuan, H.; Sun, D. Engineering Exosomes as Refined Biological Nanoplatforms for Drug Delivery. Acta Pharmacol. Sin. 2017, 38, 754–763. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, Y.; Liu, H.; Tang, W.H. Exosomes: Biogenesis, Biologic Function and Clinical Potential. Cell Biosci. 2019, 9, 19. [Google Scholar] [CrossRef]
- Moghadasi, S.; Elveny, M.; Rahman, H.S.; Suksatan, W.; Jalil, A.T.; Abdelbasset, W.K.; Yumashev, A.V.; Shariatzadeh, S.; Motavalli, R.; Behzad, F.; et al. A Paradigm Shift in Cell-Free Approach: The Emerging Role of MSCs-Derived Exosomes in Regenerative Medicine. J. Transl. Med. 2021, 19, 302. [Google Scholar] [CrossRef]
- Rezaeian, A.R.; Khatami, F.; Heidari Keshel, S.; Akbari, M.R.; Mirzaei, A.; Gholami, K.; Mohammadi Farsani, R.; Aghamir, S.M.K. The Effect of Mesenchymal Stem Cells-Derived Exosomes on the Prostate, Bladder, and Renal Cancer Cell Lines. Sci. Rep. 2022, 12, 20924. [Google Scholar] [CrossRef]
- Bruno, S.; Collino, F.; Deregibus, M.C.; Grange, C.; Tetta, C.; Camussi, G. Microvesicles Derived from Human Bone Marrow Mesenchymal Stem Cells Inhibit Tumor Growth. Stem Cells Dev. 2013, 22, 758–771. [Google Scholar] [CrossRef]
- Vallabhaneni, K.C.; Penfornis, P.; Dhule, S.; Guillonneau, F.; Adams, K.V.; Mo, Y.Y.; Xu, R.; Liu, Y.; Watabe, K.; Vemuri, M.C.; et al. Extracellular Vesicles from Bone Marrow Mesenchymal Stem/Stromal Cells Transport Tumor Regulatory MicroRNA, Proteins, and Metabolites. Oncotarget 2014, 6, 4953–4967. [Google Scholar] [CrossRef]
- Lin, R.; Wang, S.; Zhao, R.C. Exosomes from Human Adipose-Derived Mesenchymal Stem Cells Promote Migration through Wnt Signaling Pathway in a Breast Cancer Cell Model. Mol. Cell. Biochem. 2013, 383, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Qi, J.; Zhou, Y.; Jiao, Z.; Wang, X.; Zhao, Y.; Li, Y.; Chen, H.; Yang, L.; Zhu, H.; Li, Y. Exosomes Derived from Human Bone Marrow Mesenchymal Stem Cells Promote Tumor Growth Through Hedgehog Signaling Pathway. Cell. Physiol. Biochem. 2017, 42, 2242–2254. [Google Scholar] [CrossRef]
- Wang, M.; Zhao, C.; Shi, H.; Zhang, B.; Zhang, L.; Zhang, X.; Wang, S.; Wu, X.; Yang, T.; Huang, F.; et al. Deregulated MicroRNAs in Gastric Cancer Tissue-Derived Mesenchymal Stem Cells: Novel Biomarkers and a Mechanism for Gastric Cancer. Br. J. Cancer 2014, 110, 1199–1210. [Google Scholar] [CrossRef]
- Xu, H.; Zhao, G.; Zhang, Y.; Jiang, H.; Wang, W.; Zhao, D.; Hong, J.; Yu, H.; Qi, L. Mesenchymal Stem Cell-Derived Exosomal MicroRNA-133b Suppresses Glioma Progression via Wnt/β-Catenin Signaling Pathway by Targeting EZH2. Stem Cell Res. Ther. 2019, 10, 381. [Google Scholar] [CrossRef]
- Katakowski, M.; Buller, B.; Zheng, X.; Lu, Y.; Rogers, T.; Osobamiro, O.; Shu, W.; Jiang, F.; Chopp, M. Exosomes from Marrow Stromal Cells Expressing MiR-146b Inhibit Glioma Growth. Cancer Lett. 2013, 335, 201–204. [Google Scholar] [CrossRef]
- Figueroa, J.; Phillips, L.M.; Shahar, T.; Hossain, A.; Gumin, J.; Kim, H.; Bean, A.J.; Calin, G.A.; Fueyo, J.; Walters, E.T.; et al. Exosomes from Glioma-Associated Mesenchymal Stem Cells Increase the Tumorigenicity of Glioma Stem-like Cells via Transfer of MiR-1587. Cancer Res. 2017, 77, 5808–5819. [Google Scholar] [CrossRef] [PubMed]
- Ho, I.A.W.; Toh, H.C.; Ng, W.H.; Teo, Y.L.; Guo, C.M.; Hui, K.M.; Lam, P.Y.P. Human Bone Marrow-Derived Mesenchymal Stem Cells Suppress Human Glioma Growth through Inhibition of Angiogenesis. Stem Cells 2013, 31, 146–155. [Google Scholar] [CrossRef]
- Kološa, K.; Motaln, H.; Herold-Mende, C.; Koršič, M.; Lah, T.T. Paracrine Effects of Mesenchymal Stem Cells Induce Senescence and Differentiation of Glioblastoma Stem-like Cells. Cell Transplant. 2015, 24, 631–644. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 Years of Image Analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal Information for Studies of Extracellular Vesicles 2018 (MISEV2018): A Position Statement of the International Society for Extracellular Vesicles and Update of the MISEV2014 Guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef]
- Kim, O.; Hwangbo, C.; Tran, P.T.; Lee, J.H. Syntenin-1-Mediated Small Extracellular Vesicles Promotes Cell Growth, Migration, and Angiogenesis by Increasing Onco-MiRNAs Secretion in Lung Cancer Cells. Cell Death Dis. 2022, 13, 122. [Google Scholar] [CrossRef] [PubMed]
- Uchibori, R.; Tsukahara, T.; Mizuguchi, H.; Saga, Y.; Urabe, M.; Mizukami, H.; Kume, A.; Ozawa, K. NF-ΚB Activity Regulates Mesenchymal Stem Cell Accumulation at Tumor Sites. Cancer Res. 2013, 73, 364–372. [Google Scholar] [CrossRef]
- Ragni, E.; Orfei, C.P.; De Luca, P.; Colombini, A.; Viganò, M.; de Girolamo, L. Secreted Factors and EV-MiRNAs Orchestrate the Healing Capacity of Adipose Mesenchymal Stem Cells for the Treatment of Knee Osteoarthritis. Int. J. Mol. Sci. 2020, 21, 1582. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for Taxonomy-Based Analysis of Pathways and Genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef]
- Kanehisa, M. Toward Understanding the Origin and Evolution of Cellular Organisms. Protein Sci. 2019, 28, 1947–1951. [Google Scholar] [CrossRef]
- Friedmann-Morvinski, D. Glioblastoma Heterogeneity and Cancer Cell Plasticity. Crit. Rev. Oncog. 2014, 19, 327–336. [Google Scholar] [CrossRef]
- Lucifero, A.G.; Luzzi, S.; Brambilla, I.; Trabatti, C.; Mosconi, M.; Savasta, S.; Foiadelli, T. Innovative Therapies for Malignant Brain Tumors: The Road to a Tailored Cure. Acta Bio Med. Atenei Parm. 2020, 91, 5. [Google Scholar] [CrossRef]
- Lara-Velazquez, M.; Al-Kharboosh, R.; Jeanneret, S.; Vazquez-Ramos, C.; Mahato, D.; Tavanaiepour, D.; Rahmathulla, G.; Quinone-Hinojosa, A. Advances in Brain Tumor Surgery for Glioblastoma in Adults. Brain Sci. 2017, 7, 166. [Google Scholar] [CrossRef] [PubMed]
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.B.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef]
- Perets, N.; Hertz, S.; London, M.; Offen, D. Intranasal Administration of Exosomes Derived from Mesenchymal Stem Cells Ameliorates Autistic-like Behaviors of BTBR Mice. Mol. Autism 2018, 9, 57. [Google Scholar] [CrossRef]
- Jin, X.; Lin, T.; Xu, Y. Stem Cell Therapy and Immunological Rejection in Animal Models. Curr. Mol. Pharmacol. 2016, 9, 284–288. [Google Scholar] [CrossRef]
- Pittenger, M.F.; Discher, D.E.; Péault, B.M.; Phinney, D.G.; Hare, J.M.; Caplan, A.I. Mesenchymal Stem Cell Perspective: Cell Biology to Clinical Progress. NPJ Regen. Med. 2019, 4, 22. [Google Scholar] [CrossRef]
- Ha, D.; Yang, N.; Nadithe, V. Exosomes as Therapeutic Drug Carriers and Delivery Vehicles across Biological Membranes: Current Perspectives and Future Challenges. Acta Pharm. Sin. B 2016, 6, 287–296. [Google Scholar] [CrossRef] [PubMed]
- Bhowmik, A.; Khan, R.; Ghosh, M.K. Blood Brain Barrier: A Challenge for Effectual Therapy of Brain Tumors. BioMed Res. Int. 2015, 2015, 320941. [Google Scholar] [CrossRef]
- Sung, B.H.; von Lersner, A.; Guerrero, J.; Krystofiak, E.S.; Inman, D.; Pelletier, R.; Zijlstra, A.; Ponik, S.M.; Weaver, A.M. A Live Cell Reporter of Exosome Secretion and Uptake Reveals Pathfinding Behavior of Migrating Cells. Nat. Commun. 2020, 11, 2092. [Google Scholar] [CrossRef]
- Andreu, Z.; Yáñez-Mó, M. Tetraspanins in Extracellular Vesicle Formation and Function. Front. Immunol. 2014, 5, 42. [Google Scholar] [CrossRef] [PubMed]
- Kashyap, R.; Balzano, M.; Lechat, B.; Lambaerts, K.; Egea-Jimenez, A.L.; Lembo, F.; Fares, J.; Meeussen, S.; Kügler, S.; Roebroek, A.; et al. Syntenin-Knock out Reduces Exosome Turnover and Viral Transduction. Sci. Rep. 2021, 11, 4083. [Google Scholar] [CrossRef]
- Modi, S.J.; Kulkarni, V.M. Vascular Endothelial Growth Factor Receptor (VEGFR-2)/KDR Inhibitors: Medicinal Chemistry Perspective. Med. Drug Discov. 2019, 2, 100009. [Google Scholar] [CrossRef]
- Li, S.; Zhang, N.; Liu, S.; Zhang, H.; Liu, J.; Qi, Y.; Zhang, Q.; Li, X. ITGA5 Is a Novel Oncogenic Biomarker and Correlates With Tumor Immune Microenvironment in Gliomas. Front. Oncol. 2022, 12, 844144. [Google Scholar] [CrossRef]
- Desgrosellier, J.S.; Cheresh, D.A. Integrins in Cancer: Biological Implications and Therapeutic Opportunities. Nat. Rev. Cancer 2010, 10, 9–22. [Google Scholar] [CrossRef]
- Alonso-Alonso, M.L.; García-Posadas, L.; Diebold, Y. Extracellular Vesicles from Human Adipose-Derived Mesenchymal Stem Cells: A Review of Common Cargos. Stem Cell Rev. Rep. 2021, 18, 854–901. [Google Scholar] [CrossRef] [PubMed]
- Eirin, A.; Meng, Y.; Zhu, X.Y.; Li, Y.; Saadiq, I.M.; Jordan, K.L.; Tang, H.; Lerman, A.; van Wijnen, A.J.; Lerman, L.O. The Micro-RNA Cargo of Extracellular Vesicles Released by Human Adipose Tissue-Derived Mesenchymal Stem Cells Is Modified by Obesity. Front. Cell Dev. Biol. 2021, 9, 660851. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, R.; Mellows, B.; Sheard, J.; Antonioli, M.; Kretz, O.; Chambers, D.; Zeuner, M.T.; Tomkins, J.E.; Denecke, B.; Musante, L.; et al. Secretome of Adipose-Derived Mesenchymal Stem Cells Promotes Skeletal Muscle Regeneration through Synergistic Action of Extracellular Vesicle Cargo and Soluble Proteins. Stem Cell Res. Ther. 2019, 10, 116. [Google Scholar] [CrossRef]
- Karagkouni, D.; Paraskevopoulou, M.D.; Chatzopoulos, S.; Vlachos, I.S.; Tastsoglou, S.; Kanellos, I.; Papadimitriou, D.; Kavakiotis, I.; Maniou, S.; Skoufos, G.; et al. DIANA-TarBase v8: A Decade-Long Collection of Experimentally Supported MiRNA–Gene Interactions. Nucleic Acids Res. 2018, 46, D239–D245. [Google Scholar] [CrossRef]
- Morandi, E.M.; Verstappen, R.; Zwierzina, M.E.; Geley, S.; Pierer, G.; Ploner, C. ITGAV and ITGA5 Diversely Regulate Proliferation and Adipogenic Differentiation of Human Adipose Derived Stem Cells. Sci. Rep. 2016, 6, 28889. [Google Scholar] [CrossRef]
- Qin, F.; Tang, H.; Zhang, Y.; Zhang, Z.; Huang, P.; Zhu, J. Bone Marrow-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNA-208a Promotes Osteosarcoma Cell Proliferation, Migration, and Invasion. J. Cell. Physiol. 2020, 235, 4734–4745. [Google Scholar] [CrossRef]
- Pakravan, K.; Babashah, S.; Sadeghizadeh, M.; Mowla, S.J.; Mossahebi-Mohammadi, M.; Ataei, F.; Dana, N.; Javan, M. MicroRNA-100 Shuttled by Mesenchymal Stem Cell-Derived Exosomes Suppresses in Vitro Angiogenesis through Modulating the MTOR/HIF-1α/VEGF Signaling Axis in Breast Cancer Cells. Cell. Oncol. 2017, 40, 457–470. [Google Scholar] [CrossRef] [PubMed]
- Roccaro, A.M.; Sacco, A.; Maiso, P.; Azab, A.K.; Tai, Y.T.; Reagan, M.; Azab, F.; Flores, L.M.; Campigotto, F.; Weller, E.; et al. BM Mesenchymal Stromal Cell–Derived Exosomes Facilitate Multiple Myeloma Progression. J. Clin. Investig. 2013, 123, 1542–1555. [Google Scholar] [CrossRef] [PubMed]
Study Group | n | Invasion % | CAM Thickness Median (Range) | Number of Blood Vessels Median (Range) |
---|---|---|---|---|
HROG36—Untreated | 10 | 90 a | 199.9 (109.5–585.6) | 22 (6–51) |
HROG36—ASC-EVs | 12 | 33 a | 278.6 (114.2–511.0) | 14.5 (7–45) |
U87 MG—Untreated | 9 | 80 b | 354.0 (190.5–516.6) d | 24 (16–38) e |
U87 MG—ASC-EVs | 11 | 9 b | 134.7 (66.7–345.4) d | 18 (3–25) e |
T98G—Untreated | 12 | 83 c | 248.1 (60.11–968.2) | 28 (3–45) |
T98G—ASC-EVs | 6 | 17 c | 229.1 (193.5–527.3) | 19.5 (10–36) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gečys, D.; Skredėnienė, R.; Gečytė, E.; Kazlauskas, A.; Balnytė, I.; Jekabsone, A. Adipose Tissue-Derived Stem Cell Extracellular Vesicles Suppress Glioblastoma Proliferation, Invasiveness and Angiogenesis. Cells 2023, 12, 1247. https://doi.org/10.3390/cells12091247
Gečys D, Skredėnienė R, Gečytė E, Kazlauskas A, Balnytė I, Jekabsone A. Adipose Tissue-Derived Stem Cell Extracellular Vesicles Suppress Glioblastoma Proliferation, Invasiveness and Angiogenesis. Cells. 2023; 12(9):1247. https://doi.org/10.3390/cells12091247
Chicago/Turabian StyleGečys, Dovydas, Rūta Skredėnienė, Emilija Gečytė, Arūnas Kazlauskas, Ingrida Balnytė, and Aistė Jekabsone. 2023. "Adipose Tissue-Derived Stem Cell Extracellular Vesicles Suppress Glioblastoma Proliferation, Invasiveness and Angiogenesis" Cells 12, no. 9: 1247. https://doi.org/10.3390/cells12091247