1. Introduction
The technology of magnetic cell selection (MACS, magnetic-activated cell sorting), proposed in the 1990s by Miltenyi et al. [
1], eventually became one of the mainstays of mass cell sorting. Magnetic cell selection is currently employed in various research fields, as well as in medicine [
2,
3]. The advantages of the method include speed, simplicity, and the ability to select a large number of cells with high viability in a short time, all this without involvement of expensive equipment. However, as with any other method, it has its own disadvantages, which include a limited purity of selected cells [
4,
5,
6,
7], difficulties in selecting rare populations [
8], or complicated cell sorting using two or more markers. One of the most significant disadvantages of the magnetic selection process has long been considered its low discrimination power, which resulted in all-or none selection outcomes, namely the bulk separation of cells into largely positive and negative fractions. The possibility of a more discriminating magnetic selection process has not been previously discussed in the literature.
It should be emphasized that these drawbacks of magnetic selection may in part be related to the conditions of cell selection [
5,
9,
10,
11,
12]. For example, the study by Semple et al. [
9] demonstrated that the decrease in the antibody amount during selection may reduce the yield of the selected cells, although the purity of cell selection remains relatively constant. Wang et al. [
5] in a comparative study of four NK cell isolation protocols using both negative and CD49b-positive isolation kits from Miltenyi Biotec (Bergisch Gladbach, Germany) and Stemcell Technologies (Vancouver, BC, Canada) demonstrated a significant variation in the purity and viability of the isolated NK cells depending on the sets and markers used. The magnetic separation of the cell populations using alkaline phosphatase as selection marker showed that with an increase in the concentration of anti-ALPL-APC and/or anti-APC with magnetic microparticles, the yield of the selected cells increases [
13]. At the same time, a comparison of positive and negative magnetic selection of monocytes showed that a two-fold decrease in the concentration of antibodies does not affect the purity, selectivity, and expression of CD14 in isolated monocytes [
14].
The efficiency of the magnetic cell selection and the purity of the selected samples, defined as the ability to separate target cells from other cells and the percentage of undesired cells in selected samples, respectively, may depend on a number of factors. Currently, several solutions have been proposed to improve the efficiency of cell selection. As a solution to the problem of the magnetic selection of cells using two or more markers, Miltenyi Biotec developed the MACS MultiSort, as well as the REAlease technologies; two methods of multiparameter magnetic selection of cells. Alternative systems of magnetically activated cell sorting using microfluidics have been also developed [
15,
16,
17]. A three-stage selection system has been proposed for the selection of rare populations by magnetic selection [
8], while the combination of MACS and fluorescent cell sorting allows the selection and purification of complex and rare cellular subpopulations and, for example, is quite frequently used in hematology research [
18]. However, approaches to magnetic selection of cell populations differing in marker expression levels, in particular highly expressing populations, have not yet been developed. Solving this problem may open the way to a simple and inexpensive mass selection of cells with high marker expression or even to a separation of high- and low-expressing cell subsets.
In the present study, we attempted to address this issue. We reasoned that magnetic microbeads (MBs) that attach to a selectable marker molecules expressed on cell surface are likely to be distributed according to the representation of this marker on cells. Therefore, under conditions of limited MB availability, cells with lower marker expression will be less heavily labeled by MBs, and thus, are more likely to pass through the magnet compared to the cells with higher expression. This in turn may result in the preferential isolation of high-expressing cell subsets. The experiments reported in this study provide thorough justification of this assumption.
2. Materials and Methods
2.1. Cell Cultures
NIH 3T3 and HEK 293 cells were cultured in DMEM (Dulbecco’s Modified Eagle’s Medium) (HyClone Laboratories, South Logan, UT, USA) with 4.5 g/L glucose, 10% fetal bovine serum (FBS) (HyClone Laboratories), 2 mM glutamine (Gibco, Gaithersburg, MD, USA), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco) in 5% CO2 at 37 °C. Cells were detached with TrypLE Express (Gibco) treatment for 2–5 min at 37 °C. For magnetic selection and cytometry, the collected cells were centrifuged at 150× g for 10 min, the supernatant was removed, and the cells were suspended in phosphate buffer with 5 mM EDTA and 0.5% FBS (PBE), unless otherwise indicated.
2.2. Creation of Retroviral Expression Constructs
Bicistronic retroviral constructs with EGFP or DsRed-Express2 reporter protein ORFs in the 1st position and hLNGFR (human low-affinity nerve growth factor receptor) truncated ORF in the 2nd position were prepared using vector MigR1ad1. This vector was created on the basis of the original bicistronic MigR1 vector (Addgene #27490) [
19] to incorporate an extended polylinker, and was prepared by insertion into Bgl II and Xho I sites of the MigR1 vector of the DNA fragment obtained by annealing oligos
Ad#MigR-S1 (GATCTGCGATCGCGGCCGCACGCGTATTAGGATCCAATTGCCTGCAGGC) and Ad#MigR-A1 (TCGAGCCTGCAGGCAATTGGATCCTAATACGCGTGCGGCCGCGATCGCA)
The hLNGFR (human low-affinity nerve growth factor receptor) truncated ORF (aa 1-274) lacking the intracellular domain was amplified from the plasmid p75-RFP (Addgene #24092) using KAPA HiFi DNA polymerase (Roche Sequencing and Life Science, Wilmington, MA, USA). The 1st PCR round was performed with oligonucleotides hLNGFR-S1m (GGTGCCACCGGCCGCGCTATGGAC) and hLNGFR-A1 (TCATTGTCGACCTATCACCTCTTGAAGGCTATGTAGGC) to eliminate the undesired Nco I site near the Start codon, while the 2nd PCR round was performed with primers hLNGFR-S2 (TCATTGTCGACCTATCACCTCTTGAAGGCTATGTAGGC) and hLNGFR-A1, followed by insertion of the final fragment into the 2nd position of the MigR1ad1 vector via Nco I and Sal I sites to replace the original EGFP sequence. The correctness of the inserted fragment was verified by sequencing. The resulting MigLNR2 vector was used to prepare the final expression constructs.
To create the pMigLNR2-EGFP construct, the EGFP ORF was re-cloned from the pLeGo-G2 plasmid [
20] into the 1st position of the MigLNR2 vector via BamH I and EcoR I sites. To create the pMigLNR2-DsREx construct, the chemically synthesized (GenScript, Piscataway, NJ, USA) DsRed-Express2 [
21] ORF was inserted into the 1st position of the MigLNR2 vector via the BamH I andEcoR I sites.
2.3. NIH 3T3 Cell Transduction
HEK 293 cells in a 10 cm Petri dish at 30–35% confluence were transfected by the calcium phosphate method. For the production of viral particles, a calcium phosphate solution with 10 µg of pMigLNR2-EGFP or pMigLNR2-DsREx expression plasmid and 10 µg pCL-Eco (Addgene#12371) packaging plasmid was added to the culture medium. After 24 h, unless otherwise indicated, the medium with virus-containing supernatants (VCS) was collected and centrifuged for 5 min at 150× g; then, the VCS was passed through a 0.45 µm filter (Corning, Glendale, AR, USA) and used for the transduction of NIH 3T3 cells.
NIH 3T3 cells were seeded in the wells of a 6-well plate with an initial density of 20,000 cells/cm2, and when 35–40% confluence was reached, the cells were transduced with various doses of VCS with the addition of 16 μg/mL of polybrene (Sigma-Aldrich Sigma-Aldrich St. Louis, MO, USA). The efficiency of the cell transduction was determined by cytometry analysis 2–3 days later based on the percentage of cells expressing the reporter protein in the population. The transduced cell cultures were cultured under the conditions described above.
2.4. Magnetic Selection of Transduced Cells
For the magnetic selection of the transduced cells, MACSelect anti-LNGFR Micro Beads (No. 130-091-330) from Miltenyi Biotec, hereinafter referred to as MBs, were used. After the incubation of cells with the above MBs, selection was carried out on LS columns (No. 130-042-401) or MS columns (No. 130-042-201), mounted on a QuadroMACS or OctoMACS Separators (Miltenyi Biotec), respectively, in accordance with the recommendations of the manufacturer. In brLSef, the transduced cells were detached with TrypLE Express (Gibco) solution for 5 min. The collected cells were centrifuged at 150× g for 10 min, the supernatant was removed, and the cells were suspended in 320 µL of PBE. Furthermore, different amounts of MBs were added to the suspension and incubated for 15 min on ice; the cell suspension was then brought to 2 mL and applied to a column mounted on a MACS Separator. The column was then washed with 12 mL or 2 mL of PBE buffer for LS or MS columns, respectively. The cells of the flow-through fraction were collected in a 15 mL tube. To collect the cells of the fraction retained on the column, the column was removed from the magnet and placed in a 15 mL tube. For LS or MS columns, 5 mL and 1 mL of PBE buffer were added, respectively, and the buffer was pushed through the column with a plunger, collecting cells into test tubes. The cells of the column-retained and flow-through fractions were counted using a hemocytometer and analyzed on a cytometer. A single-stage magnetic selection was performed with the LS columns. For the two-stage magnetic selection, the first stage was carried out with the LS column; the second one with the MS column. During the two-stage selection, the collected cells of the flow-through fraction were additionally incubated with MBs and selected on the MS column, as described above. If necessary, the selected cells were further cultured in the above medium. Cell viability was determined using Trypan blue. The cells were photographed with a Leica DMI 4000B microscope camera.
2.5. Flow Cytometry
The cells before and after the magnetic selection were collected as described above and stored for no more than 30 min at 4 °C before cytometry. The collected cells were analyzed on a BDLSR Fortessa cytometer (BD Life Sciences, Franklin Lakes, NJ, USA) equipped with a 488 nm laser with an emission filter of 530 ± 15 nm, a 561 nm laser with an emission filter of 586 ± 7.5 nm, and a 640 nm laser with an emission filter of 640 ± 7 nm, which were used to detect the fluorescence of EGFP, DsRed-Express2, and antibodies. To stain the cell samples with anti-LNGFR antibodies, the cells were washed twice in phosphate-buffered saline (PBS), resuspended in 100 µL of PBS containing 0.25 mM EDTA and 0.5% FBS, and incubated in the dark on ice for 40 min with the following antibodies (BioLegend, San Diego, CA, USA): Alexa Fluor 647-conjugated anti-human CD271 antibodies (clone ME20.4; catalogue no. 345114; 1:20) or FITC-conjugated anti-human CD271 (clone ME20.4; catalogue no. 345104; 1:20). Cell clusters and debris were eliminated by sequential gating of cells on size and granularity (FSC-A/SSC-A), and on area and peak height (FSC-A/FSC-H). Cytometric settings were kept unchanged during the measurement of all samples. The amount of data collected for each sample was at least 10,000 events. Cytometric data were processed using the Flowing Software program version 2.5.1 (
https://bioscience.fi/services/cell-imaging/flowing-software), on the basis of which the necessary calculations of the parameters of the transduced populations were carried out during selection.
Most of the experiments were performed three times with similar outcomes; the figures demonstrate the representative examples of experiments.
4. Discussion
To assess the effects of various doses of MBs on the outcomes of magnetic selection, we used NIH 3T3 cells transduced with retroviral bicistronic vectors expressing LNGFR as a selection marker and fluorescent reporter proteins EGFP or DsRed-Express2, which allowed a detailed cytometric analysis of the results of retroviral transduction and cell selection. Evidence, including the results of this study, indicates that the efficiency of cell transduction depends on a number of factors, in particular, on the viral dose during the transduction. As a result of transduction, the proportion of marker-positive cells in the population and its expression profile can vary significantly. With low transduction efficiency, the selection of positive cells is usually required, and magnetic selection is considered one of the most effective methods. The attractiveness of magnetic selection technology is associated with a number of advantages of the method [
2,
3], but this approach also suffers from certain inherent drawbacks [
5,
6,
7], which are partially being counteracted by the development of new approaches and methods for magnetic cell selection [
15,
16,
17,
18]. One of the most significant disadvantages of magnetic selection process has long been considered its low discrimination power, which resulted in all-or-none selection outcomes, namely bulk separation of cells populations into positive and negative fractions. The possibility of a more discriminating selection has not been previously discussed in the literature.
The results of this study on the effects of different doses of MBs showed that in all cases, the magnetic selection of cells with the low doses of MBs contributes to the selection of cells with high expression of the selective marker. To the best of our knowledge, this feature of the magnetic selection process has not been previously reported. The depletion of negative cells was also more efficient with low MB doses. At the same time, low MB doses resulted in a reduced yield, primarily due to the selective loss of cells with low marker expression. The MFI values of populations selected with low MB doses may increase by at least a factor of 2 in the case of a fairly narrow range of expression levels, and substantially more in the case of populations with broad expression distribution, as the experiment with DsRed-Express2-positive cells has demonstrated. At the same time, high doses of MBs increase the yield of positive cells and provide a more faithful representation of cells with varying marker expression levels.
These findings have permitted us to separate heterogeneous cell populations into high- and low-expressing subsets. In the case of a rather narrow distribution of expression levels, as with the EGFP vector, the use of a two-stage selection process was necessitated, which resulted in the separation of the initial population into distinct, although partially overlapping, cell subsets, differing in expression levels by a factor of 4.4. It is likely that with the optimization of selection conditions, it will be possible to obtain a better separation of high- and low-expressing subsets. In the case of a wide expression level distribution as with DsRed-Express2, using low and high amounts of MBs was sufficient to obtain a clear separation of high and low cell populations. However, in this case as well, the two-stage selection provided a better separation of subsets with high and low marker expression.
In the study by Kowalewicz-Kulbat et al. in 2016 it was noted that a 2-fold decrease in the concentration of antibodies during the magnetic selection of monocytes did not affect the purity, selectivity, and expression of CD14 in the selected cells [
14]. In contrast, in our experiments with transduced cells, we analyzed the effects of up to tenfold and even higher reduction in the MB dose, which clearly favored the selection of cells with high expression. In certain experiments, transduced populations were first pre-selected to remove negative cells, followed by a 2–3 week cultivation, which should be sufficient for the cells to lose their magnetic label acquired after the magnetic selection [
23].
Although the analyzed cell samples in the current study represent transduced cell populations, we see no reasons why the described approach for the selection of cells with high or low marker expression cannot be applied to non-transduced immortalized cell lines, provided that the specific surface marker is available for magnetic selection. Moreover, it is likely that this approach can be used for primary cells in case the potential reduction in cell yield is not a critical factor. However, the entailing losses of cells with low marker expression may be disadvantageous for some applications.
It should also be noted that the concentration of antibodies during the magnetic selection may affect not only the number of selected cells, but also the purity of the cell selection. In particular, it was previously noted that the purity of the cell selection during the magnetic selection depends on antibodies supplied by different manufacturers and the selection conditions [
5,
7,
13]. The results of this study demonstrate that small doses of MBs contribute not only to the preferential selection of cells with high marker expression, but also to an increase in the purity of cells selected on the column, even for populations with quite a low percentage of positive cells, as judged by the percentage of negative cells in the selected cell samples. Additional factors that affect the purity of the selected fractions include cell viability and aggregation, the size heterogeneity of the selectable cells, the non-specific mechanical retention of cells on the column matrix, and the selection conditions.
Our results also indicate that the difference in the expression levels of negative and positive cell populations is an important factor strongly affecting the success of the magnetic selection process. With the high expression levels of the selective marker, low amounts of MBs used for magnetic purification favor the selection of purer cell populations. At the same time, the low marker expression levels necessitate the use of high amounts of MBs for selection in order to avoid losses of low-expressing cells. However, our data demonstrate that with high amounts of MBs, the contamination of selected populations with negative cells becomes more pronounced. It is, at present, unclear whether this is the result of a non-specific surface interaction of truly negative cells with MBs, or at least if some of the “negative” cells are not in reality negative but do express very low levels of selection marker, possibly as a result of a variable degree of silencing of integrated viral genomes. We, however, favor the third interpretation, namely that some of the magnetic nanoparticles become non-specifically internalized by cells via the endocytosis pathway, resulting in the labeling of negative cells, which is expected to be proportional to the concentration of MBs during labeling.
Our data also provide a cautionary note, namely that in situations where populations that are to be selected contain subsets of cells with low expression levels, using even high doses of MBs does not guarantee the correct representation of all subsets, and may result in substantial under-representation of low-expressing cells following selection.
5. Conclusions
Magnetic cell sorting is currently a widely applied technology with a number of attractive features such as simplicity, independence of expensive equipment and capacity for mass cell selection. However, its applications have been limited so far to the bulk separations of cell populations into largely negative and positive subsets, without further discrimination. In the current study, we developed an approach that provides more selective outcomes of magnetic cell sorting. In particular, cell selection with low doses of MBs results in the depletion of weakly expressing cells while ensuring a better removal of negative cells. Our results further demonstrate that selection with low MB doses results in the enrichment of cells with high expression levels in the column-retained fraction, while high MB doses favor the enrichment of low-expressing cells in the flow-through fraction. This makes the use of magnetic cell sorting possible not only for the specific enrichment of cells with a high expression of selectable marker, but also for the separation of cell populations into subsets with high or low marker expression levels.
Taken together, the results of this study suggest that the proposed approach extends the discriminating power of current magnetic sorting technologies. Given the ability of magnetic sorting to work with large, clinically relevant cell samples, this may open new possibilities in a number of biomedical applications, including the field of regenerative medicine, particularly in those cases where selection of cell populations with high or low expression of specific marker may be advantageous for clinical outcomes. In certain applications, this approach can also significantly reduce the consumption of magnetic beads during selection.