The Effects of Smoking on Telomere Length, Induction of Oncogenic Stress, and Chronic Inflammatory Responses Leading to Aging
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Samples
2.2. Cell Lines
2.3. Primers
2.4. Antibodies for Immunohistochemistry
2.5. Other Materials for Immunihistochemistry
2.6. Preparation of Cigarette Smoke Extract (CSE)
2.7. Tissue Culture Techniques
2.8. Isolation of Blood Leukocytes
2.9. Handling of Buccal Swabs
2.10. Real Time PCR
2.11. Isolation of DNA
2.12. Bisulfite Conversion of DNA
2.13. PCR of Bisulfite-Converted DNA
2.14. Agarose Gel Electrophoresis
2.15. Next-Generation Sequencing (NGS)
2.16. Telomere Length Assay
2.17. Enzyme Linked Immunosorbent Assay (ELISA)
2.18. Immunihistochemistry
2.19. Statistical Analysis
3. Results
3.1. Demographics for the Collection of Serum, Buccal Swabs, and Lung Sections of Smokers and Non-Smokers
3.2. Gene Expression Levels of hTERT, ISG15, TRF2, and POT1 in PC9 Cells and HLF Cells
3.3. Telomere Length Modulation of PC9 Cells and HLF Cells with Telomere Length Comparison in Smokers and Non-Smokers
3.4. Gene Expression Comparison of hTERT, ISG15, TRF2, POT1, and Methylation Pattern Analysis of hTERT in Smokers and Non-Smokers
3.5. Comparing Telomere Length of Smokers and Non-Smokers
3.6. Determining the Expression of IFN-γ in the Plasma of Smokers and Non-Smokers
3.7. Expression of ISG15 in Smoker and Non-Smoker Lung Tissue
3.8. hTERT Expression in Smokers and Non-Smokers with Lung Cancer
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bernadotte, A.; Mikhelson, V.M.; Spivak, I.M. Markers of cellular senescence. Telomere shortening as a marker of cellular senescence. Aging 2016, 8, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Stewart, S.A.; Weinberg, R.A. Telomeres: Cancer to human aging. Annu. Rev. Cell Dev. Biol. 2006, 22, 531–557. [Google Scholar] [CrossRef] [PubMed]
- Schumacher, B.; Pothof, J.; Vijg, J.; Hoeijmakers, J.H.J. The central role of DNA damage in the ageing process. Nature 2021, 592, 695–703. [Google Scholar] [CrossRef]
- Srinivas, N.; Rachakonda, S.; Kumar, R. Telomeres and Telomere Length: A General Overview. Cancers 2020, 12, 558. [Google Scholar] [CrossRef] [PubMed]
- Doksani, Y. The Response to DNA Damage at Telomeric Repeats and Its Consequences for Telomere Function. Genes 2019, 10, 318. [Google Scholar] [CrossRef]
- Martinez, P.; Blasco, M.A. Telomere-driven diseases and telomere-targeting therapies. J. Cell Biol. 2017, 216, 875–887. [Google Scholar] [CrossRef]
- Wai, L.K. Telomeres, telomerase, and tumorigenesis—A review. MedGenMed Medscape Gen. Med. 2004, 6, 19. [Google Scholar]
- Takai, K.K.; Hooper, S.; Blackwood, S.; Gandhi, R.; de Lange, T. In vivo stoichiometry of shelterin components. J. Biol. Chem. 2010, 285, 1457–1467. [Google Scholar] [CrossRef] [PubMed]
- Ghilain, C.; Gilson, E.; Giraud-Panis, M.J. Multifunctionality of the Telomere-Capping Shelterin Complex Explained by Variations in Its Protein Composition. Cells 2021, 10, 1753. [Google Scholar] [CrossRef]
- De Lange, T. Shelterin: The protein complex that shapes and safeguards human telomeres. Genes Dev. 2005, 19, 2100–2110. [Google Scholar] [CrossRef]
- Zhang, Y.; Hou, K.; Tong, J.; Zhang, H.; Xiong, M.; Liu, J.; Jia, S. The Altered Functions of Shelterin Components in ALT Cells. Int. J. Mol. Sci. 2023, 24, 16830. [Google Scholar] [CrossRef] [PubMed]
- Mir, S.M.; Samavarchi Tehrani, S.; Goodarzi, G.; Jamalpoor, Z.; Asadi, J.; Khelghati, N.; Qujeq, D.; Maniati, M. Shelterin Complex at Telomeres: Implications in Ageing. Clin. Interv. Aging 2020, 15, 827–839. [Google Scholar] [CrossRef]
- Broccoli, D.; Smogorzewska, A.; Chong, L.; de Lange, T. Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat. Genet. 1997, 17, 231–235. [Google Scholar] [CrossRef]
- van Steensel, B.; de Lange, T. Control of telomere length by the human telomeric protein TRF1. Nature 1997, 385, 740–743. [Google Scholar] [CrossRef] [PubMed]
- Smogorzewska, A.; van Steensel, B.; Bianchi, A.; Oelmann, S.; Schaefer, M.R.; Schnapp, G.; de Lange, T. Control of human telomere length by TRF1 and TRF2. Mol. Cell. Biol. 2000, 20, 1659–1668. [Google Scholar] [CrossRef] [PubMed]
- Ivancich, M.; Schrank, Z.; Wojdyla, L.; Leviskas, B.; Kuckovic, A.; Sanjali, A.; Puri, N. Treating Cancer by Targeting Telomeres and Telomerase. Antioxidants 2017, 6, 15. [Google Scholar] [CrossRef]
- Sfeir, A.; Kabir, S.; van Overbeek, M.; Celli, G.B.; de Lange, T. Loss of Rap1 induces telomere recombination in the absence of NHEJ or a DNA damage signal. Science 2010, 327, 1657–1661. [Google Scholar] [CrossRef]
- Sfeir, A.; Kosiyatrakul, S.T.; Hockemeyer, D.; MacRae, S.L.; Karlseder, J.; Schildkraut, C.L.; de Lange, T. Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell 2009, 138, 90–103. [Google Scholar] [CrossRef]
- Denchi, E.L.; de Lange, T. Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 2007, 448, 1068–1071. [Google Scholar] [CrossRef]
- Celli, G.B.; de Lange, T. DNA processing is not required for ATM-mediated telomere damage response after TRF2 deletion. Nat. Cell Biol. 2005, 7, 712–718. [Google Scholar] [CrossRef]
- Karlseder, J.; Hoke, K.; Mirzoeva, O.K.; Bakkenist, C.; Kastan, M.B.; Petrini, J.H.; de Lange, T. The telomeric protein TRF2 binds the ATM kinase and can inhibit the ATM-dependent DNA damage response. PLoS Biol. 2004, 2, E240. [Google Scholar] [CrossRef] [PubMed]
- Crees, Z.; Girard, J.; Rios, Z.; Botting, G.M.; Harrington, K.; Shearrow, C.; Wojdyla, L.; Stone, A.L.; Uppada, S.B.; Devito, J.T.; et al. Oligonucleotides and G-quadruplex stabilizers: Targeting telomeres and telomerase in cancer therapy. Curr. Pharm. Des. 2014, 20, 6422–6437. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Multani, A.S.; He, H.; Cosme-Blanco, W.; Deng, Y.; Deng, J.M.; Bachilo, O.; Pathak, S.; Tahara, H.; Bailey, S.M.; et al. Pot1 deficiency initiates DNA damage checkpoint activation and aberrant homologous recombination at telomeres. Cell 2006, 126, 49–62. [Google Scholar] [CrossRef]
- Takasugi, T.; Gu, P.; Liang, F.; Staco, I.; Chang, S. Pot1b−/− tumors activate G-quadruplex-induced DNA damage to promote telomere hyper-elongation. Nucleic Acids Res. 2023, 51, 9227–9247. [Google Scholar] [CrossRef]
- Churikov, D.; Wei, C.; Price, C.M. Vertebrate POT1 restricts G-overhang length and prevents activation of a telomeric DNA damage checkpoint but is dispensable for overhang protection. Mol. Cell. Biol. 2006, 26, 6971–6982. [Google Scholar] [CrossRef]
- Simonet, T.; Zaragosi, L.E.; Philippe, C.; Lebrigand, K.; Schouteden, C.; Augereau, A.; Bauwens, S.; Ye, J.; Santagostino, M.; Giulotto, E.; et al. The human TTAGGG repeat factors 1 and 2 bind to a subset of interstitial telomeric sequences and satellite repeats. Cell Res. 2011, 21, 1028–1038. [Google Scholar] [CrossRef]
- Mukherjee, A.K.; Sharma, S.; Bagri, S.; Kutum, R.; Kumar, P.; Hussain, A.; Singh, P.; Saha, D.; Kar, A.; Dash, D.; et al. Telomere repeat-binding factor 2 binds extensively to extra-telomeric G-quadruplexes and regulates the epigenetic status of several gene promoters. J. Biol. Chem. 2019, 294, 17709–17722. [Google Scholar] [CrossRef] [PubMed]
- Schneider, R.P.; Garrobo, I.; Foronda, M.; Palacios, J.A.; Marion, R.M.; Flores, I.; Ortega, S.; Blasco, M.A. TRF1 is a stem cell marker and is essential for the generation of induced pluripotent stem cells. Nat. Commun. 2013, 4, 1946. [Google Scholar] [CrossRef]
- Marion, R.M.; Lopez de Silanes, I.; Mosteiro, L.; Gamache, B.; Abad, M.; Guerra, C.; Megias, D.; Serrano, M.; Blasco, M.A. Common Telomere Changes during In Vivo Reprogramming and Early Stages of Tumorigenesis. Stem Cell Rep. 2017, 8, 460–475. [Google Scholar] [CrossRef]
- Ohishi, T.; Muramatsu, Y.; Yoshida, H.; Seimiya, H. TRF1 ensures the centromeric function of Aurora-B and proper chromosome segregation. Mol. Cell. Biol. 2014, 34, 2464–2478. [Google Scholar] [CrossRef]
- Lee, J.; Gollahon, L. Mitotic perturbations induced by Nek2 overexpression require interaction with TRF1 in breast cancer cells. Cell Cycle 2013, 12, 3599–3614. [Google Scholar] [CrossRef]
- Biroccio, A.; Cherfils-Vicini, J.; Augereau, A.; Pinte, S.; Bauwens, S.; Ye, J.; Simonet, T.; Horard, B.; Jamet, K.; Cervera, L.; et al. TRF2 inhibits a cell-extrinsic pathway through which natural killer cells eliminate cancer cells. Nat. Cell Biol. 2013, 15, 818–828. [Google Scholar] [CrossRef]
- Cherfils-Vicini, J.; Iltis, C.; Cervera, L.; Pisano, S.; Croce, O.; Sadouni, N.; Gyorffy, B.; Collet, R.; Renault, V.M.; Rey-Millet, M.; et al. Cancer cells induce immune escape via glycocalyx changes controlled by the telomeric protein TRF2. EMBO J. 2019, 38, e100012. [Google Scholar] [CrossRef]
- Saha, A.; Roy, S.; Kar, M.; Roy, S.; Thakur, S.; Padhi, S.; Akhter, Y.; Banerjee, B. Role of Telomeric TRF2 in Orosphere Formation and CSC Phenotype Maintenance Through Efficient DNA Repair Pathway and its Correlation with Recurrence in OSCC. Stem Cell Rev. Rep. 2018, 14, 871–887. [Google Scholar] [CrossRef]
- Zizza, P.; Dinami, R.; Porru, M.; Cingolani, C.; Salvati, E.; Rizzo, A.; D’Angelo, C.; Petti, E.; Amoreo, C.A.; Mottolese, M.; et al. TRF2 positively regulates SULF2 expression increasing VEGF-A release and activity in tumor microenvironment. Nucleic Acids Res. 2019, 47, 3365–3382. [Google Scholar] [CrossRef]
- El Mai, M.; Wagner, K.D.; Michiels, J.F.; Ambrosetti, D.; Borderie, A.; Destree, S.; Renault, V.; Djerbi, N.; Giraud-Panis, M.J.; Gilson, E.; et al. The Telomeric Protein TRF2 Regulates Angiogenesis by Binding and Activating the PDGFRbeta Promoter. Cell Rep. 2014, 9, 1047–1060. [Google Scholar] [CrossRef]
- Cai, Y.; Sukhova, G.K.; Wong, H.K.; Xu, A.; Tergaonkar, V.; Vanhoutte, P.M.; Tang, E.H. Rap1 induces cytokine production in pro-inflammatory macrophages through NFkappaB signaling and is highly expressed in human atherosclerotic lesions. Cell Cycle 2015, 14, 3580–3592. [Google Scholar] [CrossRef]
- Fernandes, S.G.; Dsouza, R.; Pandya, G.; Kirtonia, A.; Tergaonkar, V.; Lee, S.Y.; Garg, M.; Khattar, E. Role of Telomeres and Telomeric Proteins in Human Malignancies and Their Therapeutic Potential. Cancers 2020, 12, 1901. [Google Scholar] [CrossRef]
- Wright, W.E.; Piatyszek, M.A.; Rainey, W.E.; Byrd, W.; Shay, J.W. Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet. 1996, 18, 173–179. [Google Scholar] [CrossRef]
- Berei, J.; Eckburg, A.; Miliavski, E.; Anderson, A.D.; Miller, R.J.; Dein, J.; Giuffre, A.M.; Tang, D.; Deb, S.; Racherla, K.S.; et al. Potential Telomere-Related Pharmacological Targets. Curr. Top. Med. Chem. 2020, 20, 458–484. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, K.; Seimiya, H. Revisiting Telomere Shortening in Cancer. Cells 2019, 8, 107. [Google Scholar] [CrossRef] [PubMed]
- Trybek, T.; Kowalik, A.; Gozdz, S.; Kowalska, A. Telomeres and telomerase in oncogenesis. Oncol. Lett. 2020, 20, 1015–1027. [Google Scholar] [CrossRef] [PubMed]
- Tsuji, T.; Aoshiba, K.; Nagai, A. Alveolar cell senescence in patients with pulmonary emphysema. Am. J. Respir. Crit. Care Med. 2006, 174, 886–893. [Google Scholar] [CrossRef]
- Huzen, J.; Wong, L.S.; van Veldhuisen, D.J.; Samani, N.J.; Zwinderman, A.H.; Codd, V.; Cawthon, R.M.; Benus, G.F.; van der Horst, I.C.; Navis, G.; et al. Telomere length loss due to smoking and metabolic traits. J. Intern. Med. 2014, 275, 155–163. [Google Scholar] [CrossRef] [PubMed]
- Mirzalieva, O.; Juncker, M.; Schwartzenburg, J.; Desai, S. ISG15 and ISGylation in Human Diseases. Cells 2022, 11, 538. [Google Scholar] [CrossRef] [PubMed]
- Valavanidis, A.; Vlachogianni, T.; Fiotakis, K. Tobacco smoke: Involvement of reactive oxygen species and stable free radicals in mechanisms of oxidative damage, carcinogenesis and synergistic effects with other respirable particles. Int. J. Environ. Res. Public Health 2009, 6, 445–462. [Google Scholar] [CrossRef] [PubMed]
- Redstone, S.C.J.; Fleming, A.M.; Burrows, C.J. Oxidative Modification of the Potential G-Quadruplex Sequence in the PCNA Gene Promoter Can Turn on Transcription. Chem. Res. Toxicol. 2019, 32, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: Role and Response of Short Guanine Tracts at Genomic Locations. Int. J. Mol. Sci. 2019, 20, 4258. [Google Scholar] [CrossRef] [PubMed]
- Barnes, R.P.; Fouquerel, E.; Opresko, P.L. The impact of oxidative DNA damage and stress on telomere homeostasis. Mech. Ageing Dev. 2019, 177, 37–45. [Google Scholar] [CrossRef]
- Gottschling, D.E.; Aparicio, O.M.; Billington, B.L.; Zakian, V.A. Position effect at S. cerevisiae telomeres: Reversible repression of Pol II transcription. Cell 1990, 63, 751–762. [Google Scholar] [CrossRef]
- Stadler, G.; Rahimov, F.; King, O.D.; Chen, J.C.; Robin, J.D.; Wagner, K.R.; Shay, J.W.; Emerson, C.P., Jr.; Wright, W.E. Telomere position effect regulates DUX4 in human facioscapulohumeral muscular dystrophy. Nat. Struct. Mol. Biol. 2013, 20, 671–678. [Google Scholar] [CrossRef]
- Robin, J.D.; Ludlow, A.T.; Batten, K.; Magdinier, F.; Stadler, G.; Wagner, K.R.; Shay, J.W.; Wright, W.E. Telomere position effect: Regulation of gene expression with progressive telomere shortening over long distances. Genes Dev. 2014, 28, 2464–2476. [Google Scholar] [CrossRef]
- Kim, W.; Ludlow, A.T.; Min, J.; Robin, J.D.; Stadler, G.; Mender, I.; Lai, T.P.; Zhang, N.; Wright, W.E.; Shay, J.W. Regulation of the Human Telomerase Gene TERT by Telomere Position Effect-Over Long Distances (TPE-OLD): Implications for Aging and Cancer. PLoS Biol. 2016, 14, e2000016. [Google Scholar] [CrossRef]
- Jacome Burbano, M.S.; Gilson, E. The Power of Stress: The Telo-Hormesis Hypothesis. Cells 2021, 10, 1156. [Google Scholar] [CrossRef]
- Horn, S.; Figl, A.; Rachakonda, P.S.; Fischer, C.; Sucker, A.; Gast, A.; Kadel, S.; Moll, I.; Nagore, E.; Hemminki, K.; et al. TERT promoter mutations in familial and sporadic melanoma. Science 2013, 339, 959–961. [Google Scholar] [CrossRef]
- Gupta, S.; Vanderbilt, C.M.; Lin, Y.T.; Benhamida, J.K.; Jungbluth, A.A.; Rana, S.; Momeni-Boroujeni, A.; Chang, J.C.; McFarlane, T.; Salazar, P.; et al. A Pan-Cancer Study of Somatic TERT Promoter Mutations and Amplification in 30,773 Tumors Profiled by Clinical Genomic Sequencing. J. Mol. Diagn. JMD 2021, 23, 253–263. [Google Scholar] [CrossRef]
- Hafezi, F.; Jaxel, L.; Lemaire, M.; Turner, J.D.; Perez-Bercoff, D. TERT Promoter Mutations Increase Sense and Antisense Transcription from the TERT Promoter. Biomedicines 2021, 9, 1773. [Google Scholar] [CrossRef]
- Chiba, K.; Johnson, J.Z.; Vogan, J.M.; Wagner, T.; Boyle, J.M.; Hockemeyer, D. Cancer-associated TERT promoter mutations abrogate telomerase silencing. eLife 2015, 4, e07918. [Google Scholar] [CrossRef]
- D’Cunha, J.; Knight, E., Jr.; Haas, A.L.; Truitt, R.L.; Borden, E.C. Immunoregulatory properties of ISG15, an interferon-induced cytokine. Proc. Natl. Acad. Sci. USA 1996, 93, 211–215. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.A.; Kim, Y.J.; Jeon, Y.J. The diverse repertoire of ISG15: More intricate than initially thought. Exp. Mol. Med. 2022, 54, 1779–1792. [Google Scholar] [CrossRef] [PubMed]
- Lou, Z.; Wei, J.; Riethman, H.; Baur, J.A.; Voglauer, R.; Shay, J.W.; Wright, W.E. Telomere length regulates ISG15 expression in human cells. Aging 2009, 1, 608–621. [Google Scholar] [CrossRef]
- Owhashi, M.; Taoka, Y.; Ishii, K.; Nakazawa, S.; Uemura, H.; Kambara, H. Identification of a ubiquitin family protein as a novel neutrophil chemotactic factor. Biochem. Biophys. Res. Commun. 2003, 309, 533–539. [Google Scholar] [CrossRef]
- Zhang, J. Yin and yang interplay of IFN-gamma in inflammation and autoimmune disease. J. Clin. Investig. 2007, 117, 871–873. [Google Scholar] [CrossRef]
- Gavia-Garcia, G.; Rosado-Perez, J.; Arista-Ugalde, T.L.; Aguiniga-Sanchez, I.; Santiago-Osorio, E.; Mendoza-Nunez, V.M. Telomere Length and Oxidative Stress and Its Relation with Metabolic Syndrome Components in the Aging. Biology 2021, 10, 253. [Google Scholar] [CrossRef]
- Morla, M.; Busquets, X.; Pons, J.; Sauleda, J.; MacNee, W.; Agusti, A.G. Telomere shortening in smokers with and without COPD. Eur. Respir. J. 2006, 27, 525–528. [Google Scholar] [CrossRef]
- Astuti, Y.; Wardhana, A.; Watkins, J.; Wulaningsih, W.; Network, P.R. Cigarette smoking and telomere length: A systematic review of 84 studies and meta-analysis. Environ. Res. 2017, 158, 480–489. [Google Scholar] [CrossRef]
- Schmutz, I.; Timashev, L.; Xie, W.; Patel, D.J.; de Lange, T. TRF2 binds branched DNA to safeguard telomere integrity. Nat. Struct. Mol. Biol. 2017, 24, 734–742. [Google Scholar] [CrossRef]
- Imran, S.A.M.; Yazid, M.D.; Cui, W.; Lokanathan, Y. The Intra- and Extra-Telomeric Role of TRF2 in the DNA Damage Response. Int. J. Mol. Sci. 2021, 22, 9900. [Google Scholar] [CrossRef]
- Wang, Z.; Wu, X. Abnormal function of telomere protein TRF2 induces cell mutation and the effects of environmental tumor-promoting factors (Review). Oncol. Rep. 2021, 46, 184. [Google Scholar] [CrossRef]
- Luke-Glaser, S.; Poschke, H.; Luke, B. Getting in (and out of) the loop: Regulating higher order telomere structures. Front. Oncol. 2012, 2, 180. [Google Scholar] [CrossRef]
- Mullins, M.R.; Rajavel, M.; Hernandez-Sanchez, W.; de la Fuente, M.; Biendarra, S.M.; Harris, M.E.; Taylor, D.J. POT1-TPP1 Binding and Unfolding of Telomere DNA Discriminates against Structural Polymorphism. J. Mol. Biol. 2016, 428, 2695–2708. [Google Scholar] [CrossRef]
- Wang, H.; Nora, G.J.; Ghodke, H.; Opresko, P.L. Single molecule studies of physiologically relevant telomeric tails reveal POT1 mechanism for promoting G-quadruplex unfolding. J. Biol. Chem. 2011, 286, 7479–7489. [Google Scholar] [CrossRef]
- Barragan, R.; Ortega-Azorin, C.; Sorli, J.V.; Asensio, E.M.; Coltell, O.; St-Onge, M.P.; Portoles, O.; Corella, D. Effect of Physical Activity, Smoking, and Sleep on Telomere Length: A Systematic Review of Observational and Intervention Studies. J. Clin. Med. 2021, 11, 76. [Google Scholar] [CrossRef]
- Ahmad, T.; Sundar, I.K.; Tormos, A.M.; Lerner, C.A.; Gerloff, J.; Yao, H.; Rahman, I. Shelterin Telomere Protection Protein 1 Reduction Causes Telomere Attrition and Cellular Senescence via Sirtuin 1 Deacetylase in Chronic Obstructive Pulmonary Disease. Am. J. Respir. Cell Mol. Biol. 2017, 56, 38–49. [Google Scholar] [CrossRef]
- O’Sullivan, R.J.; Kubicek, S.; Schreiber, S.L.; Karlseder, J. Reduced histone biosynthesis and chromatin changes arising from a damage signal at telomeres. Nat. Struct. Mol. Biol. 2010, 17, 1218–1225. [Google Scholar] [CrossRef]
- Ernst, J.; Kheradpour, P.; Mikkelsen, T.S.; Shoresh, N.; Ward, L.D.; Epstein, C.B.; Zhang, X.; Wang, L.; Issner, R.; Coyne, M.; et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature 2011, 473, 43–49. [Google Scholar] [CrossRef]
- Albino, A.P.; Jorgensen, E.D.; Rainey, P.; Gillman, G.; Clark, T.J.; Gietl, D.; Zhao, H.; Traganos, F.; Darzynkiewicz, Z. gammaH2AX: A potential DNA damage response biomarker for assessing toxicological risk of tobacco products. Mutat. Res. 2009, 678, 43–52. [Google Scholar] [CrossRef]
- Lee, K.H.; Kim, D.Y.; Kim, W. Regulation of Gene Expression by Telomere Position Effect. Int. J. Mol. Sci. 2021, 22, 12807. [Google Scholar] [CrossRef]
- Jeon, Y.J.; Yoo, H.M.; Chung, C.H. ISG15 and immune diseases. Biochim. Et Biophys. Acta 2010, 1802, 485–496. [Google Scholar] [CrossRef]
- Misteli, T. The long reach of telomeres. Genes Dev. 2014, 28, 2445–2446. [Google Scholar] [CrossRef]
- Robin, J.D.; Ludlow, A.T.; Batten, K.; Gaillard, M.C.; Stadler, G.; Magdinier, F.; Wright, W.E.; Shay, J.W. SORBS2 transcription is activated by telomere position effect-over long distance upon telomere shortening in muscle cells from patients with facioscapulohumeral dystrophy. Genome Res. 2015, 25, 1781–1790. [Google Scholar] [CrossRef]
- Penev, A.; Bazley, A.; Shen, M.; Boeke, J.D.; Savage, S.A.; Sfeir, A. Alternative splicing is a developmental switch for hTERT expression. Mol. Cell 2021, 81, 2349–2360 e2346. [Google Scholar] [CrossRef]
- Ludlow, A.T.; Slusher, A.L.; Sayed, M.E. Insights into Telomerase/hTERT Alternative Splicing Regulation Using Bioinformatics and Network Analysis in Cancer. Cancers 2019, 11, 666. [Google Scholar] [CrossRef]
- Zimmermann, S.; Martens, U.M. Telomeres and telomerase as targets for cancer therapy. Cell. Mol. Life Sci. CMLS 2007, 64, 906–921. [Google Scholar] [CrossRef]
- Andersen, J.B.; Hassel, B.A. The interferon regulated ubiquitin-like protein, ISG15, in tumorigenesis: Friend or foe? Cytokine Growth Factor Rev. 2006, 17, 411–421. [Google Scholar] [CrossRef]
- Farrell, P.J.; Broeze, R.J.; Lengyel, P. Accumulation of an mRNA and protein in interferon-treated Ehrlich ascites tumour cells. Nature 1979, 279, 523–525. [Google Scholar] [CrossRef]
- Recht, M.; Borden, E.C.; Knight, E., Jr. A human 15-kDa IFN-induced protein induces the secretion of IFN-gamma. J. Immunol. 1991, 147, 2617–2623. [Google Scholar] [CrossRef]
- Shin, K.H.; Kang, M.K.; Dicterow, E.; Park, N.H. Hypermethylation of the hTERT promoter inhibits the expression of telomerase activity in normal oral fibroblasts and senescent normal oral keratinocytes. Br. J. Cancer 2003, 89, 1473–1478. [Google Scholar] [CrossRef]
- Castelo-Branco, P.; Choufani, S.; Mack, S.; Gallagher, D.; Zhang, C.; Lipman, T.; Zhukova, N.; Walker, E.J.; Martin, D.; Merino, D.; et al. Methylation of the TERT promoter and risk stratification of childhood brain tumours: An integrative genomic and molecular study. Lancet. Oncol. 2013, 14, 534–542. [Google Scholar] [CrossRef]
- Blackburn, E.H.; Epel, E.S. Telomeres and adversity: Too toxic to ignore. Nature 2012, 490, 169–171. [Google Scholar] [CrossRef]
- Hannen, R.; Bartsch, J.W. Essential roles of telomerase reverse transcriptase hTERT in cancer stemness and metastasis. FEBS Lett. 2018, 592, 2023–2031. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′ → 3′) | DNA Bases | |
---|---|---|---|
hTERT | F: | TGTTTCTGGATTTGCAGGTG | 20 |
R: | GTTCTTGGCTTTCAGGATGG | 20 | |
ISG15 | F: | CTCTGAGCATCCTGGTGAGGAA | 22 |
R: | AAGGTCAGCCAGAACAGGTCGT | 22 | |
TRF2 | F: | CTGAGTCCGCTGCCTCAAGT | 20 |
R: | ATGGTGGTTGGAGGATTCCG | 20 | |
POT1 | F: | GCCACGAAGACCTGGAACTT | 20 |
R: | CCACAGAAGAAGGAATCCACG | 21 | |
IFN-γ | F: | CATTCAGATGTAGCGGATAATG | 22 |
R: | ATTCATGTCTTCCTTGATGG | 20 | |
GAPDH | F: | ATGACATCAAGAAGGTGGTG | 20 |
R: | CAGGAAATGAGCTTGACAAA | 20 |
Gene | Sequence (5′ → 3′) | DNA Bases | Annealing Temperature | |
---|---|---|---|---|
hTERT | F: | GYGGGGAAGTGTTGTAGGGAGG | 22 | 61 °C |
R: | CCTAATCCRAAAACCCAAAACTAC | 24 | ||
CS1 | F: | ACACTGACGACATGGTTCTACA | 22 | N/A |
CS2 | R: | TACGGTAGCAGAGACTTGGTCT | 22 | N/A |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deb, S.; Berei, J.; Miliavski, E.; Khan, M.J.; Broder, T.J.; Akurugo, T.A.; Lund, C.; Fleming, S.E.; Hillwig, R.; Ross, J.; et al. The Effects of Smoking on Telomere Length, Induction of Oncogenic Stress, and Chronic Inflammatory Responses Leading to Aging. Cells 2024, 13, 884. https://doi.org/10.3390/cells13110884
Deb S, Berei J, Miliavski E, Khan MJ, Broder TJ, Akurugo TA, Lund C, Fleming SE, Hillwig R, Ross J, et al. The Effects of Smoking on Telomere Length, Induction of Oncogenic Stress, and Chronic Inflammatory Responses Leading to Aging. Cells. 2024; 13(11):884. https://doi.org/10.3390/cells13110884
Chicago/Turabian StyleDeb, Shreya, Joseph Berei, Edward Miliavski, Muhammad J. Khan, Taylor J. Broder, Thomas A. Akurugo, Cody Lund, Sara E. Fleming, Robert Hillwig, Joseph Ross, and et al. 2024. "The Effects of Smoking on Telomere Length, Induction of Oncogenic Stress, and Chronic Inflammatory Responses Leading to Aging" Cells 13, no. 11: 884. https://doi.org/10.3390/cells13110884