Modulation of Phytochemical Pathways and Antioxidant Activity in Peppermint by Salicylic Acid and GR24: A Molecular Approach
Abstract
:1. Introduction
- -
- Gene expression in the menthol biosynthetic pathway;
- -
- Essential oil quality;
- -
- Changes in growth and photosynthesis;
- -
- Essential oil yield and quality;
- -
- Antioxidant defense mechanisms.
2. Materials and Methods
2.1. Plant Material and Experimental Design
2.2. Growth Traits
2.3. Carotenoid and Chlorophyll Contents
2.4. Determination of Lipid Peroxidation and Proline Accumulation
2.5. Determination of Hydrogen Peroxide (H2O2) Accumulation and Total Soluble Phenolic Compounds
2.6. Determination of the Activity of Phenylalanine Ammonia Lyase (PAL)
2.7. Measurement of Catalase and Ascorbate Peroxidase Activities
2.8. DPPH Radical Scavenging Activity
2.9. Extraction and Identification of Essential Oil Compounds
2.10. Gene Expression Analysis
Data Analyses
3. Results
3.1. Effects of Salicylic Acid and Strigolactone on Growth Parameters of Peppermint Plants
3.2. Improvement in Photosynthetic Pigment Content in Peppermint by Foliar Application of Salicylic Acid and Strigolactone
3.3. Effects of SA and GR24 on H2O2, MDA, Proline, and Total Soluble Phenolic Levels
3.4. Effects of Strigolactone and Salicylic Acid on Antioxidant Enzymes, Phenolic Compounds, and Radical Scavenging Activity in Peppermint
3.5. Effects of Phytohormones on the Chemical Composition of Peppermint Essential Oi
3.6. Correlation Analysis
3.7. Cluster Analysis
3.8. Differential Expression of Genes Related to Menthol Biosynthesis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nadeem, S.M.; Ahmad, M.; Zahir, Z.A.; Kharal, M.A. Role of Phytohormones in Stress Tolerance of Plants. In Plant, Soil and Microbes; Springer: Berlin/Heidelberg, Germany, 2016; Volume 2, pp. 385–421. [Google Scholar] [CrossRef]
- Zheng, Y.; Wang, X.; Cui, X.; Wang, K.; Wang, Y.; He, Y. Phytohormones Regulate the Abiotic Stress: An Overview of Physiological, Biochemical, and Molecular Responses in Horticultural Crops. Front. Plant Sci. 2023, 13, 1095363. [Google Scholar] [CrossRef]
- Custódio de Moura Gonçalves, F.; de Souza Parreiras, N.; Girotto Campos, F.; Paulo Benetti Mantoan, L.; Sílvia Fernandes Boaro, C. Exogenous Salicylic Acid Modifies Gas Exchange and Biomass Production of Mentha x piperita L. Aust. J. Crop Sci. 2020, 14, 98–107. [Google Scholar] [CrossRef]
- Johnson, R.; Joel, J.M.; Puthur, J.T. Biostimulants: The Futuristic Sustainable Approach for Alleviating Crop Productivity and Abiotic Stress Tolerance. J. Plant Growth Regul. 2024, 43, 659–674. [Google Scholar] [CrossRef]
- Magnabosco, P.; Masi, A.; Shukla, R.; Bansal, V.; Carletti, P. Advancing the impact of plant biostimulants to sustainable agriculture through nanotechnologies. Chem. Biol. Technol. Agric. 2023, 10, 117. [Google Scholar] [CrossRef]
- Altaf, M.A.; Shahid, R.; Kumar, R.; Altaf, M.M.; Kumar, A.; Khan, L.U.; Saqib, M.; Nawaz, M.A.; Saddiq, B.; Bahadur, S.; et al. Phytohormones Mediated Modulation of Abiotic Stress Tolerance and Potential Crosstalk in Horticultural Crops. J. Plant Growth Regul. 2023, 42, 4724–4750. [Google Scholar] [CrossRef]
- Mearaji, H.S.; Ansari, A.; Igdelou, N.K.M.; Lajayer, B.A.; Pessarakli, M. Phytohormones and Abiotic Stresses: Roles of Phytohormones in Plants under Abiotic Stresses. In Handbook of Plant and Crop Physiology; CRC Press: Boca Raton, FL, USA, 2021; pp. 175–213. [Google Scholar] [CrossRef]
- Vaishnav, D.; Chowdhury, P.; Vaishnav, D.; Chowdhury, P. Types and Function of Phytohormone and Their Role in Stress. In Plant Abiotic Stress Responses and Tolerance Mechanisms; IntechOpen: London, UK, 2023. [Google Scholar] [CrossRef]
- Biostimulants for Climate-Smart and Sustainable Agriculture—Frontiers Research Topic. Available online: https://www.frontiersin.org/research-topics/31357/biostimulants-for-climate-smart-and-sustainable-agriculture (accessed on 18 July 2024).
- Mahendran, G.; Rahman, L.U. Ethnomedicinal, Phytochemical and Pharmacological Updates on Peppermint (Mentha × piperita L.)—A Review. Phytother. Res. 2020, 34, 2088–2139. [Google Scholar] [CrossRef]
- Herro, E.; Jacob, S.E. Mentha piperita (Peppermint). Dermatitis 2010, 21, 327–329. [Google Scholar] [CrossRef]
- McKay, D.L.; Blumberg, J.B. A Review of the Bioactivity and Potential Health Benefits of Peppermint Tea (Mentha piperita L.). Phytother. Res. 2006, 20, 619–633. [Google Scholar] [CrossRef]
- Inanoglu, S.; Goksen, G.; Nayik, G.A.; Mozaffari Nejad, A.S. Essential Oils from Lamiaceae Family (Rosemary, Thyme, Mint, Basil). In Essential Oils Extraction, Characterization and Applications; Academic Press: Cambridge, MA, USA, 2023; pp. 309–324. [Google Scholar] [CrossRef]
- Nazar, N.; Howard, C.; Slater, A.; Sgamma, T. Challenges in Medicinal and Aromatic Plants DNA Barcoding—Lessons from the Lamiaceae. Plants 2022, 11, 137. [Google Scholar] [CrossRef]
- Es, I.; Khaneghah, A.M.; Akbariirad, H. Global Regulation of Essential Oils. In Essential Oils in Food Processing: Chemistry, Safety and Applications; Wiley: Hoboken, NJ, USA, 2017; pp. 327–338. [Google Scholar] [CrossRef]
- Sharma, A.; Gumber, K.; Gohain, A.; Bhatia, T.; Sohal, H.S.; Mutreja, V.; Bhardwaj, G. Importance of Essential Oils and Current Trends in Use of Essential Oils (Aroma Therapy, Agrofood, and Medicinal Usage). In Essential Oils Extraction, Characterization and Applications; Academic Press: Cambridge, MA, USA, 2023; pp. 53–83. [Google Scholar] [CrossRef]
- Mollaei, S.; Farnia, P.; Hazrati, S. Essential Oils and Their Constituents. In Essential Oils: Sources, Production and Applications; De Gruyter: Berlin, Germany, 2023; pp. 89–120. [Google Scholar] [CrossRef]
- Daayf, F.; El Hadrami, A.; El-Bebany, A.F.; Henriquez, M.A.; Yao, Z.; Derksen, H.; El-Hadrami, I.; Adam, L.R. Phenolic Compounds in Plant Defense and Pathogen Counter-Defense Mechanisms. Recent Adv. Polyphen. Res. 2012, 3, 191–208. [Google Scholar] [CrossRef]
- Kumar, S.; Abedin, M.M.; Singh, A.K.; Das, S. Role of Phenolic Compounds in Plant-Defensive Mechanisms. Plant Phenolics Sustain. Agric. 2020, 1, 517–532. [Google Scholar] [CrossRef]
- Pandey, A.; Sharma, M.; Pandey, G.K. Emerging Roles of Strigolactones in Plant Responses to Stress and Development. Front. Plant Sci. 2016, 7, 165491. [Google Scholar] [CrossRef]
- Hossain, A.; Raza, A.; Maitra, S.; Asaduzzaman, M.; Islam, M.R.; Hossain, M.J.; Sabagh, A.E.L.; Garai, S.; Mondal, M.; Latef, A.A.H.A.; et al. Strigolactones: A Novel Carotenoid-Derived Phytohormone—Biosynthesis, Transporters, Signalling, and Mechanisms in Abiotic Stress. In Plant Growth Regulators: Signalling under Stress Conditions; Springer: Berlin/Heidelberg, Germany, 2021; pp. 275–303. [Google Scholar] [CrossRef]
- Shukla, P.K.; Haseeb, A.; Sharma, S. Soil Texture, Root Lesion Nematodes, and Yield of Peppermint (Mentha × piperita ). J. Herbs Spices Med. Plants 1998, 6, 1–8. [Google Scholar] [CrossRef]
- Arnon, D.I. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 1949, 24, 1. [Google Scholar] [CrossRef]
- Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the Thiobarbituric Acid-Reactive-Substances Assay for Estimating Lipid Peroxidation in Plant Tissues Containing Anthocyanin and Other Interfering Compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid Determination of Free Proline for Water-Stress Studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Velikova, V.; Yordanov, I.; Edreva, A. Oxidative Stress and Some Antioxidant Systems in Acid Rain-Treated Bean Plants: Protective Role of Exogenous Polyamines. Plant Sci. 2000, 151, 59–66. [Google Scholar] [CrossRef]
- Blainski, A.; Lopes, G.C.; De Mello, J.C.P. Application and Analysis of the Folin Ciocalteu Method for the Determination of the Total Phenolic Content from Limonium brasiliense L. Molecules 2013, 18, 6852–6865. [Google Scholar] [CrossRef] [PubMed]
- Beaudoin-Eagan, L.D.; Thorpe, T.A. Tyrosine and Phenylalanine Ammonia Lyase Activities during Shoot Initiation in Tobacco Callus Cultures. Plant Physiol. 1985, 78, 438–441. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in Vitro. Methods Enzym. 1984, 105, 121–126. [Google Scholar] [CrossRef]
- Amako, K.; Chen, G.X.; Asada, K. Separate Assays Specific for Ascorbate Peroxidase and Guaiacol Peroxidase and for the Chloroplastic and Cytosolic Isozymes of Ascorbate Peroxidase in Plants. Plant Cell Physiol 1994, 35, 497–504. [Google Scholar] [CrossRef]
- Figueiredo, A.C.; Barroso, J.G.; Pedro, L.G.; Scheffer, J.J.C. Factors Affecting Secondary Metabolite Production in Plants: Volatile Components and Essential Oils. Flavour Fragr. J. 2008, 23, 213–226. [Google Scholar] [CrossRef]
- Russo, A.; Formisano, C.; Rigano, D.; Cardile, V.; Arnold, N.A.; Senatore, F. Comparative Phytochemical Profile and Antiproliferative Activity on Human Melanoma Cells of Essential Oils of Three Lebanese Salvia Species. Ind. Crops Prod. 2016, 83, 492–499. [Google Scholar] [CrossRef]
- Adams, R.P. Identification of Essential Oil Components by Gas Chromatography/Quadrupole Mass Spectroscopy; Allured Publishing Corporation: Carol Stream, IL, USA, 2001. [Google Scholar]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: BestKeeper—Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Hayat, Q.; Hayat, S.; Irfan, M.; Ahmad, A. Effect of Exogenous Salicylic Acid under Changing Environment: A Review. Environ. Exp. Bot. 2010, 68, 14–25. [Google Scholar] [CrossRef]
- Lv, Z.Y.; Sun, W.J.; Jiang, R.; Chen, J.F.; Ying, X.; Zhang, L.; Chen, W.S. Phytohormones Jasmonic Acid, Salicylic Acid, Gibberellins, and Abscisic Acid are Key Mediators of Plant Secondary Metabolites. World J. Tradit. Chin. Med. 2021, 7, 307–325. [Google Scholar] [CrossRef]
- He, J.; Yao, L.; Pecoraro, L.; Liu, C.; Wang, J.; Huang, L.; Gao, W. Cold stress regulates accumulation of flavonoids and terpenoids in plants by phytohormone, transcription process, functional enzyme, and epigenetics. Crit. Rev. Biotechnol. 2023, 43, 680–697. [Google Scholar] [CrossRef]
- Banerjee, A.; Roychoudhury, A. Strigolactones: Multi-Level Regulation of Biosynthesis and Diverse Responses in Plant Abiotic Stresses. Acta Physiol. Plant 2018, 40, 86. [Google Scholar] [CrossRef]
- Marzec, M.; Muszynska, A.; Gruszka, D. The Role of Strigolactones in Nutrient-Stress Responses in Plants. Int. J. Mol. Sci. 2013, 14, 9286–9304. [Google Scholar] [CrossRef]
- De Cuyper, C.; Fromentin, J.; Yocgo, R.E.; De Keyser, A.; Guillotin, B.; Kunert, K.; Boyer, F.-D.; Goormachtig, S. From lateral root density to nodule number, the strigolactone analog GR24 shapes the root architecture of Medicago truncatula. J. Exp. Bot. 2015, 66, 137–146. [Google Scholar] [CrossRef]
- Al-Babili, S.; Bouwmeester, H.J. Strigolactones, a Novel Carotenoid-Derived Plant Hormone. Annu. Rev. Plant Biol. 2015, 66, 161–186. [Google Scholar] [CrossRef]
- Singh, P.K.; Gautam, S. Role of Salicylic Acid on Physiological and Biochemical Mechanism of Salinity Stress Tolerance in Plants. Acta Physiol. Plant 2013, 35, 2345–2353. [Google Scholar] [CrossRef]
- Vidhyasekaran, P. Plant Hormone Signaling Systems in Plant Innate Immunity; Springer: Berlin/Heidelberg, Germany, 2015; Volume 2. [Google Scholar] [CrossRef]
- Pieterse, C.M.J.; Van Der Does, D.; Zamioudis, C.; Leon-Reyes, A.; Van Wees, S.C.M. Hormonal Modulation of Plant Immunity. Annu. Rev. Cell Dev. Biol. 2012, 28, 489–521. [Google Scholar] [CrossRef] [PubMed]
- Mostofa, M.G.; Li, W.; Nguyen, K.H.; Fujita, M.; Tran, L.S.P. Strigolactones in Plant Adaptation to Abiotic Stresses: An Emerging Avenue of Plant Research. Plant Cell. Environ. 2018, 41, 2227–2243. [Google Scholar] [CrossRef] [PubMed]
- Kapulnik, Y.; Resnick, N.; Mayzlish-Gati, E.; Kaplan, Y.; Wininger, S.; Hershenhorn, J.; Koltai, H. Strigolactones Interact with Ethylene and Auxin in Regulating Root-Hair Elongation in Arabidopsis. J. Exp. Bot. 2011, 62, 2915–2924. [Google Scholar] [CrossRef]
- Kapulnik, Y.; Delaux, P.M.; Resnick, N.; Mayzlish-Gati, E.; Wininger, S.; Bhattacharya, C.; Séjalon-Delmas, N.; Combier, J.P.; Bécard, G.; Belausov, E.; et al. Strigolactones Affect Lateral Root Formation and Root-Hair Elongation in Arabidopsis. Planta 2011, 233, 209–216. [Google Scholar] [CrossRef] [PubMed]
- Großkinsky, D.K.; Van Der Graaff, E.; Roitsch, T. Regulation of Abiotic and Biotic Stress Responses by Plant Hormones. In Plant Pathogen Resistance Biotechnology; Wiley: Hoboken, NJ, USA, 2016; pp. 131–154. [Google Scholar] [CrossRef]
- Dikilitas, M.; Simsek, E.; Roychoudhury, A. Modulation of Abiotic Stress Tolerance through Hydrogen Peroxide. In Protective Chemical Agents in the Amelioration of Plant Abiotic Stress: Biochemical and Molecular Perspectives; Wiley: Hoboken, NJ, USA, 2020; pp. 147–173. [Google Scholar] [CrossRef]
- Alvi, A.F.; Sehar, Z.; Fatma, M.; Masood, A.; Khan, N.A.; Mostofa, G.; Saha, G.; Choudhury, R.; Van Ha, C.; Alvi, A.F.; et al. Strigolactone: An Emerging Growth Regulator for Developing Resilience in Plants. Plants 2022, 11, 2604. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Jin, S. Melatonin Interaction with Other Phytohormones in the Regulation of Abiotic Stresses in Horticultural Plants. Antioxidants 2024, 13, 663. [Google Scholar] [CrossRef]
- Souri, Z.; Karimi, N.; Farooq, M.A.; Akhtar, J. Phytohormonal Signaling under Abiotic Stress. In Plant Life under Changing Environment Responses and Management; Academic Press: Cambridge, MA, USA, 2020; pp. 397–466. [Google Scholar] [CrossRef]
- Sharma, P.; Jha, A.B.; Dubey, R.S. Strigolactones: Coordination with Other Phytohormones and Enhancement of Abiotic Stress Responses. Environ. Exp. Bot. 2024, 223, 105782. [Google Scholar] [CrossRef]
- Kohli, A.; Sreenivasulu, N.; Lakshmanan, P.; Kumar, P.P. The Phytohormone Crosstalk Paradigm Takes Center Stage in Understanding How Plants Respond to Abiotic Stresses. Plant Cell Rep. 2013, 32, 945–957. [Google Scholar] [CrossRef]
- Rivas-San Vicente, M.; Plasencia, J. Salicylic Acid beyond Defence: Its Role in Plant Growth and Development. J. Exp. Bot. 2011, 62, 3321–3338. [Google Scholar] [CrossRef] [PubMed]
- Ejaz, S.; Fahad, S.; Anjum, M.A.; Nawaz, A.; Naz, S.; Hussain, S.; Ahmad, S. Role of Osmolytes in the Mechanisms of Antioxidant Defense of Plants; Springer: Berlin/Heidelberg, Germany, 2020; pp. 95–117. [Google Scholar] [CrossRef]
- Zhou, X.; Tan, Z.; Zhou, Y.; Guo, S.; Sang, T.; Wang, Y.; Shu, S. Physiological Mechanism of Strigolactone Enhancing Tolerance to Low Light Stress in Cucumber Seedlings. BMC Plant Biol. 2022, 22, 30. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Li, C.; Yan, M.; Zhao, Z.; Huang, P.; Wei, L.; Wu, X.; Wang, C.; Liao, W. Strigolactone Is Involved in Nitric Oxide-Enhanced the Salt Resistance in Tomato Seedlings. J. Plant Res. 2022, 135, 337–350. [Google Scholar] [CrossRef]
- Kusajima, M.; Fujita, M.; Soudthedlath, K.; Nakamura, H.; Yoneyama, K.; Nomura, T.; Akiyama, K.; Maruyama-Nakashita, A.; Asami, T.; Nakashita, H. Strigolactones Modulate Salicylic Acid-Mediated Disease Resistance in Arabidopsis thaliana. Int. J. Mol. Sci. 2022, 23, 5246. [Google Scholar] [CrossRef]
- Soleymani, F.; Taheri, H.; Shafeinia, A.R. Relative Expression of Genes of Menthol Biosynthesis Pathway in Peppermint (Mentha piperita L.) after Chitosan, Gibberellic Acid and Methyl Jasmonate Treatments. Russ. J. Plant Physiol. 2017, 64, 59–66. [Google Scholar] [CrossRef]
Mineral Absorbable (mg kg−1) | Texture Loam | OC | EC | PH | |||||
---|---|---|---|---|---|---|---|---|---|
Cd | K | P | N | Silt | Clay | Sand | 0.81 | 1.57 D Sm−1 | 8.2 |
0.5> | 166 | 33.1 | 900 | 24% | 21% | 39% |
Gene | Gene Bank (Accession Number) | Primers | Primer Size (bp) | TM |
---|---|---|---|---|
Pulegone reductase (IPR) | AY300163.1 | F: CACAAGCCCTCATTCCTCTCT | 21 | 60 |
R: CTCTTTCCGCCGCAAAATGT | 20 | |||
Menthofuran synthase (MFS) | AF346833.1 | F: GAGATGTTCATGGCGCTGAC | 20 | 60 |
R: CCACTTCTGCATCGACGCC | 18 | |||
Menthol Dehydrogenase (MDH) | KT796560.1 | F: GGTAAATTGCAACAAAACAACTGG | 24 | 60 |
R: TTCAGCACCTTCAGCTTCAC | 20 | |||
Actin | F: GCTGGATTTGCTGGAGATGATG | 22 | 60 | |
R: TCCATATCATCCCAGTTGCTGAC | 23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jariani, P.; Sabokdast, M.; Moghadam, T.K.; Nabati, F.; Dedicova, B. Modulation of Phytochemical Pathways and Antioxidant Activity in Peppermint by Salicylic Acid and GR24: A Molecular Approach. Cells 2024, 13, 1360. https://doi.org/10.3390/cells13161360
Jariani P, Sabokdast M, Moghadam TK, Nabati F, Dedicova B. Modulation of Phytochemical Pathways and Antioxidant Activity in Peppermint by Salicylic Acid and GR24: A Molecular Approach. Cells. 2024; 13(16):1360. https://doi.org/10.3390/cells13161360
Chicago/Turabian StyleJariani, Parisa, Manijeh Sabokdast, Taraneh Karami Moghadam, Farzaneh Nabati, and Beata Dedicova. 2024. "Modulation of Phytochemical Pathways and Antioxidant Activity in Peppermint by Salicylic Acid and GR24: A Molecular Approach" Cells 13, no. 16: 1360. https://doi.org/10.3390/cells13161360