Functional Analysis of Human GBA1 Missense Mutations in Drosophila: Insights into Gaucher Disease Pathogenesis and Phenotypic Consequences
Abstract
:1. Introduction
2. Materials and Methods
2.1. Antibodies
2.2. Plasmids Construction
2.3. Fly Strains
2.4. Ambroxol Treatment
2.5. Carbobenzoxy-L-Leucyl-L-Leucyl-L-Leucinal (MG-132) Treatment
2.6. Endoglycosidase-H (Endo-H) Assay
2.7. GCase Activity Assay
2.8. Total Lipid Extraction
2.9. Lysotracker Staining and Confocal Imaging
2.10. SDS-PAGE and Western Blotting
2.11. RNA Preparation
2.12. cDNA Preparation
2.13. Quantitative Real-Time PCR
2.14. Climbing Assay
2.15. Survival Assay
2.16. Molecular Dynamics Simulation for Ambroxol Binding
2.17. Quantification
2.18. Statistics
3. Results
3.1. GCase Activity and Substrate Accumulation in the Gba1bD370S/D370S and Gba1bL444P/L444P Lines
3.2. Altered Lysosomal Morphologies in Mutant Flies
3.3. ER Retention and ERAD of the Mutant Gba1b Variants and Activation of UPR
3.4. Activation of Inflammation in the Mutant Flies
3.5. Neurodegeneration and Decreased Lifespan in the Mutant Flies
3.6. Partial Rescue of the Mutant-Gba1b Phenotype by Ambroxol
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brady, R.O.; Kanfer, J.N.; Shapiro, D. Metabolism of glucocerebrosides II. Evidence of an enzymatic deficiency in Gaucher’s disease. Biochem. Biophys. Res. Commun. 1965, 18, 221–225. [Google Scholar] [CrossRef]
- Nilsson, O.; Svennerholm, L. Accumulation of Glucosylceramide and Glucosylsphingosine (Psychosine) in Cerebrum and Cerebellum in Infantile and Juvenile Gaucher Disease. J. Neurochem. 1982, 39, 709–718. [Google Scholar] [CrossRef]
- Raghavan, S.S.; Mumford, R.A.; Kanfer, J.N. Deficiency of glucosylsphingosine: -Glucosidase in Gaucher disease. Biochem. Biophys. Res. Commun. 1973, 54, 256–263. [Google Scholar] [CrossRef]
- Orvisky, E.; Sidransky, E.; McKinney, C.E.; LaMarca, M.E.; Samimi, R.; Krasnewich, D.; Martin, B.M.; Ginns, E.I. Glucosylsphingosine Accumulation in Mice and Patients with Type 2 Gaucher Disease Begins Early in Gestation. Pediatr. Res. 2000, 48, 233–237. [Google Scholar] [CrossRef]
- Dekker, N.; van Dussen, L.; Hollak, C.E.M.; Overkleeft, H.; Scheij, S.; Ghauharali, K.; van Breemen, M.J.; Ferraz, M.J.; Groener, J.E.M.; Maas, M.; et al. Elevated plasma glucosylsphingosine in Gaucher disease: Relation to phenotype, storage cell markers, and therapeutic response. Blood 2011, 118, e118–e127. [Google Scholar] [CrossRef]
- Brady, R.O.; Barton, N.W.; Grabowski, G.A. The Role of Neurogenetics in Gaucher Disease. Arch. Neurol. 1993, 50, 1212–1224. [Google Scholar] [CrossRef]
- Tsuji, S.; Martin, B.M.; Barranger, J.A.; Stubblefield, B.K.; LaMarca, M.E.; Ginns, E.I. Genetic heterogeneity in type 1 Gaucher disease: Multiple genotypes in Ashkenazic and non-Ashkenazic individuals. Proc. Natl. Acad. Sci. USA 1988, 85, 2349–2352. [Google Scholar] [CrossRef]
- Tsuji, S.; Choudary, P.V.; Martin, B.M.; Stubblefield, B.K.; Mayor, J.A.; Barranger, J.A.; Ginns, E.I. A Mutation in the Human Glucocerebrosidase Gene in Neuronopathic Gaucher’s Disease. N. Engl. J. Med. 1987, 316, 570–575. [Google Scholar] [CrossRef]
- Wong, K.; Sidransky, E.; Verma, A.; Mixon, T.; Sandberg, G.D.; Wakefield, L.K.; Morrison, A.; Lwin, A.; Colegial, C.; Allman, J.M.; et al. Neuropathology provides clues to the pathophysiology of Gaucher disease. Mol. Genet. Metab. 2004, 82, 192–207. [Google Scholar] [CrossRef]
- Erickson, A.H.; Ginns, E.I.; Barranger, J.A. Biosynthesis of the lysosomal enzyme glucocerebrosidase. J. Biol. Chem. 1985, 260, 14319–14324. [Google Scholar] [CrossRef]
- Rijnboutt, S.; Aerts, H.M.; Geuze, H.J.; Tager, J.M.; Strous, G.J. Mannose 6-phosphate-independent membrane association of cathepsin D, glucocerebrosidase, and sphingolipid-activating protein in HepG2 cells. J. Biol. Chem. 1991, 266, 4862–4868. [Google Scholar] [CrossRef]
- Ron, I.; Horowitz, M. ER retention and degradation as the molecular basis underlying Gaucher disease heterogeneity. Hum. Mol. Genet. 2005, 14, 2387–2398. [Google Scholar] [CrossRef]
- Hoseki, J.; Ushioda, R.; Nagata, K. Mechanism and components of endoplasmic reticulum-associated degradation. J. Biochem. 2009, 147, 19–25. [Google Scholar] [CrossRef]
- Poothong, J.; Jang, I.; Kaufman, R.J. Defects in Protein Folding and/or Quality Control Cause Protein Aggregation in the Endoplasmic Reticulum. Prog. Mol. Subcell Biol. 2021, 59, 115–143. [Google Scholar] [CrossRef]
- Schröder, M. The Unfolded Protein Response. Mol. Biotechnol. 2006, 34, 279–290. [Google Scholar] [CrossRef]
- Kaufman, R.J.; Back, S.H.; Song, B.; Han, J.; Hassler, J. The unfolded protein response is required to maintain the integrity of the endoplasmic reticulum, prevent oxidative stress and preserve differentiation in β-cells. Diabetes Obes. Metab. 2010, 12, 99–107. [Google Scholar] [CrossRef]
- Walter, P.; Ron, D. The Unfolded Protein Response: From Stress Pathway to Homeostatic Regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef]
- de la Mata, M.; Cotán, D.; Oropesa-Ávila, M.; Garrido-Maraver, J.; Cordero, M.D.; Paz, M.V.; Pavón, A.D.; Alcocer-Gómez, E.; de Lavera, I.; Ybot-González, P.; et al. Pharmacological Chaperones and Coenzyme Q10 Treatment Improves Mutant β-Glucocerebrosidase Activity and Mitochondrial Function in Neuronopathic Forms of Gaucher Disease. Sci. Rep. 2015, 5, 10903. [Google Scholar] [CrossRef]
- Sawkar, A.R.; Cheng, W.-C.; Beutler, E.; Wong, C.-H.; Balch, W.E.; Kelly, J.W. Chemical chaperones increase the cellular activity of N370S β-glucosidase: A therapeutic strategy for Gaucher disease. Proc. Natl. Acad. Sci. USA 2002, 99, 15428–15433. [Google Scholar] [CrossRef]
- Yu, Z.; Sawkar, A.R.; Kelly, J.W. Pharmacologic chaperoning as a strategy to treat Gaucher disease. FEBS J. 2007, 274, 4944–4950. [Google Scholar] [CrossRef]
- Maegawa, G.H.B.; Tropak, M.B.; Buttner, J.D.; Rigat, B.A.; Fuller, M.; Pandit, D.; Tang, L.; Kornhaber, G.J.; Hamuro, Y.; Clarke, J.T.R.; et al. Identification and Characterization of Ambroxol as an Enzyme Enhancement Agent for Gaucher Disease. J. Biol. Chem. 2009, 284, 23502–23516. [Google Scholar] [CrossRef]
- Bendikov-Bar, I.; Maor, G.; Filocamo, M.; Horowitz, M. Ambroxol as a pharmacological chaperone for mutant glucocerebrosidase. Blood Cells Mol. Dis. 2012, 50, 141–145. [Google Scholar] [CrossRef]
- Migdalska-Richards, A.; Daly, L.; Bezard, E.; Schapira, A.H.V. Ambroxol effects in glucocerebrosidase and α-synuclein transgenic mice. Ann. Neurol. 2016, 80, 766–775. [Google Scholar] [CrossRef]
- Luan, Z.; Li, L.; Higaki, K.; Nanba, E.; Suzuki, Y.; Ohno, K. The chaperone activity and toxicity of ambroxol on Gaucher cells and normal mice. Brain Dev. 2012, 35, 317–322. [Google Scholar] [CrossRef]
- Migdalska-Richards, A.; Ko, W.K.D.; Li, Q.; Bezard, E.; Schapira, A.H.V. Oral ambroxol increases brain glucocerebrosidase activity in a nonhuman primate. Synapse 2017, 71, e21967. [Google Scholar] [CrossRef]
- Maor, G.; Cabasso, O.; Krivoruk, O.; Rodriguez, J.; Steller, H.; Segal, D.; Horowitz, M. The contribution of mutant GBA to the development of Parkinson disease in Drosophila. Hum. Mol. Genet. 2016, 25, 2712–2727. [Google Scholar] [CrossRef]
- Narita, A.; Shirai, K.; Itamura, S.; Matsuda, A.; Ishihara, A.; Matsushita, K.; Fukuda, C.; Kubota, N.; Takayama, R.; Shigematsu, H.; et al. Ambroxol chaperone therapy for neuronopathic Gaucher disease: A pilot study. Ann. Clin. Transl. Neurol. 2016, 3, 200–215. [Google Scholar] [CrossRef]
- Ramadža, D.P.; Zekušić, M.; Žigman, T.; Škaričić, A.; Bogdanić, A.; Mustać, G.; Bošnjak-Nađ, K.; Ozretić, D.; Ohno, K.; Fumić, K.; et al. Early initiation of ambroxol treatment diminishes neurological manifestations of type 3 Gaucher disease: A long-term outcome of two siblings. Eur. J. Paediatr. Neurol. 2021, 32, 66–72. [Google Scholar] [CrossRef]
- Zhang, P.; Zheng, M.-F.; Cui, S.-Y.; Zhang, W.; Gao, R.-P. Ambroxol Chaperone Therapy for Gaucher Disease Type I-Associated Liver Cirrhosis and Portal Hypertension: A Case Report. Endocr. Metab. Immune Disord.—Drug Targets 2022, 22, 658–662. [Google Scholar] [CrossRef]
- Aries, C.; Lohmöller, B.; Tiede, S.; Täuber, K.; Hartmann, G.; Rudolph, C.; Muschol, N. Promising Effect of High Dose Ambroxol Treatment on Neurocognition and Motor Development in a Patient With Neuropathic Gaucher Disease 2. Front. Neurol. 2022, 13, 907317. [Google Scholar] [CrossRef]
- Zhan, X.; Zhang, H.; Maegawa, G.H.B.; Wang, Y.; Gao, X.; Wang, D.; Li, J. Use of Ambroxol as Therapy for Gaucher Disease. JAMA Netw. Open 2023, 6, e2319364. [Google Scholar] [CrossRef]
- Istaiti, M.; Frydman, D.; Dinur, T.; Szer, J.; Revel-Vilk, S.; Zimran, A. High-Dose Ambroxol Therapy in Type 1 Gaucher Disease Focusing on Patients with Poor Response to Enzyme Replacement Therapy or Substrate Reduction Therapy. Int. J. Mol. Sci. 2023, 24, 6732. [Google Scholar] [CrossRef]
- Suzuki, M.; Fujikake, N.; Takeuchi, T.; Kohyama-Koganeya, A.; Nakajima, K.; Hirabayashi, Y.; Wada, K.; Nagai, Y. Glucocerebrosidase deficiency accelerates the accumulation of proteinase K-resistant α-synuclein and aggravates neurodegeneration in a Drosophila model of Parkinson’s disease. Hum. Mol. Genet. 2015, 24, 6675–6686. [Google Scholar] [CrossRef]
- Davis, M.Y.; Trinh, K.; Thomas, R.E.; Yu, S.; Germanos, A.A.; Whitley, B.N.; Sardi, S.P.; Montine, T.J.; Pallanck, L.J. Glucocerebrosidase Deficiency in Drosophila Results in α-Synuclein-Independent Protein Aggregation and Neurodegeneration. PLoS Genet. 2016, 12, e1005944. [Google Scholar] [CrossRef]
- Kinghorn, K.J.; Grönke, S.; Castillo-Quan, J.I.; Woodling, N.S.; Li, L.; Sirka, E.; Gegg, M.; Mills, K.; Hardy, J.; Bjedov, I.; et al. A Drosophila Model of Neuronopathic Gaucher Disease Demonstrates Lysosomal-Autophagic Defects and Altered mTOR Signalling and Is Functionally Rescued by Rapamycin. J. Neurosci. 2016, 36, 11654–11670. [Google Scholar] [CrossRef]
- Kawasaki, H.; Suzuki, T.; Ito, K.; Takahara, T.; Goto-Inoue, N.; Setou, M.; Sakata, K.; Ishida, N. Minos-insertion mutant of the Drosophila GBA gene homologue showed abnormal phenotypes of climbing ability, sleep and life span with accumulation of hydroxy-glucocerebroside. Gene 2017, 614, 49–55. [Google Scholar] [CrossRef]
- Cabasso, O.; Paul, S.; Dorot, O.; Maor, G.; Krivoruk, O.; Pasmanik-Chor, M.; Mirzaian, M.; Ferraz, M.; Aerts, J.; Horowitz, M. Drosophila melanogaster Mutated in its GBA1b Ortholog Recapitulates Neuronopathic Gaucher Disease. J. Clin. Med. 2019, 8, 1420. [Google Scholar] [CrossRef]
- Jewett, K.A.; Thomas, R.E.; Phan, C.Q.; Lin, B.; Milstein, G.; Yu, S.; Bettcher, L.F.; Neto, F.C.; Djukovic, D.; Raftery, D.; et al. Glucocerebrosidase reduces the spread of protein aggregation in a Drosophila melanogaster model of neurodegeneration by regulating proteins trafficked by extracellular vesicles. PLoS Genet. 2021, 17, e1008859. [Google Scholar] [CrossRef]
- Atilano, M.L.; Hull, A.; Romila, C.-A.; Adams, M.L.; Wildfire, J.; Ureña, E.; Dyson, M.; Ivan-Castillo-Quan, J.; Partridge, L.; Kinghorn, K.J. Autophagic dysfunction and gut microbiota dysbiosis cause chronic immune activation in a Drosophila model of Gaucher disease. PLoS Genet. 2023, 19, e1011063. [Google Scholar] [CrossRef]
- Tayebi, N.; Cushner, S.R.; Kleijer, W.; Lau, E.K.; Damschroder-Williams, P.J.; Stubblefield, B.K.; Hollander, J.D.; Sidransky, E. Prenatal lethality of a homozygous null mutation in the human glucocerebrosidase gene. Am. J. Med. Genet. 1997, 73, 41–47. [Google Scholar] [CrossRef]
- Carvalho, G.B.; Ja, W.W.; Benzer, S. Non-lethal PCR genotyping of single Drosophila. BioTechniques 2009, 46, 312–314. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Stanley, G.H.S. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Inagaki, H.K.; Kamikouchi, A.; Ito, K. Methods for quantifying simple gravity sensing in Drosophila melanogaster. Nat. Protoc. 2009, 5, 20–25. [Google Scholar] [CrossRef]
- Abraham, M.J.; Murtola, T.; Schulz, R.; Páll, S.; Smith, J.C.; Hess, B.; Lindahl, E. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX 2015, 1, 19–25. [Google Scholar] [CrossRef]
- Meivar-Levy, I.; Horowitz, M.; Futerman, A.H. Analysis of glucocerebrosidase activity using N-(1-[14C]hexanoyl)-d-erythro-glucosylsphingosine demonstrates a correlation between levels of residual enzyme activity and the type of Gaucher disease. Biochem. J. 1994, 303, 377–382. [Google Scholar] [CrossRef]
- Kok, J.W.; Babia, T.; Klappe, K.; Hoekstra, D. Fluorescent, short-chain C6-NBD-sphingomyelin, but not C6-NBD-glucosylceramide, is subject to extensive degradation in the plasma membrane: Implications for signal transduction related to cell differentiation. Biochem. J. 1995, 309, 905–912. [Google Scholar] [CrossRef]
- Farfel-Becker, T.; Vitner, E.B.; Kelly, S.L.; Bame, J.R.; Duan, J.; Shinder, V.; Merrill, A.H., Jr.; Dobrenis, K.; Futerman, A.H. Neuronal accumulation of glucosylceramide in a mouse model of neuronopathic Gaucher disease leads to neurodegeneration. Hum. Mol. Genet. 2013, 23, 843–854. [Google Scholar] [CrossRef]
- Heyworth, R.; Dahlqvist, A. Pig intestinal β-glucosidase activities II. Evidence for the hydrolysis of 4-methylumbellifery β-d-glucoside and β-d-galactoside at the same enzyme site. Biochim. Biophys. Acta 1962, 64, 182–184. [Google Scholar] [CrossRef]
- Economos, A.; Lints, F. Developmental Temperature and Life Span in Drosophila melanogaster. Gerontology 1986, 32, 18–27. [Google Scholar] [CrossRef]
- Chen, J.; Nolte, V.; Schlötterer, C. Temperature Stress Mediates Decanalization and Dominance of Gene Expression in Drosophila melanogaster. PLoS Genet. 2015, 11, e1004883. [Google Scholar] [CrossRef]
- Maor, G.; Rencus-Lazar, S.; Filocamo, M.; Steller, H.; Segal, D.; Horowitz, M. Unfolded protein response in Gaucher disease: From human to Drosophila. Orphanet J. Rare Dis. 2013, 8, 140. [Google Scholar] [CrossRef]
- Maley, F.; Trimble, R.B.; Tarentino, A.L.; Plummer, T.H., Jr. Characterization of glycoproteins and their associated oligosaccharides through the use of endoglycosidases. Anal. Biochem. 1989, 180, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Trimble, R.B.; Tarentino, A.L. Identification of distinct endoglycosidase (endo) activities in Flavobacterium meningosepticum: Endo F1, endo F2, and endo F3. Endo F1 and endo H hydrolyze only high mannose and hybrid glycans. J. Biol. Chem. 1991, 266, 1646–1651. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Jia, C.; He, F.; Hu, M.; Guo, X.; Zhang, J.; Feng, X. Site-Specific Profiling of N-Glycans in Drosophila melanogaster. Front. Biosci. 2023, 28, 278. [Google Scholar] [CrossRef]
- Braunstein, H.; Maor, G.; Chicco, G.; Filocamo, M.; Zimran, A.; Horowitz, M. UPR activation and CHOP mediated induction of GBA1 transcription in Gaucher disease. Blood Cells Mol. Dis. 2018, 68, 21–29. [Google Scholar] [CrossRef]
- Vallerie, S.N.; Hotamisligil, G.S. The Role of JNK Proteins in Metabolism. Sci. Transl. Med. 2010, 2, 60rv5. [Google Scholar] [CrossRef]
- Stöven, S.; Ando, I.; Kadalayil, L.; Engström, Y.; Hultmark, D. Activation of the Drosophila NF-κB factor Relish by rapid endoproteolytic cleavage. Embo Rep. 2000, 1, 347–352. [Google Scholar] [CrossRef]
- Shaukat, Z.; Liu, D.; Gregory, S. Sterile Inflammation in Drosophila. Mediat. Inflamm. 2015, 2015, 369286. [Google Scholar] [CrossRef]
- Ugur, B.; Chen, K.; Bellen, H.J. Drosophila tools and assays for the study of human diseases. Dis. Models Mech. 2016, 9, 235–244. [Google Scholar] [CrossRef]
- Babajani, G.; Tropak, M.B.; Mahuran, D.J.; Kermode, A.R. Pharmacological chaperones facilitate the post-ER transport of recombinant N370S mutant β-glucocerebrosidase in plant cells: Evidence that N370S is a folding mutant. Mol. Genet. Metab. 2012, 106, 323–329. [Google Scholar] [CrossRef]
- Jung, O.; Patnaik, S.; Marugan, J.; Sidransky, E.; Westbroek, W. Progress and potential of non-inhibitory small molecule chaperones for the treatment of Gaucher disease and its implications for Parkinson disease. Expert Rev. Proteom. 2016, 13, 471–479. [Google Scholar] [CrossRef]
- Beeh, K.M.; Beier, J.; Esperester, A.; Paul, L.D. Antiinflammatory properties of ambroxol. 2008, 13, 557–562.
- Cabasso, O.; Paul, S.; Maor, G.; Pasmanik-Chor, M.; Kallemeijn, W.; Aerts, J.; Horowitz, M. The Uncovered Function of the Drosophila GBA1a-Encoded Protein. Cells 2021, 10, 630. [Google Scholar] [CrossRef]
- Pokorna, S.; Khersonsky, O.; Lipsh-Sokolik, R.; Goldenzweig, A.; Nielsen, R.; Ashani, Y.; Peleg, Y.; Unger, T.; Albeck, S.; Dym, O.; et al. Design of a stable human acid-β-glucosidase: Towards improved Gaucher disease therapy and mutation classification. FEBS J. 2023, 290, 3383–3399. [Google Scholar] [CrossRef]
- Zhang, X.-H.; Tee, L.Y.; Wang, X.-G.; Huang, Q.-S.; Yang, S.-H. Off-target effects in CRISPR/Cas9-mediated genome engineering. Mol. Ther. Nucleic Acids 2015, 4, e264. [Google Scholar] [CrossRef]
- Xu, Y.-H.; Quinn, B.; Witte, D.; Grabowski, G.A. Viable Mouse Models of Acid β-Glucosidase Deficiency. Am. J. Pathol. 2003, 163, 2093–2101. [Google Scholar] [CrossRef]
- Liu, Y.; Suzuki, K.; Reed, J.D.; Grinberg, A.; Westphal, H.; Hoffmann, A.; Döring, T.; Sandhoff, K.; Proia, R.L. Mice with type 2 and 3 Gaucher disease point mutations generated by a single insertion mutagenesis procedure (SIMP). Proc. Natl. Acad. Sci. USA 1998, 95, 2503–2508. [Google Scholar] [CrossRef]
- Mizukami, H.; Mi, Y.; Wada, R.; Kono, M.; Yamashita, T.; Liu, Y.; Werth, N.; Sandhoff, R.; Sandhoff, K.; Proia, R.L. Systemic inflammation in glucocerebrosidase-deficient mice with minimal glucosylceramide storage. J. Clin. Investig. 2002, 109, 1215–1221. [Google Scholar] [CrossRef]
Name | Primers for Plasmid Construction |
---|---|
L444P Gba1b | F: 5′–CCCTTCACCCAGCCGAGTGTTGTTGGCTTCCAGCGACC–3′ R: 5′–GGTCGCTGGAAGCCAACAACATCGGCTGGGTGAAGGG-3′ |
D370S Gba1b | F: 5′–GGCCTATACCCAGTCTCTGACGCACAACTTCAACGG–3′ R: 5′–CCGTTGAAGTTGTGCGTCAGAGACTGGGTATAGGCC-3′ |
Donor Construct | A 2741 bp fragment of the fly Gba1b gene in pUC57 |
sgRNA 1 | gaaacgtgatcgatggccagtgg |
sgRNA 2 | atattggtccaaatgtagggtgg |
Name | Primers for Plasmid Construction |
---|---|
Gba1b | F: 5′–GCTATCTGGCTGAACGACAATCTG–3′ R: 5′–CCATTGTAGATTATCAACGCCACAC-3′ |
Name | Primers for qRT-PCR |
---|---|
rp49 | F: 5′-TAAGAAGCGCACAAAGCACT-3′ R: 5′-GGGCATCAGATATTGTCCCT-3′ |
HSc-70-3 | F: 5′-GCTGGTGTTATTGCCGGTCTGC-3′ R: 5′-GATGCCTCGGGATGGTTCCTTGC-3′ |
Atf4 | F: 5′-AGACGCTGCTTCGCTTCCTTC-3′ R: 5′-GCCCGTAAGTGCGAGTACGCT-3′ |
Atf6 | F: 5′-CGTAATTCCACGGAAGCCCAAC-3′ R: 5′-CGACGGTAGCTTGATTTCTAGAGCC-3′ |
sXbp1 | F: 5′-CCGAACTGAAGCAGCAACAGC-3′ R: 5′-GTATACCCTGCGGCAGATCC-3′ |
Attc | F: 5′-CTGCACTGGACTACTCCCACATCA-3′ R: 5′-CGATCCTGCGACTGCCAAAGATTG-3′ |
Cec | F: 5′-CATTGGACAATCGGAAGCTGGGTG-3′ R: 5′-TAATCATCGTGGTCAACCTCGGGC-3′ |
Drs | F: 5′-AGTACTTGTTCGCCCTCTTCGCTG-3′ R: 5′-CCTTGTATCTTCCGGACAGGCAGT-3′ |
Mtk | F: 5′-CATCAATCAATTCCCGCCACCGAG-3′ R: 5′-AAATGGGTCCCTGGTGACGATGAG-3′ |
Loops | Human GBA1 | Drosophila Gba1b |
---|---|---|
Loop A | 243–249 | 300–315 |
Loop B | 310–312 | 379–386 |
Loop C | 386–400 | 452–467 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuppuramalingam, A.; Cabasso, O.; Horowitz, M. Functional Analysis of Human GBA1 Missense Mutations in Drosophila: Insights into Gaucher Disease Pathogenesis and Phenotypic Consequences. Cells 2024, 13, 1619. https://doi.org/10.3390/cells13191619
Kuppuramalingam A, Cabasso O, Horowitz M. Functional Analysis of Human GBA1 Missense Mutations in Drosophila: Insights into Gaucher Disease Pathogenesis and Phenotypic Consequences. Cells. 2024; 13(19):1619. https://doi.org/10.3390/cells13191619
Chicago/Turabian StyleKuppuramalingam, Aparna, Or Cabasso, and Mia Horowitz. 2024. "Functional Analysis of Human GBA1 Missense Mutations in Drosophila: Insights into Gaucher Disease Pathogenesis and Phenotypic Consequences" Cells 13, no. 19: 1619. https://doi.org/10.3390/cells13191619