TMEM206 Contributes to Cancer Hallmark Functions in Colorectal Cancer Cells and Is Regulated by p53 in a p21-Dependent Manner
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Transfection
2.3. CRISPR Cas9 KO
2.4. Quantitative Real-Time PCR
2.5. Electrophysiology
2.6. Acid-Induced Cell Death Assay
2.7. Proliferation Assay
2.8. Migration Assay
2.9. Luciferase Assay
2.10. TMEM206 Expression in Human Primary Colorectal Cancer Samples
2.11. Western Blot
2.12. Statistical Analysis
3. Results
3.1. TMEM206 mRNA Expression Is Increased in Human Primary Colorectal Cancer and p53 Knockout Increases TMEM206-Mediated Currents
3.2. Overexpression of p53 Reduces TMEM206-Mediated Currents in HCT116 p53 KO and LNCaP Cells
3.3. TMEM206 Knockout Increases Acid-Induced Cell Death Dependent on p53 Expression
3.4. TMEM206 Knockout Decreases the Cancer Hallmark Functions Including Proliferation and Migration
3.5. p53-Mediated Repression of TMEM206 Dependent on p21
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Anderson, N.M.; Simon, M.C. The Tumor Microenvironment. Curr. Biol. 2020, 30, R921–R925. [Google Scholar] [CrossRef] [Scilit]
- Barba, I.; Carrillo-Bosch, L.; Seoane, J. Targeting the Warburg Effect in Cancer: Where Do We Stand? Int. J. Mol. Sci. 2024, 25, 3142. [Google Scholar] [CrossRef] [Scilit]
- Boedtkjer, E.; Pedersen, S.F. The Acidic Tumor Microenvironment as a Driver of Cancer. Annu. Rev. Physiol. 2020, 82, 103–126. [Google Scholar] [CrossRef] [Scilit]
- Dai, G.; Doisy, E.A. Signaling by Ion Channels: Pathways, Dynamics and Channelopathies. Mo. Med. 2023, 120, 367. [Google Scholar]
- Bell, D.C.; Leanza, L.; Gentile, S.; Sauter, D.R. News and Views on Ion Channels in Cancer: Is Cancer a Channelopathy? Front. Pharmacol. 2023, 14, 1258933. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.Y.; Shimizu, T.; Numata, T.; Okada, Y. Role of Acid-Sensitive Outwardly Rectifying Anion Channels in Acidosis-Induced Cell Death in Human Epithelial Cells. Pflug. Arch. 2007, 454, 223–233. [Google Scholar] [CrossRef] [Scilit]
- Lambert, S.; Oberwinkler, J. Characterization of a Proton-Activated, Outwardly Rectifying Anion Channel. J. Physiol. 2005, 567, 191–213. [Google Scholar] [CrossRef] [Scilit]
- Jentsch, T.J.; Pusch, M. CLC Chloride Channels and Transporters: Structure, Function, Physiology, and Disease. Physiol. Rev. 2018, 98, 1493–1590. [Google Scholar] [CrossRef] [Scilit]
- Jentsch, T.J.; Stein, V.; Weinreich, F.; Zdebik, A.A. Molecular Structure and Physiological Function of Chloride Channels. Physiol. Rev. 2002, 82, 503–568. [Google Scholar] [CrossRef] [Scilit]
- Ullrich, F.; Blin, S.; Lazarow, K.; Daubitz, T.; von Kries, J.P.; Jentsch, T.J. Identification of TMEM206 Proteins as Pore of PAORAC/ASOR Acid-Sensitive Chloride Channels. eLife 2019, 8, e49187. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Chen, J.; Del Carmen Vitery, M.; Osei-Owusu, J.; Chu, J.; Yu, H.; Sun, S.; Qiu, Z. PAC, an Evolutionarily Conserved Membrane Protein, Is a Proton-Activated Chloride Channel. Science 2019, 364, 395–399. [Google Scholar] [CrossRef] [Scilit]
- Pissas, K.P.; Gründer, S.; Tian, Y. Functional Expression of the Proton Sensors ASIC1a, TMEM206, and OGR1 Together with BKCa Channels Is Associated with Cell Volume Changes and Cell Death under Strongly Acidic Conditions in DAOY Medulloblastoma Cells. Pflug. Arch. 2024, 476, 923–937. [Google Scholar] [CrossRef] [Scilit]
- Osei-Owusu, J.; Yang, J.; Del Carmen Vitery, M.; Tian, M.; Qiu, Z. PAC Proton-Activated Chloride Channel Contributes to Acid-Induced Cell Death in Primary Rat Cortical Neurons. Channels 2020, 14, 53–58. [Google Scholar] [CrossRef] [Scilit]
- Osei-Owusu, J.; Yang, J.; Leung, K.H.; Ruan, Z.; Lü, W.; Krishnan, Y.; Qiu, Z. Proton-Activated Chloride Channel PAC Regulates Endosomal Acidification and Transferrin Receptor-Mediated Endocytosis. Cell Rep. 2021, 34, 108683. [Google Scholar] [CrossRef] [Scilit]
- Zeziulia, M.; Blin, S.; Schmitt, F.W.; Lehmann, M.; Jentsch, T.J. Proton-Gated Anion Transport Governs Macropinosome Shrinkage. Nat. Cell Biol. 2022, 24, 885–895. [Google Scholar] [CrossRef] [Scilit]
- Andrieux, G.; Busch, H.; Boerries, M. ColoCare Project: Gene Expression Analysis in Colorectal Cancer and Adjacent Mucosa Tissues. Available online: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse106582 (accessed on 5 June 2024).
- Kappel, S.; Melek, K.; Ross-Kaschitza, D.; Hauert, B.; Gerber, C.E.; Lochner, M.; Peinelt, C. CBA (4-Chloro-2-(2-Chlorophenoxy)Acetamido) Benzoic Acid Inhibits TMEM206 Mediated Currents and TMEM206 Does Not Contribute to Acid-Induced Cell Death in Colorectal Cancer Cells. Front. Pharmacol. 2024, 15, 1369513. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Liu, S.Y.I.; Yang, X.; Wang, Y.Q.; Cheng, Y.X. TMEM206 Is a Potential Prognostic Marker of Hepatocellular Carcinoma. Oncol. Lett. 2020, 20, 174. [Google Scholar] [CrossRef] [Scilit]
- Song, L.; Feng, D.; Tan, J.; Zhang, H. Effects of TMEM206 on the Malignant Behavior of HepG2 Human Hepatocellular Carcinoma Cells. Eur. J. Inflamm. 2022, 20, 1721727X221122724. [Google Scholar] [CrossRef] [Scilit]
- Peng, F.; Li, H.; Li, J.; Wang, Z. Downregulation of the Proton-Activated Cl-Channel TMEM206 Inhibits Malignant Properties of Human Osteosarcoma Cells. Oxid. Med. Cell. Longev. 2021, 2021, 3672112. [Google Scholar] [CrossRef] [Scilit]
- Bouaoun, L.; Sonkin, D.; Ardin, M.; Hollstein, M.; Byrnes, G.; Zavadil, J.; Olivier, M. TP53 Variations in Human Cancers: New Lessons from the IARC TP53 Database and Genomics Data. Hum. Mutat. 2016, 37, 865–876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solomon, H.; Madar, S.; Rotter, V. Mutant P53 Gain of Function Is Interwoven into the Hallmarks of Cancer. J. Pathol. 2011, 225, 475–478. [Google Scholar] [CrossRef] [Scilit]
- Fernandez-Fernandez, M.R.; Sot, B. The Relevance of Protein-Protein Interactions for P53 Function: The CPE Contribution. Protein Eng. Des. Sel. 2011, 24, 41–51. [Google Scholar] [CrossRef] [Scilit]
- El-Deiry, W.S.; Tokino, T.; Velculescu, V.E.; Levy, D.B.; Parsons, R.; Trent, J.M.; Lin, D.; Mercer, W.E.; Kinzler, K.W.; Vogelstein, B.; et al. WAF1, a Potential Mediator of P53 Tumor Suppression. Cell 1993, 75, 817–825. [Google Scholar] [CrossRef] [Scilit]
- Deng, C.; Zhang, P.; Wade Harper, J.; Elledge, S.J.; Leder, P. Mice Lacking P21CIP1/WAF1 Undergo Normal Development, but Are Defective in G1 Checkpoint Control. Cell 1995, 82, 675–684. [Google Scholar] [CrossRef] [Scilit]
- Müller, G.A.; Quaas, M.; Schümann, M.; Krause, E.; Padi, M.; Fischer, M.; Litovchick, L.; DeCaprio, J.A.; Engeland, K. The CHR Promoter Element Controls Cell Cycle-Dependent Gene Transcription and Binds the DREAM and MMB Complexes. Nucleic Acids Res. 2012, 40, 1561–1578. [Google Scholar] [CrossRef] [Scilit]
- Engeland, K. Cell Cycle Regulation: P53-P21-RB Signaling. Cell Death Differ. 2022, 29, 946–960. [Google Scholar] [CrossRef] [Scilit]
- Engeland, K. Cell Cycle Arrest through Indirect Transcriptional Repression by P53: I Have a DREAM. Cell Death Differ. 2018, 25, 114–132. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.; Yu, X.; Xue, L.; Li, S.; Li, J.; Tong, D.; Du, Y. TP53-Associated Ion Channel Genes Serve as Prognostic Predictor and Therapeutic Targets in Head and Neck Squamous Cell Carcinoma. Technol. Cancer Res. Treat. 2020, 19, 153303382097234. [Google Scholar] [CrossRef] [Scilit]
- Ko, J.H.; Ko, E.A.; Gu, W.; Lim, I.; Bang, H.; Zhou, T. Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer. Mol. Cancer 2013, 12, 106. [Google Scholar] [CrossRef] [Scilit]
- Kappel, S.; Ross-Kaschitza, D.; Hauert, B.; Rother, K.; Peinelt, C. P53 Alters Intracellular Ca2+ Signaling through Regulation of TRPM4. Cell Calcium 2022, 104, 102591. [Google Scholar] [CrossRef] [Scilit]
- Concordet, J.P.; Haeussler, M. CRISPOR: Intuitive Guide Selection for CRISPR/Cas9 Genome Editing Experiments and Screens. Nucleic Acids Res. 2018, 46, W242–W245. [Google Scholar] [CrossRef] [Scilit]
- Heigwer, F.; Kerr, G.; Boutros, M. E-CRISP: Fast CRISPR Target Site Identification. Nat. Methods 2014, 11, 122–123. [Google Scholar] [CrossRef] [Scilit]
- Addgene: Zhang Lab CRISPR Page. Available online: https://www.addgene.org/crispr/zhang/ (accessed on 14 December 2021).
- Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Tissue-based map of the human proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef] [Scilit]
- GEO2R-GEO-NCBI. Available online: https://www.ncbi.nlm.nih.gov/geo/geo2r/ (accessed on 17 June 2024).
- Sato-Numata, K.; Numata, T.; Okada, T.; Okada, Y. Acid-Sensitive Outwardly Rectifying (ASOR) Anion Channels in Human Epithelial Cells Are Highly Sensitive to Temperature and Independent of ClC-3. Pflug. Arch. 2013, 465, 1535–1543. [Google Scholar] [CrossRef] [Scilit]
- Rabachini, T.; Fernandez-Marrero, Y.; Montani, M.; Loforese, G.; Sladky, V.; He, Z.; Bachmann, D.; Wicki, S.; Villunger, A.; Stroka, D.; et al. BOK Promotes Chemical-Induced Hepatocarcinogenesis in Mice. Cell Death Differ. 2018, 25, 708–720. [Google Scholar] [CrossRef] [Scilit]
- Mamoor, S. Differential Expression of TMEM206 in Colorectal Cancer. 2024. Available online: https://osf.io/preprints/osf/hmesx (accessed on 5 June 2024).
- Szigeti, K.A.; Kalmár, A.; Galamb, O.; Valcz, G.; Barták, B.K.; Nagy, Z.B.; Zsigrai, S.; Felletár, I.; Patai, Á.V.; Micsik, T.; et al. Global DNA Hypomethylation of Colorectal Tumours Detected in Tissue and Liquid Biopsies May Be Related to Decreased Methyl-Donor Content. BMC Cancer 2022, 22, 605. [Google Scholar] [CrossRef] [Scilit]
- Vaseva, A.V.; Marchenko, N.D.; Ji, K.; Tsirka, S.E.; Holzmann, S.; Moll, U.M. P53 Opens the Mitochondrial Permeability Transition Pore to Trigger Necrosis. Cell 2012, 149, 1536–1548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zirngibl, K.; Moll, U.M. P53 Opens the Mitochondrial Permeability Transition Pore to Trigger Necrosis in Response to Oxidative Damage. In Necrotic Cell Death; Humana Press: New York, NY, USA, 2014; pp. 195–209. [Google Scholar] [CrossRef] [Scilit]
- Fu, Z.J.; Li, X.Z.; Wang, Q.R.; Shi, L.; Zhang, L.Q.; Pan, X.L. Extracellular Acidic PH-Activated, Outward Rectifying Chloride Currents Can Be Regulated by Reactive Oxygen Species in Human THP-1 Monocytes. Biochem. Biophys. Res. Commun. 2013, 432, 701–706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kostritskaia, Y.; Klüssendorf, M.; Pan, Y.E.; Hassani Nia, F.; Kostova, S.; Stauber, T. Physiological Functions of the Volume-Regulated Anion Channel VRAC/LRRC8 and the Proton-Activated Chloride Channel ASOR/TMEM206. Handb. Exp. Pharmacol. 2024, 283, 181–218. [Google Scholar] [CrossRef] [Scilit]
- Damalas, A.; Kahan, S.; Shtutman, M.; Ben-Ze’ev, A.; Oren, M. Deregulated β-Catenin Induces a P53- and ARF-Dependent Growth Arrest and Cooperates with Ras in Transformation. EMBO J. 2001, 20, 4912. [Google Scholar] [CrossRef] [Scilit]
- Singh, B.; Reddy, P.G.; Goberdhan, A.; Walsh, C.; Dao, S.; Ngai, I.; Chou, T.C.; O-charoenrat, P.; Levine, A.J.; Rao, P.H.; et al. P53 Regulates Cell Survival by Inhibiting PIK3CA in Squamous Cell Carcinomas. Genes Dev. 2002, 16, 984. [Google Scholar] [CrossRef] [Scilit]
- Boilly, B.; Vercoutter-Edouart, A.S.; Hondermarck, H.; Nurcombe, V.; Le Bourhis, X. FGF Signals for Cell Proliferation and Migration through Different Pathways. Cytokine Growth Factor Rev. 2000, 11, 295–302. [Google Scholar] [CrossRef] [Scilit]
- Tebaldi, T.; Zaccara, S.; Alessandrini, F.; Bisio, A.; Ciribilli, Y.; Inga, A. Whole-Genome Cartography of P53 Response Elements Ranked on Transactivation Potential. BMC Genom. 2015, 16, 464. [Google Scholar] [CrossRef] [Scilit]
- Bracken, A.P.; Ciro, M.; Cocito, A.; Helin, K. E2F Target Genes: Unraveling the Biology. Trends Biochem. Sci. 2004, 29, 409–417. [Google Scholar] [CrossRef] [Scilit]
- Müller, G.A.; Wintsche, A.; Stangner, K.; Prohaska, S.J.; Stadler, P.F.; Engeland, K. The CHR Site: Definition and Genome-Wide Identification of a Cell Cycle Transcriptional Element. Nucleic Acids Res. 2014, 42, 10331–10350. [Google Scholar] [CrossRef] [Scilit]





| Name | 5′-3′ | Used For |
|---|---|---|
| 363R-fwd | CACCGCCATTGTTCAATATCGTCCG | p53 gRNA sense oligo |
| 363R-rev | AAACCGGACGATATTGAACAATGGC | p53 gRNA antisense oligo |
| 10R-fwd | CACCGTCGACGCTAGGATCTGACTG | p53 gRNA sense oligo |
| 10R-rev | AAACCAGTCAGATCCTAGCGTCGAC | p53 gRNA antisense oligo |
| 92R-fwd | CACCGCCTGAGACCGCCCCAGCCCG | TMEM206 gRNA sense oligo |
| 92R-rev | AAACCGGGCTGGGGCGGTCTCAGGC | TMEM206 gRNA sense oligo |
| 170F-fwd | CACCGGAGCGCTCCACATCCTACC | TMEM206 gRNA sense oligo |
| 170F-rev | AAACGGTAGGATGTGGAGCGCTCC | TMEM206 gRNA sense oligo |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Melek, K.; Hauert, B.; Kappel, S. TMEM206 Contributes to Cancer Hallmark Functions in Colorectal Cancer Cells and Is Regulated by p53 in a p21-Dependent Manner. Cells 2024, 13, 1825. https://doi.org/10.3390/cells13221825
Melek K, Hauert B, Kappel S. TMEM206 Contributes to Cancer Hallmark Functions in Colorectal Cancer Cells and Is Regulated by p53 in a p21-Dependent Manner. Cells. 2024; 13(22):1825. https://doi.org/10.3390/cells13221825
Chicago/Turabian StyleMelek, Korollus, Barbara Hauert, and Sven Kappel. 2024. "TMEM206 Contributes to Cancer Hallmark Functions in Colorectal Cancer Cells and Is Regulated by p53 in a p21-Dependent Manner" Cells 13, no. 22: 1825. https://doi.org/10.3390/cells13221825
APA StyleMelek, K., Hauert, B., & Kappel, S. (2024). TMEM206 Contributes to Cancer Hallmark Functions in Colorectal Cancer Cells and Is Regulated by p53 in a p21-Dependent Manner. Cells, 13(22), 1825. https://doi.org/10.3390/cells13221825

