Inhibition of miR-143-3p Restores Blood–Testis Barrier Function and Ameliorates Sertoli Cell Senescence
Abstract
1. Introduction
2. Materials and Methods
2.1. Ex Vivo Culture of Mouse SCs
2.2. Animals
2.3. Cell Transfection
2.4. Quantitative Real-Time PCR (qRT-PCR)
2.5. Western Blot Assay
2.6. Treatment of SCs with SB431542
2.7. Transepithelial Electrical Resistance (TER) Measurements
2.8. Luciferase Reporter Assay
2.9. β-Gal Staining
2.10. Oil Red O Staining
2.11. EdU Staining
2.12. Biotin-NHS Ester Labeling Assay
2.13. Testicular Injection of miR-143-3p
2.14. Treatment of Mice with SB431542
2.15. Statistical Analysis
3. Results
3.1. Role of miR-143-3p Overexpression in SC Senescence and BTB Dysfunction
3.2. miR-143-3p Promoted the Senescence of SCs by Targets UBE2E3
3.3. miR-143-3p Overexpression in Testis Induced SCs Dysfunction
3.4. Loss of UBE2E3 Induce SCs Senescence
3.5. Loss of UBE2E3 Induced SC Dysfunction
3.6. SB431542 Attenuated Age-Related SC Dysfunction by Inhibiting miR-143-3p and Upregulating UBE2E3
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kovac, J.R.; Addai, J.; Smith, R.P.; Coward, R.M.; Lamb, D.J.; Lipshultz, L.I. The effects of advanced paternal age on fertility. Asian J. Androl. 2013, 15, 723–728. [Google Scholar] [CrossRef] [Scilit]
- Mawhinney, M.; Mariotti, A. Physiology, pathology and pharmacology of the male reproductive system. Periodontol. 2000 2013, 61, 232–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yokonishi, T.; McKey, J.; Ide, S.; Capel, B. Sertoli cell ablation and replacement of the spermatogonial niche in mouse. Nat. Commun. 2020, 11, 40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mital, P.; Hinton, B.T.; Dufour, J.M. The blood-testis and blood-epididymis barriers are more than just their tight junctions. Biol. Reprod. 2011, 84, 851–858. [Google Scholar] [CrossRef] [Scilit]
- Hofmann, M.C.; McBeath, E. Sertoli Cell-Germ Cell Interactions Within the Niche: Paracrine and Juxtacrine Molecular Communications. Front. Endocrinol. 2022, 13, 897062. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, L.B.; Walker, W.H. The regulation of spermatogenesis by androgens. Semin. Cell Dev. Biol. 2014, 30, 2–13. [Google Scholar] [CrossRef] [Scilit]
- Gupta, A.; Vats, A.; Ghosal, A.; Mandal, K.; Sarkar, R.; Bhattacharya, I.; Das, S.; Pal, R.; Majumdar, S.S. Follicle-stimulating hormone-mediated decline in miR-92a-3p expression in pubertal mice Sertoli cells is crucial for germ cell differentiation and fertility. Cell Mol. Life Sci. 2022, 79, 136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Washburn, R.L.; Hibler, T.; Kaur, G.; Dufour, J.M. Sertoli Cell Immune Regulation: A Double-Edged Sword. Front. Immunol. 2022, 13, 913502. [Google Scholar] [CrossRef] [Scilit]
- Jégou, B. The Sertoli cell in vivo and in vitro. Cell Biol. Toxicol. 1992, 8, 49–54. [Google Scholar] [CrossRef] [Scilit]
- Mital, P.; Kaur, G.; Dufour, J.M. Immunoprotective sertoli cells: Making allogeneic and xenogeneic transplantation feasible. Reproduction 2010, 139, 495–504. [Google Scholar] [CrossRef] [Scilit]
- Umeda, K.; Ikenouchi, J.; Katahira-Tayama, S.; Furuse, K.; Sasaki, H.; Nakayama, M.; Matsui, T.; Tsukita, S.; Furuse, M.; Tsukita, S. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell 2006, 126, 741–754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saitoh, Y.; Suzuki, H.; Tani, K.; Nishikawa, K.; Irie, K.; Ogura, Y.; Tamura, A.; Tsukita, S.; Fujiyoshi, Y. Tight junctions. Structural insight into tight junction disassembly by Clostridium perfringens enterotoxin. Science 2015, 347, 775–778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cummins, J.M.; Jequier, A.M.; Kan, R. Molecular biology of human male infertility: Links with aging, mitochondrial genetics, and oxidative stress? Mol. Reprod. Dev. 1994, 37, 345–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nie, X.; Munyoki, S.K.; Sukhwani, M.; Schmid, N.; Missel, A.; Emery, B.R.; DonorConnect; Stukenborg, J.B.; Mayerhofer, A.; Orwig, K.E.; et al. Single-cell analysis of human testis aging and correlation with elevated body mass index. Dev. Cell 2022, 57, 1160–1176.e5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petersen, C.; Soder, O. The sertoli cell—A hormonal target and ‘super’ nurse for germ cells that determines testicular size. Horm. Res. 2006, 66, 153–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, H.; Zhu, W.J.; Li, J.; Chen, Q.J.; Liang, W.B.; Gu, Y.Q. Quantitative histological analysis and ultrastructure of the aging human testis. Int. Urol. Nephrol. 2014, 46, 879–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koksal, I.T.; Ishak, Y.; Usta, M.; Danisman, A.; Guntekin, E.; Bassorgun, I.C.; Ciftcioglu, A. Varicocele-induced testicular dysfunction may be associated with disruption of blood-testis barrier. Arch. Androl. 2007, 53, 43–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.N.; Li, Z.S.; Ren, Y.; Jiang, T.; Wang, Y.Q.; Chen, M.; Zhang, J.; Hao, J.X.; Wang, Y.B.; Sha, R.N.; et al. The Wilms tumor gene, Wt1, is critical for mouse spermatogenesis via regulation of sertoli cell polarity and is associated with non-obstructive azoospermia in humans. PLoS Genet. 2013, 9, e1003645. [Google Scholar] [CrossRef] [Scilit]
- Barnes, P.J.; Baker, J.; Donnelly, L.E. Cellular Senescence as a Mechanism and Target in Chronic Lung Diseases. Am. J. Respir. Crit. Care Med. 2019, 200, 556–564. [Google Scholar] [CrossRef] [Scilit]
- Olivieri, F.; Prattichizzo, F.; Giuliani, A.; Matacchione, G.; Rippo, M.R.; Sabbatinelli, J.; Bonafè, M. miR-21 and miR-146a: The microRNAs of inflammaging and age-related diseases. Ageing Res. Rev. 2021, 70, 101374. [Google Scholar] [CrossRef] [Scilit]
- Vienberg, S.; Geiger, J.; Madsen, S.; Dalgaard, L.T. MicroRNAs in metabolism. Acta Physiol. 2017, 219, 346–361. [Google Scholar] [CrossRef] [Scilit]
- Procópio, M.S.; de Avelar, G.F.; Costa, G.M.J.; Lacerda, S.; Resende, R.R.; de França, L.R. MicroRNAs in Sertoli cells: Implications for spermatogenesis and fertility. Cell Tissue Res. 2017, 370, 335–346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papaioannou, M.D.; Lagarrigue, M.; Vejnar, C.E.; Rolland, A.D.; Kühne, F.; Aubry, F.; Schaad, O.; Fort, A.; Descombes, P.; Neerman-Arbez, M.; et al. Loss of Dicer in Sertoli cells has a major impact on the testicular proteome of mice. Mol. Cell. Proteom. 2011, 10, M900587mcp900200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orth, J.M.; Gunsalus, G.L.; Lamperti, A.A. Evidence from Sertoli cell-depleted rats indicates that spermatid number in adults depends on numbers of Sertoli cells produced during perinatal development. Endocrinology 1988, 122, 787–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.; Yao, C.; Tian, R.; Zhu, Z.; Zhao, L.; Li, P.; Chen, H.; Huang, Y.; Zhi, E.; Gong, Y.; et al. miR-202-3p Regulates Sertoli Cell Proliferation, Synthesis Function, and Apoptosis by Targeting LRP6 and Cyclin D1 of Wnt/β-Catenin Signaling. Mol. Ther. Nucleic Acids 2019, 14, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Yang, B.; Pan, P.; Ma, Q.; Wu, Y.; Zhang, Z.; Guo, X.; Ye, J.; Gui, Y. MicroRNA-130a inhibits spermatogenesis by directly targeting androgen receptor in mouse Sertoli cells. Mol. Reprod. Dev. 2018, 85, 768–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Korhonen, H.M.; Yadav, R.P.; Da Ros, M.; Chalmel, F.; Zimmermann, C.; Toppari, J.; Nef, S.; Kotaja, N. DICER Regulates the Formation and Maintenance of Cell-Cell Junctions in the Mouse Seminiferous Epithelium. Biol. Reprod. 2015, 93, 139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Zeng, H.; Lei, L.; Tong, X.; Yang, L.; Yang, Y.; Li, S.; Zhou, Y.; Luo, L.; Huang, J.; et al. Tight junctions and their regulation by non-coding RNAs. Int. J. Biol. Sci. 2021, 17, 712–727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Chen, D.; Wang, T.; Zhou, J.; Xu, W.; Xiong, H.; Bai, R.; Wu, S.; Li, J.; Li, F. Sertoli cell survival and barrier function are regulated by miR-181c/d-Pafah1b1 axis during mammalian spermatogenesis. Cell Mol. Life Sci. 2022, 79, 498. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Wu, W.; Fan, Y.; Jiang, S.; Jia, X.; Su, W. MiR-142-3p Inhibits TGF-β3-Induced Blood-Testis Barrier Impairment by Targeting Lethal Giant Larvae Homolog 2. Cell Physiol. Biochem. 2018, 46, 253–268. [Google Scholar] [CrossRef] [Scilit]
- Gupta, A.; Mandal, K.; Singh, P.; Sarkar, R.; Majumdar, S.S. Declining levels of miR-382-3p at puberty trigger the onset of spermatogenesis. Mol. Ther. Nucleic Acids 2021, 26, 192–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, J.; Chen, D.; Xiao, Z.; Wei, S.; Liu, Y.; Wang, C.; Wang, Z.; Feng, Y.; Lei, Y.; Hu, M.; et al. Role of miR-300-3p in Leydig cell function and differentiation: A therapeutic target for obesity-related testosterone deficiency. Mol. Ther. Nucleic Acids 2023, 32, 879–895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, J.; Li, H.; Mei, J.; Cao, Z.; Tang, Y.; Huang, R.; Xia, H.; Zhang, Q.; Xiang, Q.; Yang, Y.; et al. Sertoli cell-derived exosome-mediated transfer of miR-145-5p inhibits Leydig cell steroidogenesis by targeting steroidogenic factor 1. FASEB J. 2021, 35, e21660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, J.; Wu, Y.; Ai, Z.; Shi, X.; Chen, L.; Guo, Z. Mechanism of SB431542 in inhibiting mouse embryonic stem cell differentiation. Cell Signal 2014, 26, 2107–2116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janecki, A.; Jakubowiak, A.; Steinberger, A. Regulation of transepithelial electrical resistance in two-compartment Sertoli cell cultures: In vitro model of the blood-testis barrier. Endocrinology 1991, 129, 1489–1496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiong, W.; Wang, H.; Wu, H.; Chen, Y.; Han, D. Apoptotic spermatogenic cells can be energy sources for Sertoli cells. Reproduction 2009, 137, 469–479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stanton, P.G. Regulation of the blood-testis barrier. Semin. Cell Dev. Biol. 2016, 59, 166–173. [Google Scholar] [CrossRef] [Scilit]
- Ruthig, V.A.; Lamb, D.J. Updates in Sertoli Cell-Mediated Signaling During Spermatogenesis and Advances in Restoring Sertoli Cell Function. Front. Endocrinol. 2022, 13, 897196. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, L.; Smith, L.B.; Rebourcet, D. Sertoli cells as key drivers of testis function. Semin. Cell Dev. Biol. 2022, 121, 2–9. [Google Scholar] [CrossRef] [Scilit]
- Santiago, J.; Silva, J.V.; Alves, M.G.; Oliveira, P.F.; Fardilha, M. Testicular Aging: An Overview of Ultrastructural, Cellular, and Molecular Alterations. J. Gerontol. A Biol. Sci. Med. Sci. 2019, 74, 860–871. [Google Scholar] [CrossRef] [Scilit]
- Schrans-Stassen, B.H.; van de Kant, H.J.; de Rooij, D.G.; van Pelt, A.M. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia. Endocrinology 1999, 140, 5894–5900. [Google Scholar] [CrossRef] [PubMed]
- Rossi, P.; Sette, C.; Dolci, S.; Geremia, R. Role of c-kit in mammalian spermatogenesis. J. Endocrinol. Investig. 2000, 23, 609–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mauduit, C.; Hamamah, S.; Benahmed, M. Stem cell factor/c-kit system in spermatogenesis. Hum. Reprod. Update 1999, 5, 535–545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, L.B.; O’Shaughnessy, P.J.; Rebourcet, D. Cell-specific ablation in the testis: What have we learned? Andrology 2015, 3, 1035–1049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van den Driesche, S.; Sharpe, R.M.; Saunders, P.T.; Mitchell, R.T. Regulation of the germ stem cell niche as the foundation for adult spermatogenesis: A role for miRNAs? Semin. Cell Dev. Biol. 2014, 29, 76–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, H.; Tao, T.; Chen, S.; Liang, C.; Qiu, Y.; Zhou, Y.; Zhang, R. MicroRNA-143 promotes cardiac ischemia-mediated mitochondrial impairment by the inhibition of protein kinase Cepsilon. Basic. Res. Cardiol. 2017, 112, 60. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Li, J.; Xue, K.; Zhang, J.; Wang, C.; Zhang, Q.; Chen, X.; Gao, C.; Yu, X.; Sun, L. MicroRNA-143-3p promotes human cardiac fibrosis via targeting sprouty3 after myocardial infarction. J. Mol. Cell. Cardiol. 2019, 129, 281–292. [Google Scholar] [CrossRef] [Scilit]
- Ma, W.Y.; Song, R.J.; Xu, B.B.; Xu, Y.; Wang, X.X.; Sun, H.Y.; Li, S.N.; Liu, S.Z.; Yu, M.X.; Yang, F.; et al. Melatonin promotes cardiomyocyte proliferation and heart repair in mice with myocardial infarction via miR-143-3p/Yap/Ctnnd1 signaling pathway. Acta Pharmacol. Sin. 2021, 42, 921–931. [Google Scholar] [CrossRef] [Scilit]
- Xiong, H.; Ren, S.; Chen, J.; Yang, X.; Liu, Y.; Xu, Z.; Guo, J.; Jiang, T.; Yuan, M.; Liu, Y.; et al. Knockdown of long noncoding RNA SAN rejuvenates aged adipose-derived stem cells via miR-143-3p/ADD3 axis. Stem Cell Res. Ther. 2023, 14, 213. [Google Scholar] [CrossRef] [Scilit]
- Ye, Y.; Rape, M. Building ubiquitin chains: E2 enzymes at work. Nat. Rev. Mol. Cell Biol. 2009, 10, 755–764. [Google Scholar] [CrossRef] [Scilit]
- Plafker, K.S.; Zyla, K.; Berry, W.; Plafker, S.M. Loss of the ubiquitin conjugating enzyme UBE2E3 induces cellular senescence. Redox Biol. 2018, 17, 411–422. [Google Scholar] [CrossRef] [Scilit]
- Kevei, É.; Hoppe, T. Ubiquitin sets the timer: Impacts on aging and longevity. Nat. Struct. Mol. Biol. 2014, 21, 290–292. [Google Scholar] [CrossRef] [Scilit]
- Plafker, K.S.; Farjo, K.M.; Wiechmann, A.F.; Plafker, S.M. The human ubiquitin conjugating enzyme, UBE2E3, is required for proliferation of retinal pigment epithelial cells. Investig. Ophthalmol. Vis. Sci. 2008, 49, 5611–5618. [Google Scholar] [CrossRef] [Scilit]
- Plafker, K.S.; Plafker, S.M. The ubiquitin-conjugating enzyme UBE2E3 and its import receptor importin-11 regulate the localization and activity of the antioxidant transcription factor NRF2. Mol. Biol. Cell 2015, 26, 327–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubben, N.; Zhang, W.; Wang, L.; Voss, T.C.; Yang, J.; Qu, J.; Liu, G.H.; Misteli, T. Repression of the Antioxidant NRF2 Pathway in Premature Aging. Cell 2016, 165, 1361–1374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larabee, C.M.; Georgescu, C.; Wren, J.D.; Plafker, S.M. Expression profiling of the ubiquitin conjugating enzyme UbcM2 in murine brain reveals modest age-dependent decreases in specific neurons. BMC Neurosci. 2015, 16, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freund, A.; Patil, C.K.; Campisi, J. p38MAPK is a novel DNA damage response-independent regulator of the senescence-associated secretory phenotype. EMBO J. 2011, 30, 1536–1548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vousden, K.H.; Prives, C. Blinded by the Light: The Growing Complexity of p53. Cell 2009, 137, 413–431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, D.; Prives, C. Relevance of the p53-MDM2 axis to aging. Cell Death Differ. 2018, 25, 169–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, S.; Sharpless, N.E. Senescence in Health and Disease. Cell 2017, 169, 1000–1011. [Google Scholar] [CrossRef] [Scilit]
- Qin, S.; Schulte, B.A.; Wang, G.Y. Role of senescence induction in cancer treatment. World J. Clin. Oncol. 2018, 9, 180–187. [Google Scholar] [CrossRef] [Scilit]
- Ma, W.; Ding, F.; Wang, X.; Huang, Q.; Zhang, L.; Bi, C.; Hua, B.; Yuan, Y.; Han, Z.; Jin, M.; et al. By Targeting Atg7 MicroRNA-143 Mediates Oxidative Stress-Induced Autophagy of c-Kit(+) Mouse Cardiac Progenitor Cells. eBioMedicine 2018, 32, 182–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, Y.C.; Li, X.H.; Rao, X.; Li, Y.J.; Du, J. Involvement of microRNA/cystine/glutamate transporter in cold-stressed gastric mucosa injury. Front. Pharmacol. 2022, 13, 968098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gan, M.; Jing, Y.; Xie, Z.; Ma, J.; Chen, L.; Zhang, S.; Zhao, Y.; Niu, L.; Wang, Y.; Li, X.; et al. Potential Function of Testicular MicroRNAs in Heat-Stress-Induced Spermatogenesis Disorders. Int. J. Mol. Sci. 2023, 24, 8809. [Google Scholar] [CrossRef] [Scilit]
- Plafker, K.S.; Nguyen, L.; Barneche, M.; Mirza, S.; Crawford, D.; Plafker, S.M. The ubiquitin-conjugating enzyme UbcM2 can regulate the stability and activity of the antioxidant transcription factor Nrf2. J. Biol. Chem. 2010, 285, 23064–23074. [Google Scholar] [CrossRef] [Scilit]
- Huang, Z.; Zhang, D.; Chen, S.C.; Huang, D.; Mackey, D.; Chen, F.K.; McLenachan, S. Mitochondrial Dysfunction and Impaired Antioxidant Responses in Retinal Pigment Epithelial Cells Derived from a Patient with RCBTB1-Associated Retinopathy. Cells 2023, 12, 1358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wendt, F.R.; Pathak, G.A.; Levey, D.F.; Nuñez, Y.Z.; Overstreet, C.; Tyrrell, C.; Adhikari, K.; De Angelis, F.; Tylee, D.S.; Goswami, A.; et al. Sex-stratified gene-by-environment genome-wide interaction study of trauma, posttraumatic-stress, and suicidality. Neurobiol. Stress. 2021, 14, 100309. [Google Scholar] [CrossRef] [Scilit]
- Cheng, C.Y.; Mruk, D.D. The blood-testis barrier and its implications for male contraception. Pharmacol. Rev. 2012, 64, 16–64. [Google Scholar] [CrossRef] [Scilit]
- Li, N.; Wang, T.; Han, D. Structural, cellular and molecular aspects of immune privilege in the testis. Front. Immunol. 2012, 3, 152. [Google Scholar] [CrossRef] [Scilit]
- Pelletier, R.M. The blood-testis barrier: The junctional permeability, the proteins and the lipids. Prog. Histochem. Cytochem. 2011, 46, 49–127. [Google Scholar] [CrossRef] [Scilit]
- Mruk, D.D.; Cheng, C.Y. The Mammalian Blood-Testis Barrier: Its Biology and Regulation. Endocr. Rev. 2015, 36, 564–591. [Google Scholar] [CrossRef] [Scilit]
- Pelletier, R.M.; Byers, S.W. The blood-testis barrier and Sertoli cell junctions: Structural considerations. Microsc. Res. Tech. 1992, 20, 3–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ni, F.D.; Hao, S.L.; Yang, W.X. Multiple signaling pathways in Sertoli cells: Recent findings in spermatogenesis. Cell Death Dis. 2019, 10, 541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lui, W.Y.; Lee, W.M.; Cheng, C.Y. TGF-betas: Their role in testicular function and Sertoli cell tight junction dynamics. Int. J. Androl. 2003, 26, 147–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eto, K.; Shiotsuki, M.; Sakai, T.; Abe, S. Nociceptin is upregulated by FSH signaling in Sertoli cells in murine testes. Biochem. Biophys. Res. Commun. 2012, 421, 678–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Lui, W.Y. Opposite effects of interleukin-1alpha and transforming growth factor-beta2 induce stage-specific regulation of junctional adhesion molecule-B gene in Sertoli cells. Endocrinology 2009, 150, 2404–2412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Q.; You, X.; Zhu, K.; Zhao, X.; Yuan, D.; Wang, T.; Dun, Y.; Wu, J.; Ren, D.; Zhang, C.; et al. Changes in the tight junctions of the testis during aging: Role of the p38 MAPK/MMP9 pathway and autophagy in Sertoli cells. Exp. Gerontol. 2022, 161, 111729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paul, C.; Robaire, B. Impaired function of the blood-testis barrier during aging is preceded by a decline in cell adhesion proteins and GTPases. PLoS ONE 2013, 8, e84354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avalle, L.; Incarnato, D.; Savino, A.; Gai, M.; Marino, F.; Pensa, S.; Barbieri, I.; Stadler, M.B.; Provero, P.; Oliviero, S.; et al. MicroRNAs-143 and -145 induce epithelial to mesenchymal transition and modulate the expression of junction proteins. Cell Death Differ. 2017, 24, 1750–1760. [Google Scholar] [CrossRef] [Scilit]
- Du, X.; Zhang, L.; Li, X.; Pan, Z.; Liu, H.; Li, Q. TGF-β signaling controls FSHR signaling-reduced ovarian granulosa cell apoptosis through the SMAD4/miR-143 axis. Cell Death Dis. 2016, 7, e2476. [Google Scholar] [CrossRef] [Scilit]
- Inman, G.J.; Nicolás, F.J.; Callahan, J.F.; Harling, J.D.; Gaster, L.M.; Reith, A.D.; Laping, N.J.; Hill, C.S. SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol. Pharmacol. 2002, 62, 65–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Name | Sequences (5′-3′) |
|---|---|
| miR-143-3p-mimic | UGAGAUGAAGCACUGUAGCUC |
| NC-mimic | UUUGUACUACACAAAAGUACUG |
| miR-143-3p-inhibitor | GAGCUACAGUGCUUCAUCUCA |
| NC-inhibitor | CAGUACUUUUGUGUAGUACAAA |
| si-Ube2e3 | GCATAGCCACTCAGTATTT |
| Name | Sense Primers (5′-3′) | Anti-Sense Primers |
|---|---|---|
| β-actin | GAGCGCAAGTACTCTGTGTG | AACGCAGCTCAGTAACAGTC |
| Ube2e3 | TGCAACATCAACAGTCAGGGA | GAGTGGCTATGCTTCCGACC |
| Il-1β | GCCACCTTTTGACAGTGATGAG | GACAGCCCAGGTCAAAGGTT |
| Il-6 | CACTTCACAAGTCGGAGGCT | CTGCAAGTGCATCATCGTTGT |
| Il-10 | GGAGGGGTTCTTCCTTGGGA | TGAGCTGCTGCAGGAATGAT |
| Cxcl-1 | TGCACCCAAACCGAAGTCAT | CTCCGTTACTTGGGGACACC |
| Cxcl-2 | TCATAGCCACTCTCAAGGGC | TCAGGTACGATCCAGGCTTC |
| Tnf-α | ATGTCTCAGCCTCTTCTCATTC | GCTTGTCACTCGAATTTTGAGA |
| Antibody | Source | Item Number | Working Dilution |
|---|---|---|---|
| p53 | Proteintech (Wuhan, China) | 10442 | 1:1000 (WB) |
| p38 MAPK | Cell Signaling Technology (Boston, MA, USA) | 8690T | 1:1000 (WB) |
| p16INK4a | Abcam (Cambridge, MA, USA) | Ab211542 | 1:1000 (WB) |
| β-actin | Fude BioTECH (Hangzhou, China) | FD0060 | 1:5000 (WB) |
| UBE2E3 | Proteintech | 15488 | 1:1000 (WB) |
| ZO-1 | Abcam | Ab221547 | 1:100 (IF)–1:1000 (WB) |
| Occludin | Abcam | Ab216327 | 1:1000 (WB) |
| Claudin-11 | Invitrogen (Carlsbad, CA, USA) | 364500 | 1:100 (IF)–1:500 (WB) |
| PCNA | Abcam | Ab29 | 1:100 (IF) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, Z.; Liang, J.; Huang, R.; Chen, D.; Mei, J.; Deng, J.; Wang, Z.; Li, L.; Li, Z.; Xia, H.; et al. Inhibition of miR-143-3p Restores Blood–Testis Barrier Function and Ameliorates Sertoli Cell Senescence. Cells 2024, 13, 313. https://doi.org/10.3390/cells13040313
Xiao Z, Liang J, Huang R, Chen D, Mei J, Deng J, Wang Z, Li L, Li Z, Xia H, et al. Inhibition of miR-143-3p Restores Blood–Testis Barrier Function and Ameliorates Sertoli Cell Senescence. Cells. 2024; 13(4):313. https://doi.org/10.3390/cells13040313
Chicago/Turabian StyleXiao, Ziyan, Jinlian Liang, Rufei Huang, Derong Chen, Jiaxin Mei, Jingxian Deng, Zhaoyang Wang, Lu Li, Ziyi Li, Huan Xia, and et al. 2024. "Inhibition of miR-143-3p Restores Blood–Testis Barrier Function and Ameliorates Sertoli Cell Senescence" Cells 13, no. 4: 313. https://doi.org/10.3390/cells13040313
APA StyleXiao, Z., Liang, J., Huang, R., Chen, D., Mei, J., Deng, J., Wang, Z., Li, L., Li, Z., Xia, H., Yang, Y., & Huang, Y. (2024). Inhibition of miR-143-3p Restores Blood–Testis Barrier Function and Ameliorates Sertoli Cell Senescence. Cells, 13(4), 313. https://doi.org/10.3390/cells13040313

