Next Article in Journal
Gut–Brain Interactions and Their Impact on Astrocytes in the Context of Multiple Sclerosis and Beyond
Previous Article in Journal
Diversity of Intercellular Communication Modes: A Cancer Biology Perspective
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 13
Issue 6
10.3390/cells13060496
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts

by
Annemarie Proff
1,*,
Ute Nazet
2,
Agnes Schröder
2,3 and
Jonathan Jantsch
1
1
Institute for Medical Microbiology, Immunology, and Hygiene, Center for Molecular Medicine Cologne (CMMC), University Hospital Cologne and Faculty of Medicine, University of Cologne, 50935 Cologne, Germany
2
Department of Orthodontics, University Hospital Regensburg, 93053 Regensburg, Germany
3
Institute for Medical Microbiology and Hygiene, University Hospital Regensburg, 93053 Regensburg, Germany
*
Author to whom correspondence should be addressed.
Cells 2024, 13(6), 496; https://doi.org/10.3390/cells13060496
Submission received: 20 December 2023 / Revised: 21 February 2024 / Accepted: 6 March 2024 / Published: 13 March 2024
Browse Figures
Versions Notes

Abstract

:
Osteoarthritis (OA) is a multifactorial disease depending on molecular, genetic, and environmental factors like mechanical strain. Next to the cartilage and the subchondral bone, OA also affects the synovium, which is critically involved in the maintenance of joint homeostasis. As there is a correlation between the extracellular sodium content in the knee joint and OA, this study investigates the impact of sodium on OA-associated processes like inflammation and bone remodeling without and with mechanical loading in synovial fibroblasts. For that purpose, murine synovial fibroblasts from the knee joint were exposed to three different extracellular sodium chloride concentrations (−20 mM, ±0 mM and +50 mM NaCl) in the absence or presence of compressive or intermittent tensile strain. In addition to the intracellular Na+ content and gene expression of the osmoprotective transcription factor nuclear factor of activated T cells 5 (Nfat5), the gene and protein expression of inflammatory mediators (interleukin-6 (IL6), prostaglandin endoperoxide synthase-2 (Ptgs2)/prostaglandin E2 (PGE2)), and factors involved in bone metabolism (receptor activator of NF-κB ligand (RANKL), osteoprotegerin (OPG)) were analyzed by qPCR and ELISA. Mechanical strain already increased intracellular Na+ and Nfat5 gene expression at standard salt conditions to levels obtained by exposure to increased extracellular Na+ content. Both high salt and compressive strain resulted in elevated IL6 and PGE2 release. Intermittent tensile strain did not increase Il6 mRNA expression or IL6 protein secretion but triggered Ptgs2 expression and PGE2 production. Increased extracellular Na+ levels and compressive strain increased RANKL expression. In contrast, intermittent tension suppressed RANKL expression without this response being subject to modification by extracellular sodium availability. OPG expression was only induced by compressive strain. Changes in extracellular Na+ levels modified the inflammatory response and altered the expression of mediators involved in bone metabolism in cells exposed to mechanical strain. These findings indicate that Na+ balance and Nfat5 are important players in synovial fibroblast responses to mechanical stress. The integration of Na+ and Na+-dependent signaling will help to improve the understanding of the pathogenesis of osteoarthritis and could lead to the establishment of new therapeutic targets.

1. Introduction

Millions of people worldwide suffer from osteoarthritis (OA), a chronic degenerative joint disease [1,2]. It can be accompanied by severe pain and immobilization, reducing the quality of life of the patients [3]. There is still no established curative therapy available yet [1,4,5]. The knee joint is one of the joints most frequently affected by OA, as it is exposed to severe mechanical stress in everyday life. OA of the knee joint is a significant orthopedic problem and is associated with high costs in the healthcare system [6,7,8]. The disease is multifactorial: genetic, epigenetic, and environmental factors contribute to the development and progression of OA [9,10,11,12]. Various joint structures, including the cartilage and synovium, are significantly involved in the development and progression of this disease [13]. The synovial fibroblasts investigated in this study represent an important cell type of the synovium as they are involved in the maintenance of joint homeostasis [14,15]. In OA patients, there is inflammation of the synovium, which is promoted by increased cartilage attrition [11,16,17]. The inflammatory and bone remodeling processes involved in this process are subject to various influencing factors. The factor of mechanical stress has already been linked to the development of OA in previous studies. While moderate mechanical stress is essential for joint preservation, exceptionally high levels of non-physiological and inefficient mechanical stress are associated with disease-promoting processes [12,18,19].
It is well established that various molecular mechanisms contribute to the development and progression of OA [20]. The remodeling of extracellular matrix components, inflammation, and bone metabolism are important modulatory factors. Previous studies show a clear relationship between elevated interleukin 6 (IL6) levels in the blood and tissue and the incidence of the development of OA [21,22,23]. Furthermore, IL6 was reported to be involved in the degradation of cartilage [24,25,26]. Prostaglandin E2 (PGE2) is synthesized by prostaglandin endoperoxide synthase 2 (PTGS2) and is one of the main catabolic factors involved in OA by critically contributing to the degradation of cartilage [27]. Moreover, subchondral bone osteoblasts from OA patients display high levels of the osteoclast-promoting factor receptor activator of NF-κB ligand (RANKL) and low levels of its decoy receptor osteoprotegerin (OPG) [28,29]. In the synovial fluid of late-stage OA patients, the RANKL/OPG-ratio is increased, indicating propagated osteoclastogenesis, which ultimately promotes subchondral bone resorption and bone loss [30].
The expression of IL6, PTGS2/PGE2 as well as OPG was shown to be regulated by the osmoprotective transcription factor nuclear factor of activated T cells 5 (NFAT5) [31,32,33,34]. Since increased extracellular ion abundance and tonicity regulate NFAT5 expression, the surrounding ionic microenvironment may affect the cellular responses induced by mechanical stress. Changes in tissue sodium concentration in response to a high-salt diet [30,31] or inflammation [32,33] influence numerous processes at the molecular level, indicating a key role of salt balance for different cell types [34]. Extracellular Na+ content in tissues can trigger the expression of the osmoprotective transcription factor NFAT5 [31,32,33,34]. Moreover, NFAT5 expression is increased after mechanical loading in fibroblasts [35]. Sodium MRI studies have shown a correlation between the extracellular sodium concentrations and OA-characteristic catabolic remodeling processes of the extracellular matrix [36]. The osmoprotective transcription factor NFAT5 plays a decisive regulatory role in connection with extracellular sodium levels. Changes in tonicity increase NFAT5 expression and trigger various different regulatory mechanisms [37,38,39,40].
The aim of this study was to analyze the relationship between different mechanical loading protocols, extracellular sodium chloride concentrations, and inflammatory and bone remodeling processes, which also play a critical role during OA pathogenesis in synovial fibroblasts.

2. Materials and Methods

2.1. Cell Culture Experiments

2.1.1. General Cell Culture Conditions

Primary, murine synovial fibroblasts from the knee joints (passages four to eight; Supplemental Figure S1a) of eight-week-old wildtype BL/6 mice male mice were used. The mice were euthanised and dissected conforming to national and institutional regulations. The cells have been isolated and were characterized previously [41]. The synovial fibroblasts were cultured at 37 °C in RPMI1640 with GlutaMAX™ (61870-010, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal calf serum (FCS, P30-3302, PAN-Biotech, Aidenbach, Germany), 1% antifungal/antibiotic (A5955, Sigma-Aldrich, Darmstadt, Germany), and 1% ascorbic acid (A8960, Sigma-Aldrich).

2.1.2. Experiments with Different Salt Concentrations without Mechanical Loading

Inflammation and diet can affect sodium content in different ways [36,37,38,42]. To avoid any cytotoxic effects, different lower and higher NaCl concentrations were tested, and concentrations without increased LDH release were used (Supplemental Figure S1b). The experiments were performed with three different extracellular sodium chloride concentrations in the following media: a low salt medium (−20 mM Na+ compared to standard salt medium; resulting in a total Na+ content of 125 mM), a standard salt medium (±0 mM Na+ compared to standard salt medium; resulting in a total Na+ content of 145 mM), and a high salt medium (+50 mM Na+ compared to standard salt medium; resulting in a total Na+ content of 195 mM). To prepare the media with the different salt concentrations, the culture medium was mixed with either sterile, deionized water (L0015, Biochrom, Cambridge, UK), the same amount of saline solution (0.9% NaCl), or sodium chloride supplemented with a 2.5 M NaCl stock solution (3957.1, Carl Roth, Karlsruhe, Germany). The final Na+ concentrations in the medium were confirmed by atomic adsorption spectroscopy. For the experiments, a total of 35,000 synovial fibroblasts were seeded per well of a 24-well plate and incubated overnight at 37 °C. After that, the medium was changed, and the synovial fibroblasts were incubated for another 48 h.

2.1.3. Experiments with Static Compressive Force Application

A total of 35,000 synovial fibroblasts were seeded per well of a 24-well plate and incubated overnight at 37 °C. Then, cells were subjected to three different sodium chloride concentrations (−20 mM, ±0 mM, +50 mM) for 48 h. During the incubation period, the cells were exposed to compressive force using ZnO2 plates (2 g/cm2; Figure 1a) [43].

2.1.4. Experiments with Intermittent Tensile Strain

A total of 200,000 primary synovial knee fibroblasts were seeded per well on collagen-coated 6-well Bioflex plates (BF-3001C, Dunn Labortechnik, Asbach, Germany) and incubated overnight at 37 °C. On the following day, the culture medium was replaced by a medium with different sodium chloride concentrations (−20 mM, ±0 mM, +50 mM). Then, synovial fibroblasts were subjected to intermittent tensile strain (amplitude 15%; frequency 0.5 Hz; two eight-hour rest periods followed by 16 h of stretching; Figure 1b) [41,44,45]. The synovial fibroblasts were exposed to different sodium chloride concentrations for a total of 48 h.

2.2. Assessment of Intracellular Na+ Using Atomic Adsorption Spectrometry

Essentially, detection of intracellular Na+ was performed as described earlier [46,47]. The supernatant was removed, and the cells were washed three times with a sucrose solution (34.24%; 4621.2 Carl Roth, Karlsruhe, Germany). Synovial fibroblasts were lysed by incubation in 0.1% Triton X-100 (327371000, Acros Organics, Antwerp, Belgium) for 20 min. The cell lysates were scraped off with a cell scraper and transferred to reaction tubes. To quantify sodium in the lysate, atomic absorption spectrometry (iCE 3500, Thermo Fisher Scientific, Waltham, MA, USA) was used. For this purpose, 100 μL of the lysates were added to a 3 mL dilution solution (0.1% HNO3 (X898.2, Carl Roth), 0.5% CsCl solution (289329, Sigma-Aldrich, Darmstadt, Germany) in H2Odd) and mixed by inverting. Standard dilution series of Na+ (2337, Carl Roth) were prepared within the linear range.

2.3. Quantitative Polymerase Chain Reaction (qPCR)

The qPCR protocol basically followed the previously published proceedings [41,44]. Briefly, RNA was extracted using RNA-Solv (R6830-01, VWR, Darmstadt, Germany) according to the manufacturer’s protocol. A concentration specific amount of RNA was mixed with nuclease-free water (T143.5, Carl Roth) for cDNA synthesis. A total of 4.5 μL of master mix, consisting of 2 µL of M-MLV buffer (M531A, Promega, Madison, WI, USA) and 0.5 µL each of OligodT (SO132, Thermo Fisher Scientific), Random Hexamer Primer (SO142, Thermo Fisher Scientific), dNTPs (L785, Carl Roth), RNase Inhibitor (EO0381, Thermo Fisher Scientific) and Reverse Transcriptase (M170B, Promega), were added per sample. The samples were incubated for one hour at 37 °C in a thermocycler (Biometra, Analytik Jena, Jena, Germany), followed by heating to 95 °C for 2 min. A total of 1.5 μL of each diluted cDNA sample was pipetted into a nuclease-free 96-well plate (712282, BiozymScientific, Hessisch Oldendorf, Germany) in duplicate. To each well, 8.5 μL of a master mix consisting of 0.25 μL forward primer (Table 1), 0.25 μL reverse primer (Table 1), 5 μL Luna Universal qPCR Mix (M3003E, New England Biolabs, Frankfurt am Main, Germany), and 3 μL nuclease-free water (T143.5, Carl Roth) was added. The 96-well plate was then sealed (712350, Biozym) and centrifuged. The qPCR was performed using a Realplex2 cycler (Eppendorf, Hamburg, Germany). Hprt and Sdha were used as reference genes (Table 1). All primers were designed for exon-intron spanning. Relative gene expression was determined using the 2−ΔCT formula with ΔCT = Cq(target gene) − Cq (geometric mean Hprt/Sdha) [48,49]. It was then divided by the arithmetic mean of the control group to obtain relative gene expression with respect to the control group.

2.4. Enzyme Linked Immune Absorbent Assays (ELISAs)

All ELISAs were performed according to the manufacturer’s instructions. The following ELISA kits were used: interleukin 6 (MyBioSource, San Diego, CA, USA, Murine IL6 ELISA, MBS335514), prostaglandin E2 (MyBioSource, Mouse Prostaglandin E2 ELISA, MBS266212), osteoprotegerin (Thermo scientific, Mouse OPG (TNFRSF11B) ELISA Kit, EMTNFRSF11B) and RANKL (Thermo scientific, Mouse TRANCE (TNFSF11) ELISA Kit, EMTNFSF11).

2.5. Statistics

Statistical analysis was performed using the program GraphPadPrism 9.5. Before statistical evaluation, all absolute data values, except the protein data of the ELISA, were divided by the respective arithmetic mean of the control group without mechanical stress to obtain normalized data values. The bars show the mean, and the horizontal lines the standard error of the mean. The normal distribution of the data was examined with the Shapiro–Wilk test. The homogeneity of the groups was determined using the Brown-Forsythe test. Depending on the normal distribution and homogeneity of the data, a Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test was performed, and differences were considered statistically significant at p < 0.05.

3. Results

3.1. Impact of Different Extracellular Na+ Concentrations on Synovial Fibroblasts

First, the effects of different extracellular salt concentrations on intracellular Na+ (Nai+) without any additional mechanical loading were analyzed. The reduction of extracellular Na+ by −20 mM or addition of +50 mM NaCl did not induce any cytotoxicity (Supplemental Figure S1b). The reduction of extracellular Na+ (Nae+) by −20 mM decreased intracellular Na+ (Nai+, p = 0.03; Figure 2a), while increasing Nae+ by 50 mM increased Nai+ levels (p = 0.021). Gene expression of the osmoprotective transcription factor nuclear factor of activated T cells 5 (Nfat5) was increased after incubation in salt-rich conditions (p ≤ 0.014; Figure 2b). NFAT5 can regulate the expression of the inflammatory genes interleukin-6 (Il6) and the inflammatory enzyme gene prostaglandin endoperoxide synthase-2 (Ptgs2) [31,32,34]. Accordingly, high salt conditions increased Il6 gene expression (p = 0.046; Figure 2c) and IL6 protein release (p = 0.004; Figure 2d). The mRNA expression of Ptgs2 (p = 0.002; Figure 2e) and the secretion of PGE2 (p < 0.001; Figure 2f) were also upregulated with increased extracellular NaCl content. Expression of the bone protective decoy receptor osteoprotegerin (OPG) was not affected on either the mRNA (p ≤ 0.406; Figure 2g) or the protein level (p ≤ 0.509; Figure 2h) by exposure to high salt conditions. Receptor activator of NF-κB ligand (RANKL) mRNA expression (p = 0.013; Figure 2i) and protein secretion (p = 0.013; Figure 2j) were increased by the addition of salt compared to the low salt group. Increased Il6/IL6, Ptgs2/PGE2, and Rankl/RANKL expression/release under high salt conditions may point towards the induction of osteoclastogenesis by murine knee synovial fibroblasts upon exposure to high salt conditions.

3.2. Impact of Static Pressure Application and Extracellular Na+ Levels on Synovial Fibroblasts

Nae+ levels had no effects on cytotoxicity during static pressure (Supplemental Figure S1c). After static pressure application in medium with different extracellular salt contents, Nai+ was measured. Nai+ increased after compressive strain without the external addition of NaCl (p = 0.005; Figure 3a). Of note, the lowering of Nae+ was accompanied by lower Nai+ concentrations (p = 0.008), while increasing Nae+ levels only tended to increase Nai+ levels (p = 0.061; Figure 3a). Nfat5 gene expression was increased by static pressure (p = 0.004) and correlated with external NaCl levels in cells exposed to static pressure (p < 0.001; Figure 3b).
Il6 mRNA expression (p = 0.011; Figure 3c) and IL6 protein secretion (p = 0.002; Figure 3d) were elevated in reaction to static pressure application. The reduction of extracellular NaCl by −20 mM decreased pressure-induced Il6 gene (p = 0.016) and protein expression (p = 0.003). Under high salt conditions, there was no further detectable increase in Il6 expression or release (Figure 3c,d). Compressive strain increased Ptgs2 mRNA (p = 0.010; Figure 3e). Additional extracellular NaCl tended to further elevate Ptgs2 gene expression after static pressure application (p = 0.087), while an additional reduction in extracellular sodium chloride content reduced Ptgs2 mRNA (p = 0.055; Figure 3e). Compressive force application increased PGE2 secretion (p < 0.001; Figure 3f). This response was further increased by additional exposure to high extracellular NaCl conditions (p ≤ 0.023).
Opg mRNA was elevated after compression of synovial fibroblasts (p < 0.001; Figure 3g). No significant additional effect of extracellular NaCl on Opg gene expression was detectable in cells exposed to static force. These effects were also mirrored at the protein level (Figure 3h). Compressive strain increased Rankl gene expression (p = 0.012; Figure 3i) and RANKL protein secretion (p = 0.007; Figure 3j). In cells treated with compressive static strain, additional extracellular NaCl further increased RANKL protein secretion (Figure 3i,j).

3.3. Impact of Intermittant Tension and Extracellular Na+ on Synovial Fibroblasts

Like static compressive strain, intermittent tension did not exert any cytotoxicity (Supplemental Figure S1d). Intermittent compressive strain increased Nai+ content (p = 0.028; Figure 4a) and Nfat5 expression (p = 0.023; Figure 4b). Under these conditions, Nai+ levels depended on extracellular NaCl availability (p ≤ 0.011; Figure 4a). A reduction in extracellular salt led to diminished Nfat5 mRNA after tensile strain (p = 0.014), while there was no significant effect on Nfat5 levels in cells treated with intermittent compressive strain after increasing extracellular NaCl levels (p = 0.838; Figure 4b).
In contrast to static compressive strain, intermittent tension reduced Il6 mRNA (p = 0.004; Figure 4c) and IL6 protein secretion (p < 0.001; Figure 4d). While extracellular NaCl had no statistically significant impact on Il6 mRNA gene expression after intermittent tensile loading, increased extracellular NaCl concentrations elevated IL6 protein secretion significantly (p = 0.007; Figure 4d). Intermittent tension induced Ptgs2 gene expression and PGE2 secretion (p ≤ 0.002; Figure 4e,f). Increases in extracellular NaCl boosted this effect (p ≤ 0.033).
Gene and protein expression of the RANKL decoy receptor OPG were neither affected by intermittent tension nor by increased or reduced extracellular NaCl content (Figure 4g,h). Intermittent tension reduced Rankl mRNA levels (p = 0.067; Figure 4i) and RANKL secretion (p = 0.049; Figure 4j). This response to intermittent tension was not modified by extracellular NaCl availability (Figure 4i,j).

4. Discussion

Changes in intra- and extracellular ion concentrations influence numerous processes at the molecular level [50,51,52]. A low-salt diet is generally recommended for a healthier lifestyle [53,54]. The progression and pathogenesis of knee OA might be influenced by tissue Na+ content, as a high-salt diet in particular is associated with OA-promoting inflammatory processes [55,56].
The inflammatory mediators IL6, PTGS2, and PGE2 have already been described in connection with OA in relation to catabolic processes [24,25,26,27,57]. An increased secretion of PGE2 was demonstrated in murine synovial fibroblasts of the temporomandibular joint and osteoblasts of the subchondral bone exposed to mechanical stress [44,57,58]. Increased expression of inflammatory factors occurs particularly during short periods of intense mechanical stress, similar to the initial stage of OA. During long-term stress, inflammatory processes are less dominant than remodeling processes of the extracellular matrix [58]. Contrary to Ptgs2/PGE2, there were different expression patterns for IL6 that were detectable depending on the nature of the applied force. With compressive strain, there was an increase in Il6 gene expression and IL6 protein secretion, while expression decreased with intermittent tension. These findings are in line with the literature [43,44,58].
In contrast to the inflammatory processes investigated, the bone remodeling factor OPG was unaffected by a high salt exposure. Rather, the mechanical load plays a decisive role. Increased RANKL and decreased OPG levels are both associated with catabolic bone remodeling processes [28,30,59]. Increased RANKL was detected in the synovial fluid of patients with temporomandibular joint OA [60] and in the serum of patients with knee OA [30]. Confirming earlier studies [44], it was found that only compressive force application increased expression of RANKL but not intermittent tensile strain.
Exposure to high extracellular Na+ levels triggers increased intracellular Na+ concentrations [61]. In line with this, exposure to high extracellular NaCl resulted in higher intracellular Na+ levels in mouse fibroblasts as well. Here it was shown that mechanical stress can induce increases in intracellular Na+ under normal cell culture conditions in mouse fibroblasts. This suggests that increases in Na+ might be involved in signal transduction and cellular responses to mechanical stress. In addition to mechanostress, hypoxia is able to trigger increases in Na+ levels in mitochondria, which ultimately interfere with electron transfer and mitochondrial energy generation. Therefore, it was suggested that intracellular Na+ might act as a second messenger [62].
Of note, in this study, intracellular Na+ levels were correlated with the expression of the transcription factor Nfat5, which is not only involved in various downstream osmoprotective but also inflammatory [34,39] and bone remodeling processes [33,34,63]. NFAT5 promotes the expression of inflammatory mediators in various tissues [34,39]. Increased salt concentrations and subsequently elevated NFAT5 expression were associated with increased activation of proinflammatory macrophages and T cell outputs [37,38,42,64]. NFAT5 could also play a significant role as an intermediate mediator in OA-associated inflammatory processes. For instance, Yoon et al. reported an upregulation of NFAT5 under proinflammatory conditions in rheumatoid arthritis [65]. The interdependence of NFAT5 and inflammation is also important. In line with this notion, NFAT5 can be upregulated not only by osmotic stress but also by inflammatory cytokines [66]. Although both mechanical loading protocols increase intracellular Na+ concentrations and NFAT5 expression, the effects on inflammatory and bone remodeling genes are not uniform.
In this context, it should be kept in mind that, next to its effect on NFAT5 expression, Na+ itself might represent a second messenger affecting many cellular signaling processes and inflammatory responses [50,62]. Of note, increasing intracellular Na+ levels is not sufficient to mimic effects induced by exposure to increases in high extracellular salt in macrophages, but additional signals, such as hypertonic membrane stress, are required [46].
In this study, for instance, intracellular Na+ was correlated with RANKL expression after compressive strain, but there was no correlation upon exposure to intermittent tensile strain. Next, although OPG was reported to be a NFAT5 target gene in osteoblasts [33], no effects of either mechanical loading or salt concentration on Opg mRNA expression or OPG protein level were observed in murine knee synovial fibroblasts. Therefore, it is very tempting to speculate that there is a complex and context-dependent interplay of intracellular Na+ levels, transcription factor abundance, and membrane responses that ultimately drive the outputs of cells. If and how our findings on inflammatory and bone remodeling outputs are mechanistically linked to intracellular Na+ concentrations and Nfat5 need further experimental clarification. This could be particularly interesting because local ion concentrations in the joint could be influenced therapeutically, for example, through joint injections [67].
This study has several limitations that should be mentioned. OA is a multifactorial disease that depends on various cell types. This study only investigated synovial fibroblasts. The suggested relationship with the pathophysiology of osteoarthritis is correlative and must be validated in further mechanistic experiments.

5. Conclusions

Overall, the data of this in vitro study indicate that extracellular sodium chloride concentrations impact synovial fibroblast responses upon mechanical strain. Of utmost interest, however, our data show that mechanical stress results in enhanced Nai+ and Nfat5 levels even under normal salt conditions. This suggests that Nai+ and Nfat5 could play an important role in transducing mechanostress signals to cells.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells13060496/s1, Figure S1: Primary murine synovial fibroblasts form the knee joint (a). Lactat dehy-drogenase (LDH) release of murine synovial fibroblasts exposed to different NaCl concentriations without mechanical loading (b; n = 4), static compressive force (c; n = 9) and intermittent tension (d; n = 6). The LDH assay was performed according to the manufacturer’s instructions (04744926001, Roche, Mannheim, Germany). Statistics: Welch-corrected ANOVA with Dunnett´s T3 multiple comparisons test; * p < 0.05; ** p < 0.01.

Author Contributions

Conceptualization, A.S. and J.J.; methodology, A.S. and U.N.; validation, A.P.; formal analysis, A.P.; investigation, A.P.; resources, J.J.; data curation, A.P.; writing—original draft preparation, A.P.; writing—review and editing, A.S. and J.J.; visualization, A.P.; supervision, J.J.; project administration, J.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable as for cell isolation euthanised animals without pretreatment were conducted.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are available on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Abramoff, B.; Caldera, F.E. Osteoarthritis: Pathology, Diagnosis, and Treatment Options. Med. Clin. N. Am. 2020, 104, 293–311. [Google Scholar] [CrossRef]
  2. Perruccio, A.V.; Young, J.J.; Wilfong, J.M.; Denise Power, J.; Canizares, M.; Badley, E.M. Osteoarthritis Year in Review 2023: Epidemiology & therapy. Osteoarthr. Cartil. 2023, 32, 159–165. [Google Scholar] [CrossRef]
  3. Vitaloni, M.; Botto-van Bemden, A.; Sciortino Contreras, R.M.; Scotton, D.; Bibas, M.; Quintero, M.; Monfort, J.; Carné, X.; de Abajo, F.; Oswald, E.; et al. Global management of patients with knee osteoarthritis begins with quality of life assessment: A systematic review. BMC Musculoskelet. Disord. 2019, 20, 493. [Google Scholar] [CrossRef] [PubMed]
  4. Michael, J.W.-P.; Schlüter-Brust, K.U.; Eysel, P. The epidemiology, etiology, diagnosis, and treatment of osteoarthritis of the knee. Dtsch. Arztebl. Int. 2010, 107, 152–162. [Google Scholar] [CrossRef] [PubMed]
  5. Hunter, D.J.; March, L.; Chew, M. Osteoarthritis in 2020 and beyond: A Lancet Commission. Lancet 2020, 396, 1711–1712. [Google Scholar] [CrossRef] [PubMed]
  6. Salmon, J.H.; Rat, A.C.; Achit, H.; Ngueyon-Sime, W.; Gard, C.; Guillemin, F.; Jolly, D.; Fautrel, B. Health resource use and costs of symptomatic knee and/or hip osteoarthritis. Osteoarthr. Cartil. 2019, 27, 1011–1017. [Google Scholar] [CrossRef] [PubMed]
  7. Wright, E.A.; Katz, J.N.; Cisternas, M.G.; Kessler, C.L.; Wagenseller, A.; Losina, E. Impact of knee osteoarthritis on health care resource utilization in a US population-based national sample. Med. Care 2010, 48, 785–791. [Google Scholar] [CrossRef] [PubMed]
  8. Bedenbaugh, A.V.; Bonafede, M.; Marchlewicz, E.H.; Lee, V.; Tambiah, J. Real-World Health Care Resource Utilization and Costs Among US Patients with Knee Osteoarthritis Compared with Controls. Clinicoecon. Outcomes Res. 2021, 13, 421–435. [Google Scholar] [CrossRef]
  9. O’Neill, T.W.; McCabe, P.S.; McBeth, J. Update on the epidemiology, risk factors and disease outcomes of osteoarthritis. Best Pract. Res. Clin. Rheumatol. 2018, 32, 312–326. [Google Scholar] [CrossRef]
  10. Buckwalter, J.A. The role of mechanical forces in the initiation and progression of osteoarthritis. HSS J. 2012, 8, 37–38. [Google Scholar] [CrossRef]
  11. Buckwalter, J.A.; Anderson, D.D.; Brown, T.D.; Tochigi, Y.; Martin, J.A. The Roles of Mechanical Stresses in the Pathogenesis of Osteoarthritis: Implications for Treatment of Joint Injuries. Cartilage 2013, 4, 286–294. [Google Scholar] [CrossRef]
  12. Dwivedi, G.; Flaman, L.; Alaybeyoglu, B.; Struglics, A.; Frank, E.H.; Chubinskya, S.; Trippel, S.B.; Rosen, V.; Cirit, M.; Grodzinsky, A.J. Inflammatory cytokines and mechanical injury induce post-traumatic osteoarthritis-like changes in a human cartilage-bone-synovium microphysiological system. Arthritis Res. Ther. 2022, 24, 198. [Google Scholar] [CrossRef]
  13. Mathiessen, A.; Conaghan, P.G. Synovitis in osteoarthritis: Current understanding with therapeutic implications. Arthritis Res. Ther. 2017, 19, 18. [Google Scholar] [CrossRef]
  14. Bhattaram, P.; Chandrasekharan, U. The joint synovium: A critical determinant of articular cartilage fate in inflammatory joint diseases. Semin. Cell Dev. Biol. 2017, 62, 86–93. [Google Scholar] [CrossRef] [PubMed]
  15. Hui, A.Y.; McCarty, W.J.; Masuda, K.; Firestein, G.S.; Sah, R.L. A systems biology approach to synovial joint lubrication in health, injury, and disease. Wiley Interdiscip. Rev. Syst. Biol. Med. 2012, 4, 15–37. [Google Scholar] [CrossRef]
  16. Doherty, M. Synovial inflammation and osteoarthritis progression: Effects of nonsteroidal antiinflammatory drugs. Osteoarthr. Cartil. 1999, 7, 319–320. [Google Scholar] [CrossRef] [PubMed]
  17. Sanchez-Lopez, E.; Coras, R.; Torres, A.; Lane, N.E.; Guma, M. Synovial inflammation in osteoarthritis progression. Nat. Rev. Rheumatol. 2022, 18, 258–275. [Google Scholar] [CrossRef] [PubMed]
  18. Griffin, T.M.; Guilak, F. The role of mechanical loading in the onset and progression of osteoarthritis. Exerc. Sport Sci. Rev. 2005, 33, 195–200. [Google Scholar] [CrossRef] [PubMed]
  19. Vincent, K.R.; Conrad, B.P.; Fregly, B.J.; Vincent, H.K. The pathophysiology of osteoarthritis: A mechanical perspective on the knee joint. PM&R 2012, 4, S3–S9. [Google Scholar] [CrossRef]
  20. Wang, X.D.; Zhang, J.N.; Gan, Y.H.; Zhou, Y.H. Current understanding of pathogenesis and treatment of TMJ osteoarthritis. J. Dent. Res. 2015, 94, 666–673. [Google Scholar] [CrossRef]
  21. Wiegertjes, R.; van de Loo, F.A.J.; Blaney Davidson, E.N. A roadmap to target interleukin-6 in osteoarthritis. Rheumatology 2020, 59, 2681–2694. [Google Scholar] [CrossRef] [PubMed]
  22. Livshits, G.; Zhai, G.; Hart, D.J.; Kato, B.S.; Wang, H.; Williams, F.M.K.; Spector, T.D. Interleukin-6 is a significant predictor of radiographic knee osteoarthritis: The Chingford Study. Arthritis Rheum. 2009, 60, 2037–2045. [Google Scholar] [CrossRef] [PubMed]
  23. Siqueira, M.B.P.; Frangiamore, S.; Klika, A.K.; Gajewski, N.; Barsoum, W.K.; Higuera, C.A. Comparison of Synovial Fluid Cytokine Levels between Traumatic Knee Injury and End-Stage Osteoarthritis. J. Knee Surg. 2017, 30, 128–133. [Google Scholar] [CrossRef] [PubMed]
  24. Liao, Y.; Ren, Y.; Luo, X.; Mirando, A.J.; Long, J.T.; Leinroth, A.; Ji, R.-R.; Hilton, M.J. Interleukin-6 signaling mediates cartilage degradation and pain in posttraumatic osteoarthritis in a sex-specific manner. Sci. Signal. 2022, 15, eabn7082. [Google Scholar] [CrossRef]
  25. Stannus, O.; Jones, G.; Cicuttini, F.; Parameswaran, V.; Quinn, S.; Burgess, J.; Ding, C. Circulating levels of IL-6 and TNF-α are associated with knee radiographic osteoarthritis and knee cartilage loss in older adults. Osteoarthr. Cartil. 2010, 18, 1441–1447. [Google Scholar] [CrossRef]
  26. Tsuchida, A.I.; Beekhuizen, M.; Rutgers, M.; van Osch, G.J.V.M.; Bekkers, J.E.J.; Bot, A.G.J.; Geurts, B.; Dhert, W.J.A.; Saris, D.B.F.; Creemers, L.B. Interleukin-6 is elevated in synovial fluid of patients with focal cartilage defects and stimulates cartilage matrix production in an in vitro regeneration model. Arthritis Res. Ther. 2012, 14, R262. [Google Scholar] [CrossRef]
  27. Gosset, M.; Berenbaum, F.; Levy, A.; Pigenet, A.; Thirion, S.; Cavadias, S.; Jacques, C. Mechanical stress and prostaglandin E2 synthesis in cartilage. Biorheology 2008, 45, 301–320. [Google Scholar] [CrossRef]
  28. Tat, S.K.; Pelletier, J.-P.; Velasco, C.R.; Padrines, M.; Martel-Pelletier, J. New perspective in osteoarthritis: The OPG and RANKL system as a potential therapeutic target? Keio J. Med. 2009, 58, 29–40. [Google Scholar] [CrossRef]
  29. Liang, J.; Liu, L.; Feng, H.; Yue, Y.; Zhang, Y.; Wang, Q.; Zhao, H. Therapeutics of osteoarthritis and pharmacological mechanisms: A focus on RANK/RANKL signaling. Biomed. Pharmacother. 2023, 167, 115646. [Google Scholar] [CrossRef]
  30. Naik, S.; Sahu, S.; Bandyopadhyay, D.; Tripathy, S. Serum levels of osteoprotegerin, RANK-L & vitamin D in different stages of osteoarthritis of the knee. Indian J. Med. Res. 2021, 154, 491–496. [Google Scholar] [CrossRef]
  31. Favale, N.O.; Casali, C.I.; Lepera, L.G.; Pescio, L.G.; Fernández-Tome, M.C. Hypertonic induction of COX2 expression requires TonEBP/NFAT5 in renal epithelial cells. Biochem. Biophys. Res. Commun. 2009, 381, 301–305. [Google Scholar] [CrossRef]
  32. Lee, N.; Kim, D.; Kim, W.-U. Role of NFAT5 in the Immune System and Pathogenesis of Autoimmune Diseases. Front. Immunol. 2019, 10, 270. [Google Scholar] [CrossRef]
  33. Schröder, A.; Neubert, P.; Titze, J.; Bozec, A.; Neuhofer, W.; Proff, P.; Kirschneck, C.; Jantsch, J. Osteoprotective action of low-salt diet requires myeloid cell-derived NFAT5. JCI Insight 2019, 4, e127868. [Google Scholar] [CrossRef]
  34. Lunazzi, G.; Buxadé, M.; Riera-Borrull, M.; Higuera, L.; Bonnin, S.; Huerga Encabo, H.; Gaggero, S.; Reyes-Garau, D.; Company, C.; Cozzuto, L.; et al. NFAT5 Amplifies Antipathogen Responses by Enhancing Chromatin Accessibility, H3K27 Demethylation, and Transcription Factor Recruitment. J. Immunol. 2021, 206, 2652–2667. [Google Scholar] [CrossRef] [PubMed]
  35. Schröder, A.; Gubernator, J.; Nazet, U.; Spanier, G.; Jantsch, J.; Proff, P.; Kirschneck, C. Effects of sodium chloride on the gene expression profile of periodontal ligament fibroblasts during tensile strain. J. Orofac. Orthop. 2020, 81, 360–370. [Google Scholar] [CrossRef]
  36. Madelin, G.; Regatte, R.R. Biomedical applications of sodium MRI in vivo. J. Magn. Reson. Imaging 2013, 38, 511–529. [Google Scholar] [CrossRef] [PubMed]
  37. Machnik, A.; Neuhofer, W.; Jantsch, J.; Dahlmann, A.; Tammela, T.; Machura, K.; Park, J.-K.; Beck, F.-X.; Müller, D.N.; Derer, W.; et al. Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C-dependent buffering mechanism. Nat. Med. 2009, 15, 545–552. [Google Scholar] [CrossRef] [PubMed]
  38. Jantsch, J.; Schatz, V.; Friedrich, D.; Schröder, A.; Kopp, C.; Siegert, I.; Maronna, A.; Wendelborn, D.; Linz, P.; Binger, K.J.; et al. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense. Cell Metab. 2015, 21, 493–501. [Google Scholar] [CrossRef] [PubMed]
  39. Neuhofer, W. Role of NFAT5 in inflammatory disorders associated with osmotic stress. Curr. Genom. 2010, 11, 584–590. [Google Scholar] [CrossRef]
  40. Aramburu, J.; López-Rodríguez, C. Regulation of Inflammatory Functions of Macrophages and T Lymphocytes by NFAT5. Front. Immunol. 2019, 10, 535. [Google Scholar] [CrossRef]
  41. Nazet, U.; Neubert, P.; Schatz, V.; Grässel, S.; Proff, P.; Jantsch, J.; Schröder, A.; Kirschneck, C. Differential gene expression response of synovial fibroblasts from temporomandibular joints and knee joints to dynamic tensile stress. J. Orofac. Orthop. 2022, 83, 361–375. [Google Scholar] [CrossRef] [PubMed]
  42. Jobin, K.; Müller, D.N.; Jantsch, J.; Kurts, C. Sodium and its manifold impact on our immune system. Trends Immunol. 2021, 42, 469–479. [Google Scholar] [CrossRef] [PubMed]
  43. Schröder, A.; Nazet, U.; Muschter, D.; Grässel, S.; Proff, P.; Kirschneck, C. Impact of Mechanical Load on the Expression Profile of Synovial Fibroblasts from Patients with and without Osteoarthritis. Int. J. Mol. Sci. 2019, 20, 585. [Google Scholar] [CrossRef]
  44. Nazet, U.; Feulner, L.; Muschter, D.; Neubert, P.; Schatz, V.; Grässel, S.; Jantsch, J.; Proff, P.; Schröder, A.; Kirschneck, C. Mechanical Stress Induce PG-E2 in Murine Synovial Fibroblasts Originating from the Temporomandibular Joint. Cells 2021, 10, 298. [Google Scholar] [CrossRef]
  45. Lohberger, B.; Kaltenegger, H.; Weigl, L.; Mann, A.; Kullich, W.; Stuendl, N.; Leithner, A.; Steinecker-Frohnwieser, B. Mechanical exposure and diacerein treatment modulates integrin-FAK-MAPKs mechanotransduction in human osteoarthritis chondrocytes. Cell. Signal. 2019, 56, 23–30. [Google Scholar] [CrossRef]
  46. Krampert, L.; Ossner, T.; Schröder, A.; Schatz, V.; Jantsch, J. Simultaneous Increases in Intracellular Sodium and Tonicity Boost Antimicrobial Activity of Macrophages. Cells 2023, 12, 2816. [Google Scholar] [CrossRef]
  47. Geisberger, S.; Bartolomaeus, H.; Neubert, P.; Willebrand, R.; Zasada, C.; Bartolomaeus, T.; McParland, V.; Swinnen, D.; Geuzens, A.; Maifeld, A.; et al. Salt Transiently Inhibits Mitochondrial Energetics in Mononuclear Phagocytes. Circulation 2021, 144, 144–158. [Google Scholar] [CrossRef]
  48. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  49. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  50. Müller, D.N.; Geisberger, S.; Kleinewietfeld, M.; Jantsch, J. Salt sensitivity includes effects on immune cell signalling and metabolism. Nat. Rev. Immunol. 2023, 23, 341–342. [Google Scholar] [CrossRef] [PubMed]
  51. Zhang, J.; Li, M.-N.; Yang, G.-M.; Hou, X.-T.; Yang, D.; Han, M.-M.; Zhang, Y.; Liu, Y.-F. Effects of water-sodium balance and regulation of electrolytes associated with antidiabetic drugs. Eur. Rev. Med. Pharmacol. Sci. 2023, 27, 5784–5794. [Google Scholar] [CrossRef] [PubMed]
  52. Li, X.; Alu, A.; Wei, Y.; Wei, X.; Luo, M. The modulatory effect of high salt on immune cells and related diseases. Cell Prolif. 2022, 55, e13250. [Google Scholar] [CrossRef] [PubMed]
  53. Suckling, R.J.; Swift, P.A. The health impacts of dietary sodium and a low-salt diet. Clin. Med. 2015, 15, 585–588. [Google Scholar] [CrossRef] [PubMed]
  54. Robinson, A.T.; Edwards, D.G.; Farquhar, W.B. The Influence of Dietary Salt Beyond Blood Pressure. Curr. Hypertens. Rep. 2019, 21, 42. [Google Scholar] [CrossRef] [PubMed]
  55. Ha, Y.-J.; Ji, E.; Lee, J.H.; Kim, J.H.; Park, E.H.; Chung, S.W.; Chang, S.H.; Yoo, J.J.; Kang, E.H.; Ahn, S.; et al. High Estimated 24-Hour Urinary Sodium Excretion Is Related to Symptomatic Knee Osteoarthritis: A Nationwide Cross-Sectional Population-Based Study. J. Nutr. Health Aging 2022, 26, 581–589. [Google Scholar] [CrossRef]
  56. Morales-Ivorra, I.; Romera-Baures, M.; Roman-Viñas, B.; Serra-Majem, L. Osteoarthritis and the Mediterranean Diet: A Systematic Review. Nutrients 2018, 10, 1030. [Google Scholar] [CrossRef]
  57. Sanchez, C.; Gabay, O.; Salvat, C.; Henrotin, Y.E.; Berenbaum, F. Mechanical loading highly increases IL-6 production and decreases OPG expression by osteoblasts. Osteoarthr. Cartil. 2009, 17, 473–481. [Google Scholar] [CrossRef]
  58. Nazet, U.; Grässel, S.; Jantsch, J.; Proff, P.; Schröder, A.; Kirschneck, C. Early OA Stage Like Response Occurs after Dynamic Stretching of Human Synovial Fibroblasts. Int. J. Mol. Sci. 2020, 21, 3874. [Google Scholar] [CrossRef]
  59. Takito, J.; Nonaka, N. Osteoclasts at Bone Remodeling: Order from Order. Results Probl. Cell Differ. 2024, 71, 227–256. [Google Scholar] [CrossRef] [PubMed]
  60. Cafferata, E.A.; Monasterio, G.; Castillo, F.; Carvajal, P.; Flores, G.; Díaz, W.; Fuentes, A.D.; Vernal, R. Overexpression of MMPs, cytokines, and RANKL/OPG in temporomandibular joint osteoarthritis and their association with joint pain, mouth opening, and bone degeneration: A preliminary report. Oral Dis. 2021, 27, 970–980. [Google Scholar] [CrossRef] [PubMed]
  61. Neubert, P.; Homann, A.; Wendelborn, D.; Bär, A.-L.; Krampert, L.; Trum, M.; Schröder, A.; Ebner, S.; Weichselbaum, A.; Schatz, V.; et al. NCX1 represents an ionic Na+ sensing mechanism in macrophages. PLoS Biol. 2020, 18, e3000722. [Google Scholar] [CrossRef] [PubMed]
  62. Hernansanz-Agustín, P.; Choya-Foces, C.; Carregal-Romero, S.; Ramos, E.; Oliva, T.; Villa-Piña, T.; Moreno, L.; Izquierdo-Álvarez, A.; Cabrera-García, J.D.; Cortés, A.; et al. Na+ controls hypoxic signalling by the mitochondrial respiratory chain. Nature 2020, 586, 287–291. [Google Scholar] [CrossRef] [PubMed]
  63. Schröder, A.; Leikam, A.; Käppler, P.; Neubert, P.; Jantsch, J.; Neuhofer, W.; Deschner, J.; Proff, P.; Kirschneck, C. Impact of salt and the osmoprotective transcription factor NFAT-5 on macrophages during mechanical strain. Immunol. Cell Biol. 2021, 99, 84–96. [Google Scholar] [CrossRef]
  64. Amara, S.; Tiriveedhi, V. Inflammatory role of high salt level in tumor microenvironment (Review). Int. J. Oncol. 2017, 50, 1477–1481. [Google Scholar] [CrossRef] [PubMed]
  65. Yoon, H.-J.; You, S.; Yoo, S.-A.; Kim, N.-H.; Kwon, H.M.; Yoon, C.-H.; Cho, C.-S.; Hwang, D.; Kim, W.-U. NF-AT5 is a critical regulator of inflammatory arthritis. Arthritis Rheum. 2011, 63, 1843–1852. [Google Scholar] [CrossRef]
  66. Lee, J.; Lee, J.; Lee, S.; Yoo, S.-A.; Kim, K.-M.; Kim, W.-U.; Cho, C.-S.; Yoon, C.-H. Genetic deficiency of nuclear factor of activated T cells 5 attenuates the development of osteoarthritis in mice. Jt. Bone Spine 2022, 89, 105273. [Google Scholar] [CrossRef]
  67. Bar-Or, D.; Rael, L.T.; Brody, E.N. Use of Saline as a Placebo in Intra-articular Injections in Osteoarthritis: Potential Contributions to Nociceptive Pain Relief. Open Rheumatol. J. 2017, 11, 16–22. [Google Scholar] [CrossRef]
Cells 13 00496 g001
Figure 1. Schematic representation of the performed experiments. Mouse synovial fibroblasts from knee joints were incubated in different Na+ concentrations (−20 mM, ±0 mM, +50 mM) for a total of 48 h. For compressive force treatment, a sterile ZnO2 plate (2 g/cm2), as illustrated on the right side, was placed on the synovial fibroblasts for 48 h (a). Intermittent cyclic tension was performed for at least 48 h with two cycles of 8 h at a 0% amplitude followed by 16 h at a 15% amplitude using a cell stretching machine (b). The piston (marked with the blue arrow) pushes the stamps (green arrows) upwards according to the specified frequency and amplitude. The light gray metal block contains a collagen-coated 6-well Bioflex plate with a flexible underside.
Figure 1. Schematic representation of the performed experiments. Mouse synovial fibroblasts from knee joints were incubated in different Na+ concentrations (−20 mM, ±0 mM, +50 mM) for a total of 48 h. For compressive force treatment, a sterile ZnO2 plate (2 g/cm2), as illustrated on the right side, was placed on the synovial fibroblasts for 48 h (a). Intermittent cyclic tension was performed for at least 48 h with two cycles of 8 h at a 0% amplitude followed by 16 h at a 15% amplitude using a cell stretching machine (b). The piston (marked with the blue arrow) pushes the stamps (green arrows) upwards according to the specified frequency and amplitude. The light gray metal block contains a collagen-coated 6-well Bioflex plate with a flexible underside.
Cells 13 00496 g001
Cells 13 00496 g002
Figure 2. Impact of different extracellular NaCl concentrations for 48 h on relative Na+i content ((a); n = 7), Nfat5 mRNA (b), Il6 mRNA (c) and IL6 protein secretion (d), Ptgs2 mRNA (e) and PGE2 secretion (f), Opg mRNA (g) and OPG protein secretion (h), as well as Rankl mRNA (i) and RANKL protein secretion (j). mRNA expression: n ≥ 7; protein secretion: n = 4. Statistics: Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test; T p < 0.1; * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 2. Impact of different extracellular NaCl concentrations for 48 h on relative Na+i content ((a); n = 7), Nfat5 mRNA (b), Il6 mRNA (c) and IL6 protein secretion (d), Ptgs2 mRNA (e) and PGE2 secretion (f), Opg mRNA (g) and OPG protein secretion (h), as well as Rankl mRNA (i) and RANKL protein secretion (j). mRNA expression: n ≥ 7; protein secretion: n = 4. Statistics: Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test; T p < 0.1; * p < 0.05; ** p < 0.01; *** p < 0.001.
Cells 13 00496 g002
Cells 13 00496 g003aCells 13 00496 g003b
Figure 3. Impact of different extracellular NaCl concentrations during static pressure application on relative Na+i ((a); n = 7), Nfat5 (b), IL6 mRNA (c) and protein secretion (d), Ptgs2 mRNA (e) and PGE2 secretion (f), OPG mRNA (g) and protein secretion (h), as well as RANKL mRNA (i) and protein secretion (j). mRNA expression: n ≥ 7; protein secretion: n = 4. Statistics: Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test; T p < 0.1; * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 3. Impact of different extracellular NaCl concentrations during static pressure application on relative Na+i ((a); n = 7), Nfat5 (b), IL6 mRNA (c) and protein secretion (d), Ptgs2 mRNA (e) and PGE2 secretion (f), OPG mRNA (g) and protein secretion (h), as well as RANKL mRNA (i) and protein secretion (j). mRNA expression: n ≥ 7; protein secretion: n = 4. Statistics: Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test; T p < 0.1; * p < 0.05; ** p < 0.01; *** p < 0.001.
Cells 13 00496 g003aCells 13 00496 g003b
Cells 13 00496 g004
Figure 4. Impact of different extracellular Na+ concentrations during intermittent tension on Nai+ level ((a); n = 8), Nfat5 (b), IL6 mRNA (c) and protein secretion (d), Ptgs2 mRNA (e) and PGE2 secretion ((f) OPG mRNA (g) and protein secretion (h), as well as RANKL mRNA (i) and protein secretion (j). mRNA expression: n ≥ 7; protein secretion: n = 4. Statistics: Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test; T p < 0.1; * p < 0.05; ** p < 0.01; *** p < 0.001.
Figure 4. Impact of different extracellular Na+ concentrations during intermittent tension on Nai+ level ((a); n = 8), Nfat5 (b), IL6 mRNA (c) and protein secretion (d), Ptgs2 mRNA (e) and PGE2 secretion ((f) OPG mRNA (g) and protein secretion (h), as well as RANKL mRNA (i) and protein secretion (j). mRNA expression: n ≥ 7; protein secretion: n = 4. Statistics: Welch-corrected ANOVA with Dunnett’s T3 multiple comparisons test; T p < 0.1; * p < 0.05; ** p < 0.01; *** p < 0.001.
Cells 13 00496 g004
Table 1. Reference (Hprt and Sdha) and target gene primers used for qPCR.
Table 1. Reference (Hprt and Sdha) and target gene primers used for qPCR.
GeneGene Name5′-Forward-Primer-3′5′-Reverse-Primer-3′
Hprthypoxanthine guanine phosphoribosyl transferaseAGCTTGCTGGTGAAAAGGACAGTCAAGGGCATATCCAACAAC
Il6Interleukin-6AAAGCCAGAGTCCTTCAGAGAGCCTTAGCCACTCCTTCTGTGAC
Nfat5nuclear factor of activated T-cellsAAATGACCTGTAGTTCTCTGCTTCGCTGTCGGTGACTGAGGTAG
OpgosteoprotegerinCCTTGCCCTGACCACTCTTATCACACACTCGGTTGTGGGT
Ptgs2prostaglandin endoperoxide synthase-2TCCCTGAAGCCGTACACATCTCCCCAAAGATAGCATCTGGAC
Ranklreceptor activatior of NF-κB ligandAAACGCAGATTTGCAGGACTCCCCCACAATGTGTTGCAGTTC
Sdhasuccinat dehydrogenase complex, subunit AAACACTGGAGGAAGCACACCAGTAGGAGCGGATAGCAGGAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Proff, A.; Nazet, U.; Schröder, A.; Jantsch, J. Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts. Cells 2024, 13, 496. https://doi.org/10.3390/cells13060496

AMA Style

Proff A, Nazet U, Schröder A, Jantsch J. Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts. Cells. 2024; 13(6):496. https://doi.org/10.3390/cells13060496

Chicago/Turabian Style

Proff, Annemarie, Ute Nazet, Agnes Schröder, and Jonathan Jantsch. 2024. "Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts" Cells 13, no. 6: 496. https://doi.org/10.3390/cells13060496

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop