An EPAC1/PDE1C-Signaling Axis Regulates Formation of Leading-Edge Protrusion in Polarized Human Arterial Vascular Smooth Muscle Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and siRNA Transient Transfections
2.2. Chemotactic Leading Edge Protrusion (LEP) Assay
2.3. Immunoblotting
2.4. RNA Isolation, Reverse Transcription, and qPCR
2.5. Statistical Analysis
3. Results
3.1. Pharmacological Inhibition, or RNAi-Mediated Silencing, of EPAC1 Reduces Formation of Leading-Edge Protrusions (LEPs) in HASMCs
3.2. Selective Pharmacological Inhibition of HASMC PDEs Differentially Impacts Their Capacity to Generate LEPs
3.3. Silencing HASMC EPAC1 Obviates PDE1 Inhibition-Directed LEP Formation
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Palmer, D.; Tsoi, K.; Maurice, D.H. Synergistic inhibition of vascular smooth muscle cell migration by phosphodiesterase 3 and phosphodiesterase 4 inhibitors. Circ. Res. 1998, 82, 852–861. [Google Scholar] [CrossRef] [PubMed]
- Lehrke, M.; Kahles, F.; Makowska, A.; Tilstam, P.V.; Diebold, S.; Marx, J.; Stohr, R.; Hess, K.; Endorf, E.B.; Bruemmer, D.; et al. PDE4 inhibition reduces neointima formation and inhibits VCAM-1 expression and histone methylation in an Epac-dependent manner. J. Mol. Cell Cardiol. 2015, 81, 23–33. [Google Scholar] [CrossRef] [PubMed]
- Maurice, D.H.; Ke, H.; Ahmad, F.; Wang, Y.; Chung, J.; Manganiello, V.C. Advances in targeting cyclic nucleotide phosphodiesterases. Nat. Rev. Drug Discov. 2014, 13, 290–314. [Google Scholar] [CrossRef] [PubMed]
- Howe, A.K. Regulation of actin-based cell migration by cAMP/PKA. Biochim. Biophys. Acta 2004, 1692, 159–174. [Google Scholar] [CrossRef] [PubMed]
- Sinha, C.; Ren, A.; Arora, K.; Moon, C.S.; Yarlagadda, S.; Woodrooffe, K.; Lin, S.; Schuetz, J.D.; Ziady, A.G.; Naren, A.P. PKA and actin play critical roles as downstream effectors in MRP4-mediated regulation of fibroblast migration. Cell Signal. 2015, 27, 1345–1355. [Google Scholar] [CrossRef]
- Benz, P.M.; Ding, Y.; Stingl, H.; Loot, A.E.; Zink, J.; Wittig, I.; Popp, R.; Fleming, I. AKAP12 deficiency impairs VEGF-induced endothelial cell migration and sprouting. Acta Physiol. 2019, e13325. [Google Scholar] [CrossRef]
- Sinha, C.; Ren, A.; Arora, K.; Moon, C.S.; Yarlagadda, S.; Zhang, W.; Cheepala, S.B.; Schuetz, J.D.; Naren, A.P. Multi-drug resistance protein 4 (MRP4)-mediated regulation of fibroblast cell migration reflects a dichotomous role of intracellular cyclic nucleotides. J. Biol. Chem. 2013, 288, 3786–3794. [Google Scholar] [CrossRef]
- Howe, A.K.; Baldor, L.C.; Hogan, B.P. Spatial regulation of the cAMP-dependent protein kinase during chemotactic cell migration. Proc. Natl. Acad. Sci. USA 2005, 102, 14320–14325. [Google Scholar] [CrossRef]
- Raymond, D.R.; Carter, R.L.; Ward, C.A.; Maurice, D.H. Distinct phosphodiesterase-4D variants integrate into protein kinase A-based signaling complexes in cardiac and vascular myocytes. Am. J. Physiol. Heart Circ. Physiol. 2009, 296, H263–H271. [Google Scholar] [CrossRef]
- Baillie, G.S.; Tejeda, G.S.; Kelly, M.P. Therapeutic targeting of 3’,5’-cyclic nucleotide phosphodiesterases: Inhibition and beyond. Nat. Rev. Drug Discov. 2019. [Google Scholar] [CrossRef]
- Bobin, P.; Belacel-Ouari, M.; Bedioune, I.; Zhang, L.; Leroy, J.; Leblais, V.; Fischmeister, R.; Vandecasteele, G. Cyclic nucleotide phosphodiesterases in heart and vessels: A therapeutic perspective. Arch. Cardiovasc. Dis. 2016, 109, 431–443. [Google Scholar] [CrossRef] [PubMed]
- Halls, M.L.; Cooper, D.M.F. Adenylyl cyclase signalling complexes - Pharmacological challenges and opportunities. Pharmacol. Ther. 2017, 172, 171–180. [Google Scholar] [CrossRef] [PubMed]
- Roberts, O.L.; Dart, C. cAMP signalling in the vasculature: The role of Epac (exchange protein directly activated by cAMP). Biochem. Soc. Trans. 2014, 42, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Metrich, M.; Berthouze, M.; Morel, E.; Crozatier, B.; Gomez, A.M.; Lezoualc’h, F. Role of the cAMP-binding protein Epac in cardiovascular physiology and pathophysiology. Pflugers Arch. 2010, 459, 535–546. [Google Scholar] [CrossRef]
- Afewerki, T.; Ahmed, S.; Warren, D. Emerging regulators of vascular smooth muscle cell migration. J. Muscle Res. Cell Motil. 2019. [Google Scholar] [CrossRef]
- Moss, S.C.; Bates, M.; Parrino, P.E.; Woods, T.C. Isolation of endothelial cells and vascular smooth muscle cells from internal mammary artery tissue. Ochsner J. 2007, 7, 133–136. [Google Scholar]
- Cho, S.Y.; Klemke, R.L. Purification of pseudopodia from polarized cells reveals redistribution and activation of Rac through assembly of a CAS/Crk scaffold. J. Cell Biol. 2002, 156, 725–736. [Google Scholar] [CrossRef]
- Schmidt, M.; Dekker, F.J.; Maarsingh, H. Exchange protein directly activated by cAMP (epac): A multidomain cAMP mediator in the regulation of diverse biological functions. Pharmacol. Rev. 2013, 65, 670–709. [Google Scholar] [CrossRef]
- Rampersad, S.N.; Freitag, S.I.; Hubert, F.; Brzezinska, P.; Butler, N.; Umana, M.B.; Wudwud, A.R.; Maurice, D.H. EPAC1 promotes adaptive responses in human arterial endothelial cells subjected to low levels of laminar fluid shear stress: Implications in flow-related endothelial dysfunction. Cell Signal. 2016, 28, 606–619. [Google Scholar] [CrossRef]
- MacKeil, J.L.; Brzezinska, P.; Burke-Kleinman, J.; Craig, A.W.; Nicol, C.J.B.; Maurice, D.H. A PKA/cdc42 Signaling Axis Restricts Angiogenic Sprouting by Regulating Podosome Rosette Biogenesis and Matrix Remodeling. Sci. Rep. 2019, 9, 2385. [Google Scholar] [CrossRef]
- Cai, Y.; Nagel, D.J.; Zhou, Q.; Cygnar, K.D.; Zhao, H.; Li, F.; Pi, X.; Knight, P.A.; Yan, C. Role of cAMP-phosphodiesterase 1C signaling in regulating growth factor receptor stability, vascular smooth muscle cell growth, migration, and neointimal hyperplasia. Circ. Res. 2015, 116, 1120–1132. [Google Scholar] [CrossRef] [PubMed]
- Rose, R.J.; Liu, H.; Palmer, D.; Maurice, D.H. Cyclic AMP-mediated regulation of vascular smooth muscle cell cyclic AMP phosphodiesterase activity. Br. J. Pharmacol. 1997, 122, 233–240. [Google Scholar] [CrossRef] [PubMed]
- Ahn, H.S.; Bercovici, A.; Boykow, G.; Bronnenkant, A.; Chackalamannil, S.; Chow, J.; Cleven, R.; Cook, J.; Czarniecki, M.; Domalski, C.; et al. Potent tetracyclic guanine inhibitors of PDE1 and PDE5 cyclic guanosine monophosphate phosphodiesterases with oral antihypertensive activity. J. Med. Chem. 1997, 40, 2196–2210. [Google Scholar] [CrossRef] [PubMed]
- Dyck, B.; Branstetter, B.; Gharbaoui, T.; Hudson, A.R.; Breitenbucher, J.G.; Gomez, L.; Botrous, I.; Marrone, T.; Barido, R.; Allerston, C.K.; et al. Discovery of Selective Phosphodiesterase 1 Inhibitors with Memory Enhancing Properties. J. Med. Chem. 2017, 60, 3472–3483. [Google Scholar] [CrossRef]
- Humphrey, J.M.; Movsesian, M.; Am Ende, C.W.; Becker, S.L.; Chappie, T.A.; Jenkinson, S.; Liras, J.L.; Liras, S.; Orozco, C.; Pandit, J.; et al. Discovery of Potent and Selective Periphery-Restricted Quinazoline Inhibitors of the Cyclic Nucleotide Phosphodiesterase PDE1. J. Med. Chem. 2018, 61, 4635–4640. [Google Scholar] [CrossRef]
- Yokoyama, U.; Minamisawa, S.; Quan, H.; Akaike, T.; Jin, M.; Otsu, K.; Ulucan, C.; Wang, X.; Baljinnyam, E.; Takaoka, M.; et al. Epac1 is upregulated during neointima formation and promotes vascular smooth muscle cell migration. Am. J. Physiol. Heart Circ. Physiol. 2008, 295, H1547–H1555. [Google Scholar] [CrossRef]
- Kato, Y.; Yokoyama, U.; Yanai, C.; Ishige, R.; Kurotaki, D.; Umemura, M.; Fujita, T.; Kubota, T.; Okumura, S.; Sata, M.; et al. Epac1 Deficiency Attenuated Vascular Smooth Muscle Cell Migration and Neointimal Formation. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 2617–2625. [Google Scholar] [CrossRef]
- McKean, J.S.; Murray, F.; Gibson, G.; Shewan, D.A.; Tucker, S.J.; Nixon, G.F. The cAMP-producing agonist beraprost inhibits human vascular smooth muscle cell migration via exchange protein directly activated by cAMP. Cardiovasc. Res. 2015, 107, 546–555. [Google Scholar] [CrossRef]
- Adderley, S.P.; Martin, D.N.; Tulis, D.A. Exchange protein activated by cAMP (EPAC) controls migration of vascular smooth muscle cells in concentration- and timedependent manner. Arch. Physiol. 2015, 2. [Google Scholar] [CrossRef]
- Brzezinska, P.; Payne, D.; Rampersad, S.; MacKeil, J.; Burke-Kleinman, J.; Maurice, D. PDE1C regulates the dynamics of actin-based structures in migrating human arterial smooth muscle cells. FASEB J. 2017, 31, 826. [Google Scholar]
- Tsai, F.C.; Seki, A.; Yang, H.W.; Hayer, A.; Carrasco, S.; Malmersjo, S.; Meyer, T. A polarized Ca2+, diacylglycerol and STIM1 signalling system regulates directed cell migration. Nat. Cell Biol. 2014, 16, 133–144. [Google Scholar] [CrossRef] [PubMed]
- Eid, A.H. cAMP induces adhesion of microvascular smooth muscle cells to fibronectin via an Epac-mediated but PKA-independent mechanism. Cell Physiol. Biochem. 2012, 30, 247–258. [Google Scholar] [CrossRef] [PubMed]
- Sehrawat, S.; Ernandez, T.; Cullere, X.; Takahashi, M.; Ono, Y.; Komarova, Y.; Mayadas, T.N. AKAP9 regulation of microtubule dynamics promotes Epac1-induced endothelial barrier properties. Blood 2011, 117, 708–718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujita, H.; Fukuhara, S.; Sakurai, A.; Yamagishi, A.; Kamioka, Y.; Nakaoka, Y.; Masuda, M.; Mochizuki, N. Local activation of Rap1 contributes to directional vascular endothelial cell migration accompanied by extension of microtubules on which RAPL, a Rap1-associating molecule, localizes. J. Biol. Chem. 2005, 280, 5022–5031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, N.; Gupta, S.; Dabral, S.; Singh, S.; Sehrawat, S. Role of exchange protein directly activated by cAMP (EPAC1) in breast cancer cell migration and apoptosis. Mol. Cell Biochem. 2017, 430, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Akiyama, H.; Fukuda, T.; Tojima, T.; Nikolaev, V.O.; Kamiguchi, H. Cyclic Nucleotide Control of Microtubule Dynamics for Axon Guidance. J. Neurosci. 2016, 36, 5636–5649. [Google Scholar] [CrossRef] [Green Version]
- Hayashi, K.; Yamamoto, T.S.; Ueno, N. Intracellular calcium signal at the leading edge regulates mesodermal sheet migration during Xenopus gastrulation. Sci. Rep. 2018, 8, 2433. [Google Scholar] [CrossRef] [Green Version]
- Tsai, F.C.; Kuo, G.H.; Chang, S.W.; Tsai, P.J. Ca2+ signaling in cytoskeletal reorganization, cell migration, and cancer metastasis. Biomed. Res. Int. 2015, 2015, 409245. [Google Scholar] [CrossRef] [Green Version]
- Rybalkin, S.D.; Bornfeldt, K.E.; Sonnenburg, W.K.; Rybalkina, I.G.; Kwak, K.S.; Hanson, K.; Krebs, E.G.; Beavo, J.A. Calmodulin-stimulated cyclic nucleotide phosphodiesterase (PDE1C) is induced in human arterial smooth muscle cells of the synthetic, proliferative phenotype. J. Clin. Invest. 1997, 100, 2611–2621. [Google Scholar] [CrossRef] [Green Version]
- Rybalkin, S.D.; Rybalkina, I.; Beavo, J.A.; Bornfeldt, K.E. Cyclic nucleotide phosphodiesterase 1C promotes human arterial smooth muscle cell proliferation. Circ. Res. 2002, 90, 151–157. [Google Scholar] [CrossRef]
Target | siRNA ID | Sense | Antisense |
---|---|---|---|
PDE1C # 1 | PDE1CHSS107703 | 5′-UAUAGCAAAGAUCUCCAGCUCCGUC-3′ | 5′-CACCAGCUGUUA UUGAGGCAUUAAA-3′ |
PDE1C # 2 | PDE1CHSS182019 | 5′-CACCAGCUGUUAUUGAGGCAUUAAA-3′ | 5′-UUUAAUGCCUCAAUAACAGCUGGUG-3′ |
EPAC1 | RAPGEF3HSS115938 | 5′-CCUCAAGGAGCAGAAGAAUCUCAAU-3′ | 5′-AUUGAGAUUCUUCUGCUCCUUGAGG-3′ |
Gene | Forward | Reverse |
---|---|---|
TBP | TATAATCCCAAGCGGTTTGC | GCTGGAAAACCCAACTTCTG |
PGK | CTGTGGGGGTATTTGAATGG | CTTCCAGGAGCTCCAAACTG |
PDE1C | CAGCAAAAGCATGGGACCTC | TGAAGGTGGGTTCCACGATG |
Treatment | Density of LEPs on Bottom of Transwells (% of Control) |
---|---|
DMSO | 100 ± 5 |
C33 1 µM | 178 ± 12 1 |
Ro 20-1724 10 µM | 78 ± 14 |
Cilostamide 5 µM | 46 ± 3 1 |
Density of LEPs on Bottom of Transwells (% of Control) | ||
---|---|---|
Treatment | ||
DMSO | C33 1 µM | |
siCtrl | 100 ± 7.1 | 175 ± 17 1,2 |
si1C | 196 ± 11 1,2 | 192 ± 15 1,2 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brzezinska, P.; Maurice, D.H. An EPAC1/PDE1C-Signaling Axis Regulates Formation of Leading-Edge Protrusion in Polarized Human Arterial Vascular Smooth Muscle Cells. Cells 2019, 8, 1473. https://doi.org/10.3390/cells8121473
Brzezinska P, Maurice DH. An EPAC1/PDE1C-Signaling Axis Regulates Formation of Leading-Edge Protrusion in Polarized Human Arterial Vascular Smooth Muscle Cells. Cells. 2019; 8(12):1473. https://doi.org/10.3390/cells8121473
Chicago/Turabian StyleBrzezinska, Paulina, and Donald H. Maurice. 2019. "An EPAC1/PDE1C-Signaling Axis Regulates Formation of Leading-Edge Protrusion in Polarized Human Arterial Vascular Smooth Muscle Cells" Cells 8, no. 12: 1473. https://doi.org/10.3390/cells8121473