Zika Virus Induces Tumor Necrosis Factor-Related Apoptosis Inducing Ligand (TRAIL)-Mediated Apoptosis in Human Neural Progenitor Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, and Reagents
2.2. ZIKV Infection and Drug Treatment
2.3. Transmission Electron Microscopy (TEM)
2.4. Cell Viability and Cytotoxicity Assay
2.5. Flow Cytometry
2.6. Caspase Activity Assay
2.7. Quantitative Real-Time PCR (qRT-PCR)
2.8. Western Blotting
2.9. siRNA Transfection
2.10. Enzyme-Linked Immunosorbent Assay (ELISA)
2.11. Statistical Analysis
3. Results
3.1. Both African and Asian Lineage ZIKV Infection Results in the Activation of Apoptotic Signaling
3.2. ZIKV-Mediated Cell Death Is Involved in the Regulation of the Inflammatory Response
3.3. TRAIL-Mediated Apoptosis Is Important for Controlling ZIKV-Mediated Cell Death in hNPCs
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Dick, G.W.; Kitchen, S.F.; Haddow, A.J. Zika virus. I. Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. [Google Scholar] [CrossRef]
- Lee, J.K.; Shin, O.S. Advances in Zika Virus(-)Host Cell Interaction: Current Knowledge and Future Perspectives. Int. J. Mol. Sci. 2019, 20, 1101. [Google Scholar] [CrossRef] [Green Version]
- Musso, D.; Ko, A.I.; Baud, D. Zika Virus Infection—After the Pandemic. N. Engl. J. Med. 2019, 381, 1444–1457. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.K.; Oh, S.J.; Park, H.; Shin, O.S. Recent Updates on Research Models and Tools to Study Virus-Host Interactions at the Placenta. Viruses 2019, 12, 5. [Google Scholar] [CrossRef] [Green Version]
- Mlakar, J.; Korva, M.; Tul, N.; Popovic, M.; Poljsak-Prijatelj, M.; Mraz, J.; Kolenc, M.; Resman Rus, K.; Vesnaver Vipotnik, T.; Fabjan Vodusek, V.; et al. Zika Virus Associated with Microcephaly. N. Engl. J. Med. 2016, 374, 951–958. [Google Scholar] [CrossRef]
- Tang, H.; Hammack, C.; Ogden, S.C.; Wen, Z.; Qian, X.; Li, Y.; Yao, B.; Shin, J.; Zhang, F.; Lee, E.M.; et al. Zika Virus Infects Human Cortical Neural Progenitors and Attenuates Their Growth. Cell Stem Cell 2016, 18, 587–590. [Google Scholar] [CrossRef] [Green Version]
- Anfasa, F.; Siegers, J.Y.; van der Kroeg, M.; Mumtaz, N.; Stalin Raj, V.; de Vrij, F.M.S.; Widagdo, W.; Gabriel, G.; Salinas, S.; Simonin, Y.; et al. Phenotypic Differences between Asian and African Lineage Zika Viruses in Human Neural Progenitor Cells. mSphere 2017, 2. [Google Scholar] [CrossRef] [Green Version]
- Dang, J.; Tiwari, S.K.; Lichinchi, G.; Qin, Y.; Patil, V.S.; Eroshkin, A.M.; Rana, T.M. Zika Virus Depletes Neural Progenitors in Human Cerebral Organoids through Activation of the Innate Immune Receptor TLR3. Cell Stem Cell 2016, 19, 258–265. [Google Scholar] [CrossRef] [Green Version]
- Devhare, P.; Meyer, K.; Steele, R.; Ray, R.B.; Ray, R. Zika virus infection dysregulates human neural stem cell growth and inhibits differentiation into neuroprogenitor cells. Cell Death Dis. 2017, 8, e3106. [Google Scholar] [CrossRef] [Green Version]
- Monel, B.; Compton, A.A.; Bruel, T.; Amraoui, S.; Burlaud-Gaillard, J.; Roy, N.; Guivel-Benhassine, F.; Porrot, F.; Genin, P.; Meertens, L.; et al. Zika virus induces massive cytoplasmic vacuolization and paraptosis-like death in infected cells. EMBO J. 2017, 36, 1653–1668. [Google Scholar] [CrossRef]
- Slomnicki, L.P.; Chung, D.H.; Parker, A.; Hermann, T.; Boyd, N.L.; Hetman, M. Ribosomal stress and Tp53-mediated neuronal apoptosis in response to capsid protein of the Zika virus. Sci. Rep. 2017, 7, 16652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Souza, B.S.; Sampaio, G.L.; Pereira, C.S.; Campos, G.S.; Sardi, S.I.; Freitas, L.A.; Figueira, C.P.; Paredes, B.D.; Nonaka, C.K.; Azevedo, C.M.; et al. Zika virus infection induces mitosis abnormalities and apoptotic cell death of human neural progenitor cells. Sci. Rep. 2016, 6, 39775. [Google Scholar] [CrossRef] [PubMed]
- Garcez, P.P.; Loiola, E.C.; da Costa, R.M.; Higa, L.M.; Trindade, P.; Delvecchio, R.; Nascimento, J.M.; Brindeiro, R.; Tanuri, A.; Rehen, S.K. Zika virus impairs growth in human neurospheres and brain organoids. Science 2016, 352, 816–818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferraris, P.; Cochet, M.; Hamel, R.; Gladwyn-Ng, I.; Alfano, C.; Diop, F.; Garcia, D.; Talignani, L.; Montero-Menei, C.N.; Nougairede, A.; et al. Zika virus differentially infects human neural progenitor cells according to their state of differentiation and dysregulates neurogenesis through the Notch pathway. Emerg. Microbes Infect. 2019, 8, 1003–1016. [Google Scholar] [CrossRef] [PubMed]
- Solomon, I.H.; Milner, D.A.; Folkerth, R.D. Neuropathology of Zika virus infection. J. Neuroinfectious Dis. 2016, 7, 220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, Z.; An, S.; Chen, J.; Zhang, S.; Tan, C.; Yu, J.; Ye, H.; Wu, Y.; Yuan, J.; Wu, J. Neural progenitor cell pyroptosis contributes to Zika virus-induced brain atrophy and represents a therapeutic target. Proc. Natl. Acad. Sci. USA 2020, 117, 23869–23878. [Google Scholar] [CrossRef] [PubMed]
- Daniels, B.P.; Kofman, S.B.; Smith, J.R.; Norris, G.T.; Snyder, A.G.; Kolb, J.P.; Gao, X.; Locasale, J.W.; Martinez, J.; Gale, M., Jr. The nucleotide sensor ZBP1 and kinase RIPK3 induce the enzyme IRG1 to promote an antiviral metabolic state in neurons. Immunity 2019, 50, 64–76.e64. [Google Scholar] [CrossRef] [Green Version]
- Peteranderl, C.; Herold, S. The Impact of the Interferon/TNF-Related Apoptosis-Inducing Ligand Signaling Axis on Disease Progression in Respiratory Viral Infection and Beyond. Front. Immunol. 2017, 8, 313. [Google Scholar] [CrossRef] [Green Version]
- Ellis, G.T.; Davidson, S.; Crotta, S.; Branzk, N.; Papayannopoulos, V.; Wack, A. TRAIL+ monocytes and monocyte-related cells cause lung damage and thereby increase susceptibility to influenza–S treptococcus pneumoniae coinfection. EMBO Rep. 2015, 16, 1203–1218. [Google Scholar] [CrossRef]
- Herold, S.; Steinmueller, M.; von Wulffen, W.; Cakarova, L.; Pinto, R.; Pleschka, S.; Mack, M.; Kuziel, W.A.; Corazza, N.; Brunner, T. Lung epithelial apoptosis in influenza virus pneumonia: The role of macrophage-expressed TNF-related apoptosis-inducing ligand. J. Exp. Med. 2008, 205, 3065–3077. [Google Scholar] [CrossRef]
- Brincks, E.L.; Katewa, A.; Kucaba, T.A.; Griffith, T.S.; Legge, K.L. CD8 T cells utilize TRAIL to control influenza virus infection. J. Immunol. 2008, 181, 4918–4925. [Google Scholar] [CrossRef] [PubMed]
- Brincks, E.L.; Gurung, P.; Langlois, R.A.; Hemann, E.A.; Legge, K.L.; Griffith, T.S. The magnitude of the T cell response to a clinically significant dose of influenza virus is regulated by TRAIL. J. Immunol. 2011, 187, 4581–4588. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kischkel, F.C.; Lawrence, D.A.; Chuntharapai, A.; Schow, P.; Kim, K.J.; Ashkenazi, A. Apo2L/TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5. Immunity 2000, 12, 611–620. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.A.; Seong, R.K.; Kumar, M.; Shin, O.S. Favipiravir and Ribavirin Inhibit Replication of Asian and African Strains of Zika Virus in Different Cell Models. Viruses 2018, 10, 72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.A.; Seong, R.K.; Son, S.W.; Shin, O.S. Insights into ZIKV-Mediated Innate Immune Responses in Human Dermal Fibroblasts and Epidermal Keratinocytes. J. Investig. Dermatol. 2019, 139, 391–399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, S.J.; Gim, J.A.; Lee, J.K.; Park, H.; Shin, O.S. Coxsackievirus B3 Infection of Human Neural Progenitor Cells Results in Distinct Expression Patterns of Innate Immune Genes. Viruses 2020, 12, 325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seong, R.K.; Lee, J.K.; Cho, G.J.; Kumar, M.; Shin, O.S. mRNA and miRNA profiling of Zika virus-infected human umbilical cord mesenchymal stem cells identifies miR-142-5p as an antiviral factor. Emerg. Microbes Infect. 2020, 9, 2061–2075. [Google Scholar] [CrossRef]
- Kim, J.A.; Park, S.K.; Seo, S.W.; Lee, C.H.; Shin, O.S. STING Is Involved in Antiviral Immune Response against VZV Infection via the Induction of Type I and III IFN Pathways. J. Investig. Dermatol. 2017, 137, 2101–2109. [Google Scholar] [CrossRef] [Green Version]
- Seong, R.K.; Seo, S.W.; Kim, J.A.; Fletcher, S.J.; Morgan, N.V.; Kumar, M.; Choi, Y.K.; Shin, O.S. Schlafen 14 (SLFN14) is a novel antiviral factor involved in the control of viral replication. Immunobiology 2017, 222, 979–988. [Google Scholar] [CrossRef]
- McGrath, E.L.; Rossi, S.L.; Gao, J.; Widen, S.G.; Grant, A.C.; Dunn, T.J.; Azar, S.R.; Roundy, C.M.; Xiong, Y.; Prusak, D.J.; et al. Differential Responses of Human Fetal Brain Neural Stem Cells to Zika Virus Infection. Stem Cell Rep. 2017, 8, 715–727. [Google Scholar] [CrossRef]
- Orzalli, M.H.; Kagan, J.C. Apoptosis and Necroptosis as Host Defense Strategies to Prevent Viral Infection. Trends Cell Biol. 2017, 27, 800–809. [Google Scholar] [CrossRef] [PubMed]
- Kvansakul, M.; Caria, S.; Hinds, M.G. The Bcl-2 Family in Host-Virus Interactions. Viruses 2017, 9, 290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, E.W.; Seo, J.; Jeong, M.; Lee, S.; Song, J. The roles of FADD in extrinsic apoptosis and necroptosis. BMB Rep. 2012, 45, 496–508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, E.W.; Kim, J.H.; Ahn, Y.H.; Seo, J.; Ko, A.; Jeong, M.; Kim, S.J.; Ro, J.Y.; Park, K.M.; Lee, H.W.; et al. Ubiquitination and degradation of the FADD adaptor protein regulate death receptor-mediated apoptosis and necroptosis. Nat. Commun. 2012, 3, 978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Olmo, I.G.; Carvalho, T.G.; Costa, V.V.; Alves-Silva, J.; Ferrari, C.Z.; Izidoro-Toledo, T.C.; da Silva, J.F.; Teixeira, A.L.; Souza, D.G.; Marques, J.T.; et al. Zika Virus Promotes Neuronal Cell Death in a Non-Cell Autonomous Manner by Triggering the Release of Neurotoxic Factors. Front. Immunol. 2017, 8, 1016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanners, N.W.; Eitson, J.L.; Usui, N.; Richardson, R.B.; Wexler, E.M.; Konopka, G.; Schoggins, J.W. Western Zika Virus in Human Fetal Neural Progenitors Persists Long Term with Partial Cytopathic and Limited Immunogenic Effects. Cell Rep. 2016, 15, 2315–2322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turpin, J.; Frumence, E.; Despres, P.; Viranaicken, W.; Krejbich-Trotot, P. The ZIKA Virus Delays Cell Death through the Anti-Apoptotic Bcl-2 Family Proteins. Cells 2019, 8, 1338. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Hammack, C.; Ogden, S.C.; Cheng, Y.; Lee, E.M.; Wen, Z.; Qian, X.; Nguyen, H.N.; Li, Y.; Yao, B.; et al. Molecular signatures associated with ZIKV exposure in human cortical neural progenitors. Nucleic Acids Res. 2016, 44, 8610–8620. [Google Scholar] [CrossRef]
- Gabriel, E.; Ramani, A.; Karow, U.; Gottardo, M.; Natarajan, K.; Gooi, L.M.; Goranci-Buzhala, G.; Krut, O.; Peters, F.; Nikolic, M.; et al. Recent Zika Virus Isolates Induce Premature Differentiation of Neural Progenitors in Human Brain Organoids. Cell Stem Cell 2017, 20, 397–406.e395. [Google Scholar] [CrossRef] [Green Version]
- Simonin, Y.; Loustalot, F.; Desmetz, C.; Foulongne, V.; Constant, O.; Fournier-Wirth, C.; Leon, F.; Moles, J.P.; Goubaud, A.; Lemaitre, J.M.; et al. Zika Virus Strains Potentially Display Different Infectious Profiles in Human Neural Cells. EBioMedicine 2016, 12, 161–169. [Google Scholar] [CrossRef] [Green Version]
- Ma, H.; Dang, Y.; Wu, Y.; Jia, G.; Anaya, E.; Zhang, J.; Abraham, S.; Choi, J.-G.; Shi, G.; Qi, L. A CRISPR-based screen identifies genes essential for West-Nile-virus-induced cell death. Cell Rep. 2015, 12, 673–683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marceau, C.D.; Puschnik, A.S.; Majzoub, K.; Ooi, Y.S.; Brewer, S.M.; Fuchs, G.; Swaminathan, K.; Mata, M.A.; Elias, J.E.; Sarnow, P. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature 2016, 535, 159–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, R.; Miner, J.J.; Gorman, M.J.; Rausch, K.; Ramage, H.; White, J.P.; Zuiani, A.; Zhang, P.; Fernandez, E.; Zhang, Q. A CRISPR screen defines a signal peptide processing pathway required by flaviviruses. Nature 2016, 535, 164–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, Q.; Luo, Z.; Zeng, J.; Chen, W.; Foo, S.S.; Lee, S.A.; Ge, J.; Wang, S.; Goldman, S.A.; Zlokovic, B.V.; et al. Zika Virus NS4A and NS4B Proteins Deregulate Akt-mTOR Signaling in Human Fetal Neural Stem Cells to Inhibit Neurogenesis and Induce Autophagy. Cell Stem Cell 2016, 19, 663–671. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishikawa, E.; Nakazawa, M.; Yoshinari, M.; Minami, M. Role of tumor necrosis factor-related apoptosis-inducing ligand in immune response to influenza virus infection in mice. J. Virol. 2005, 79, 7658–7663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gyurkovska, V.; Ivanovska, N. Distinct roles of TNF-related apoptosis-inducing ligand (TRAIL) in viral and bacterial infections: From pathogenesis to pathogen clearance. Inflamm. Res. 2016, 65, 427–437. [Google Scholar] [CrossRef]
- Zhou, W.; Yuan, J. Necroptosis in health and diseases. In Seminars in Cell & Developmental Biology; Academic Press: Cambridge, MA, USA, 2014; pp. 14–23. [Google Scholar]
- Diehl, G.E.; Yue, H.H.; Hsieh, K.; Kuang, A.A.; Ho, M.; Morici, L.A.; Lenz, L.L.; Cado, D.; Riley, L.W.; Winoto, A. TRAIL-R as a negative regulator of innate immune cell responses. Immunity 2004, 21, 877–889. [Google Scholar] [CrossRef] [Green Version]
- Martines, R.B.; Bhatnagar, J.; de Oliveira Ramos, A.M.; Davi, H.P.F.; Iglezias, S.D.A.; Kanamura, C.T.; Keating, M.K.; Hale, G.; Silva-Flannery, L.; Muehlenbachs, A. Pathology of congenital Zika syndrome in Brazil: A case series. Lancet 2016, 388, 898–904. [Google Scholar] [CrossRef] [Green Version]
- Martines, R.B. Notes from the field: Evidence of Zika virus infection in brain and placental tissues from two congenitally infected newborns and two fetal losses—Brazil, 2015. Morb. Mortal. Wkly. Rep. 2016, 65, 159–160. [Google Scholar] [CrossRef] [Green Version]
- Schroder, K.; Tschopp, J. The inflammasomes. Cell 2010, 140, 821–832. [Google Scholar] [CrossRef] [Green Version]
- Man, S.M.; Karki, R.; Kanneganti, T.D. Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol. Rev. 2017, 277, 61–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, Y.; Liu, Q.; Wu, Y.; Ma, L.; Zhang, Z.; Liu, T.; Jin, S.; She, Y.; Li, Y.P.; Cui, J. Zika virus elicits inflammation to evade antiviral response by cleaving cGAS via NS 1-caspase-1 axis. EMBO J. 2018, 37, e99347. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Li, G.; Wu, D.; Luo, Z.; Pan, P.; Tian, M.; Wang, Y.; Xiao, F.; Li, A.; Wu, K. Zika virus infection induces host inflammatory responses by facilitating NLRP3 inflammasome assembly and interleukin-1β secretion. Nat. Commun. 2018, 9, 106. [Google Scholar] [CrossRef] [PubMed]
- Khaiboullina, S.F.; Uppal, T.; Sarkar, R.; Gorzalski, A.; St Jeor, S.; Verma, S.C. ZIKV infection regulates inflammasomes pathway for replication in monocytes. Sci. Rep. 2017, 7, 16050. [Google Scholar] [CrossRef] [Green Version]
- Figueiredo, C.P.; Barros-Aragão, F.G.; Neris, R.L.; Frost, P.S.; Soares, C.; Souza, I.N.; Zeidler, J.D.; Zamberlan, D.C.; de Sousa, V.L.; Souza, A.S. Zika virus replicates in adult human brain tissue and impairs synapses and memory in mice. Nat. Commun. 2019, 10, 3890. [Google Scholar] [CrossRef] [Green Version]
- de Sousa, J.R.; da Silva Azevedo, R.d.S.; Martins Filho, A.J.; de Araujo, M.T.F.; Cruz, E.d.R.M.; Vasconcelos, B.C.B.; Cruz, A.C.R.; de Oliveira, C.S.; Martins, L.C.; Vasconcelos, B.H.B. In situ inflammasome activation results in severe damage to the central nervous system in fatal Zika virus microcephaly cases. Cytokine 2018, 111, 255–264. [Google Scholar] [CrossRef]
Gene List | Primer-Forward | Primer-Reverse |
---|---|---|
BCL2 | CTGCACCTGACGCCCTTCACC | CACATGACCCCACCGAACTCAAAGA |
BAX | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT |
FADD | GCTGGCTCGTCAGCTCAAA | ACTGTTGCGTTCTCCTTCTCT |
TRAIL | TGCGTGCTGATCGTGATCTTC | GCTCGTTGGTAAAGTACACGTA |
TRAIL-R1 | ACCTTCAAGTTTGTCGTCGTC | CCAAAGGGCTATGTTCCCATT |
TRAIL-R2 | GCCCCACAACAAAAGAGGTC | AGGTCATTCCAGTGAGTGCTA |
ZIKVvRNA | AGATGACTGCGTTGTGAAGC | GAGCAGAACGGGACTTCTTC |
ZIKV E | TATCAGTGCATGGCTCCCAGCATA | TCCTAAGCTTCCAAAGCCTCCCAA |
ZIKV NS5 | CCTTGGATTCTTGAACGAGGA | AGAGCTTCATTCTCCAGATCAA |
β-actin | GAGCACAGAGCCTCGCCTTT | ACATGCCGGAGCCGTTGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.K.; Kim, J.-A.; Oh, S.-J.; Lee, E.-W.; Shin, O.S. Zika Virus Induces Tumor Necrosis Factor-Related Apoptosis Inducing Ligand (TRAIL)-Mediated Apoptosis in Human Neural Progenitor Cells. Cells 2020, 9, 2487. https://doi.org/10.3390/cells9112487
Lee JK, Kim J-A, Oh S-J, Lee E-W, Shin OS. Zika Virus Induces Tumor Necrosis Factor-Related Apoptosis Inducing Ligand (TRAIL)-Mediated Apoptosis in Human Neural Progenitor Cells. Cells. 2020; 9(11):2487. https://doi.org/10.3390/cells9112487
Chicago/Turabian StyleLee, Jae Kyung, Ji-Ae Kim, Soo-Jin Oh, Eun-Woo Lee, and Ok Sarah Shin. 2020. "Zika Virus Induces Tumor Necrosis Factor-Related Apoptosis Inducing Ligand (TRAIL)-Mediated Apoptosis in Human Neural Progenitor Cells" Cells 9, no. 11: 2487. https://doi.org/10.3390/cells9112487