The Chymase Mouse Mast Cell Protease-4 Regulates Intestinal Cytokine Expression in Mature Adult Mice Infected with Giardia intestinalis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Giardia Trophozoites
2.2. Mouse Breeding and Ethical Statement
2.3. Infections and Scoring of Mice
2.4. Genotyping of the mMCP-4 Mice
2.5. Nested PCR Assay for Detection of Giardia DNA
2.6. Sampling of Tissues and Morphological Staining
2.7. Determination of Intestinal Trypsin-Like, Chymotrypsin-Like, Neutrophil Elastase (NE), and Myeloperoxidase (MPO) Activity
2.8. ELISA Assay for IL-6 Detection in Serum and Intestinal Tissues
2.9. RNA Extraction and qPCR Detection of Chemokine and Cytokine Expressions in the Intestine
2.10. Statistical Analysis
3. Results
3.1. Chymase-Deficient Mice Show Increased Weight Loss during Giardia Intestinalis Infections
3.2. Giardia-Infected Mice Show Increased Mast Cell and Granulocyte Counts in the Small Intestine but Decreased Neutrophil Elastase Activity
3.3. Increased Expression Levels of IL-6 in Serum and Intestinal Tissue in Giardia-Infected Mice
3.4. Giardia-Infected mMCP-4-Deficient Mice Show Reduced Expression of Alarmin and Chemokine Expression
3.5. Giardia-Infection in mMCP-4-Deficient Mice Affects the Th1-, Th2-, Th17-, and Treg-Induced Cytokine Profile
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Caccio, S.M.; Lalle, M.; Svard, S.G. Host specificity in the Giardia duodenalis species complex. Infect. Genet. Evol. 2017. [Google Scholar] [CrossRef] [PubMed]
- Roxstrom-Lindquist, K.; Palm, D.; Reiner, D.; Ringqvist, E.; Svard, S.G. Giardia immunity—An update. Trends Parasitol. 2006, 22, 26–31. [Google Scholar] [CrossRef] [PubMed]
- Yason, J.A.; Rivera, W.L. Genotyping of Giardia duodenalis isolates among residents of slum area in Manila, Philippines. Parasitol. Res. 2007, 101, 681–687. [Google Scholar] [CrossRef] [PubMed]
- Karanis, P.; Kourenti, C.; Smith, H. Waterborne transmission of protozoan parasites: A worldwide review of outbreaks and lessons learnt. J. Water Health 2007, 5, 1–38. [Google Scholar] [CrossRef] [PubMed]
- Donowitz, J.R.; Alam, M.; Kabir, M.; Ma, J.Z.; Nazib, F.; Platts-Mills, J.A.; Bartelt, L.A.; Haque, R.; Petri, W.A., Jr. A Prospective Longitudinal Cohort to Investigate the Effects of Early Life Giardiasis on Growth and All Cause Diarrhea. Clin. Infect. Dis. 2016, 63, 792–797. [Google Scholar] [CrossRef]
- Rogawski, E.T.; Liu, J.; Platts-Mills, J.A.; Kabir, F.; Lertsethtakarn, P.; Siguas, M.; Khan, S.S.; Praharaj, I.; Murei, A.; Nshama, R.; et al. Use of quantitative molecular diagnostic methods to investigate the effect of enteropathogen infections on linear growth in children in low-resource settings: Longitudinal analysis of results from the MAL-ED cohort study. Lancet Glob. Health 2018. [Google Scholar] [CrossRef] [Green Version]
- Bartelt, L.A.; Bolick, D.T.; Mayneris-Perxachs, J.; Kolling, G.L.; Medlock, G.L.; Zaenker, E.I.; Donowitz, J.; Thomas-Beckett, R.V.; Rogala, A.; Carroll, I.M.; et al. Cross-modulation of pathogen-specific pathways enhances malnutrition during enteric co-infection with Giardia lamblia and enteroaggregative Escherichia coli. PLoS Pathog. 2017, 13, e1006471. [Google Scholar] [CrossRef]
- Bartelt, L.A.; Roche, J.; Kolling, G.; Bolick, D.; Noronha, F.; Naylor, C.; Hoffman, P.; Warren, C.; Singer, S.; Guerrant, R. Persistent G. lamblia impairs growth in a murine malnutrition model. J. Clin. Investig. 2013, 123, 2672–2684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cusack, M.A.; O’Mahony, M.S.; Woodhouse, K. Giardia in older people. Age Ageing 2001, 30, 419–421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Halliez, M.C.; Buret, A.G. Extra-intestinal and long term consequences of Giardia duodenalis infections. World J. Gastroenterol. 2013, 19, 8974–8985. [Google Scholar] [CrossRef]
- Soenen, S.; Rayner, C.K.; Jones, K.L.; Horowitz, M. The ageing gastrointestinal tract. Curr. Opin. Clin. Nutr. Metab. Care 2016, 19, 12–18. [Google Scholar] [CrossRef] [PubMed]
- Einarsson, E.; Ma’ayeh, S.; Svard, S.G. An up-date on Giardia and giardiasis. Curr. Opin. Microbiol. 2016, 34, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Ringqvist, E.; Palm, J.E.; Skarin, H.; Hehl, A.B.; Weiland, M.; Davids, B.J.; Reiner, D.S.; Griffiths, W.J.; Eckmann, L.; Gillin, F.D.; et al. Release of metabolic enzymes by Giardia in response to interaction with intestinal epithelial cells. Mol. Biochem. Parasitol. 2008, 159, 85–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dubourg, A.; Xia, D.; Winpenny, J.P.; Al Naimi, S.; Bouzid, M.; Sexton, D.W.; Wastling, J.M.; Hunter, P.R.; Tyler, K.M. Giardia secretome highlights secreted tenascins as a key component of pathogenesis. Gigascience 2018, 7, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Ma’ayeh, S.Y.; Liu, J.; Peirasmaki, D.; Hornaeus, K.; Bergstrom Lind, S.; Grabherr, M.; Bergquist, J.; Svard, S.G. Characterization of the Giardia intestinalis secretome during interaction with human intestinal epithelial cells: The impact on host cells. PLoS Negl. Trop Dis. 2017, 11, e0006120. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Ma’ayeh, S.; Peirasmaki, D.; Lundstrom-Stadelmann, B.; Hellman, L.; Svard, S.G. Secreted Giardia intestinalis cysteine proteases disrupt intestinal epithelial cell junctional complexes and degrade chemokines. Virulence 2018, 9, 879–894. [Google Scholar] [CrossRef] [Green Version]
- Solaymani-Mohammadi, S.; Singer, S.M. Giardia duodenalis: The double-edged sword of immune responses in giardiasis. Exp. Parasitol. 2010, 126, 292–297. [Google Scholar] [CrossRef] [Green Version]
- Heyworth, M.F. Immunological aspects of Giardia infections. Parasite 2014, 21, 55. [Google Scholar] [CrossRef] [Green Version]
- Fink, M.Y.; Singer, S.M. The Intersection of Immune Responses, Microbiota, and Pathogenesis in Giardiasis. Trends Parasitol. 2017, 33, 901–913. [Google Scholar] [CrossRef]
- Serradell, M.C.; Gargantini, P.R.; Saura, A.; Oms, S.R.; Rupil, L.L.; Berod, L.; Sparwasser, T.; Lujan, H.D. Cytokines, Antibodies, and Histopathological Profiles during Giardia Infection and Variant-Specific Surface Protein-Based Vaccination. Infect. Immun. 2018, 86. [Google Scholar] [CrossRef] [Green Version]
- Ma’ayeh, S.Y.; Knorr, L.; Skold, K.; Granham, A.; Ansell, B.R.E.; Jex, A.R.; Svard, S.G. Responses of the Differentiated Intestinal Epithelial Cell Line Caco-2 to Infection With the Giardia intestinalis GS Isolate. Front. Cell Infect. Microbiol. 2018, 8, 244, Corrigendum in 2018, 8, 297. [Google Scholar] [CrossRef] [Green Version]
- Tako, E.A.; Hassimi, M.F.; Li, E.; Singer, S.M. Transcriptomic analysis of the host response to Giardia duodenalis infection reveals redundant mechanisms for parasite control. MBio 2013, 4, e00660–e00713. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hardin, J.A.; Buret, A.G.; Olson, M.E.; Kimm, M.H.; Gall, D.G. Mast cell hyperplasia and increased macromolecular uptake in an animal model of giardiasis. J. Parasitol. 1997, 83, 908–912. [Google Scholar] [CrossRef] [PubMed]
- Venkatesan, P.; Finch, R.G.; Wakelin, D. A comparison of mucosal inflammatory responses to Giardia muris in resistant B10 and susceptible BALB/c mice. Parasite Immunol. 1997, 19, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Leitch, G.J.; Udezulu, I.A.; He, Q.; Visvesvara, G.S. Effects of protein malnutrition on experimental giardiasis in the Mongolian gerbil. Scand. J. Gastroenterol. 1993, 28, 885–893. [Google Scholar] [CrossRef] [PubMed]
- Li, E.; Zhou, P.; Petrin, Z.; Singer, S.M. Mast cell-dependent control of Giardia lamblia infections in mice. Infect. Immun. 2004, 72, 6642–6649. [Google Scholar] [CrossRef] [Green Version]
- Li, E.; Tako, E.A.; Singer, S.M. Complement Activation by Giardia duodenalis Parasites through the Lectin Pathway Contributes to Mast Cell Responses and Parasite Control. Infect. Immun. 2016, 84, 1092–1099. [Google Scholar] [CrossRef] [Green Version]
- Munoz-Cruz, S.; Gomez-Garcia, A.; Matadamas-Martinez, F.; Alvarado-Torres, J.A.; Meza-Cervantez, P.; Arriaga-Pizano, L.; Yepez-Mulia, L. Giardia lamblia: Identification of molecules that contribute to direct mast cell activation. Parasitol. Res. 2018, 117, 2555–2567. [Google Scholar] [CrossRef]
- Zhou, P.; Li, E.; Zhu, N.; Robertson, J.; Nash, T.; Singer, S.M. Role of interleukin-6 in the control of acute and chronic Giardia lamblia infections in mice. Infect. Immun. 2003, 71, 1566–1568. [Google Scholar] [CrossRef] [Green Version]
- Zhou, P.; Li, E.; Shea-Donohue, T.; Singer, S.M. Tumour necrosis factor alpha contributes to protection against Giardia lamblia infection in mice. Parasite Immunol. 2007, 29, 367–374. [Google Scholar] [CrossRef] [Green Version]
- Bienz, M.; Dai, W.J.; Welle, M.; Gottstein, B.; Muller, N. Interleukin-6-deficient mice are highly susceptible to Giardia lamblia infection but exhibit normal intestinal immunoglobulin A responses against the parasite. Infect. Immun. 2003, 71, 1569–1573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piliponsky, A.M.; Chen, C.C.; Rios, E.J.; Treuting, P.M.; Lahiri, A.; Abrink, M.; Pejler, G.; Tsai, M.; Galli, S.J. The chymase mouse mast cell protease 4 degrades TNF, limits inflammation, and promotes survival in a model of sepsis. Am. J. Pathol. 2012, 181, 875–886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nelissen, S.; Vangansewinkel, T.; Geurts, N.; Geboes, L.; Lemmens, E.; Vidal, P.M.; Lemmens, S.; Willems, L.; Boato, F.; Dooley, D.; et al. Mast cells protect from post-traumatic spinal cord damage in mice by degrading inflammation-associated cytokines via mouse mast cell protease 4. Neurobiol. Dis. 2014, 62, 260–272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Groschwitz, K.R.; Ahrens, R.; Osterfeld, H.; Gurish, M.F.; Han, X.; Abrink, M.; Finkelman, F.D.; Pejler, G.; Hogan, S.P. Mast cells regulate homeostatic intestinal epithelial migration and barrier function by a chymase/Mcpt4-dependent mechanism. Proc. Natl. Acad. Sci. USA 2009, 106, 22381–22386. [Google Scholar] [CrossRef] [Green Version]
- Li, E.; Zhao, A.; Shea-Donohue, T.; Singer, S.M. Mast cell-mediated changes in smooth muscle contractility during mouse giardiasis. Infect. Immun. 2007, 75, 4514–4518. [Google Scholar] [CrossRef] [Green Version]
- Miller, H.R.; Newlands, G.F.; McKellar, A.; Inglis, L.; Coulson, P.S.; Wilson, R.A. Hepatic recruitment of mast cells occurs in rats but not mice infected with Schistosoma mansoni. Parasite Immunol. 1994, 16, 145–155. [Google Scholar] [CrossRef]
- Miller, H.; Huntley, J.; Newlands, G. Mast cell chymases in helminthosis and hypersensitivity. Mast Cell Proteases Immunol. Biol. 1995, 203–235. [Google Scholar]
- Wastling, J.M.; Scudamore, C.L.; Thornton, E.M.; Newlands, G.F.; Miller, H.R. Constitutive expression of mouse mast cell protease-1 in normal BALB/c mice and its up-regulation during intestinal nematode infection. Immunology 1997, 90, 308–313. [Google Scholar] [CrossRef] [PubMed]
- Martins, P.R.; Nascimento, R.D.; de Souza Lisboa, A.; Martinelli, P.M.; d’Avila Reis, D. Neuroimmunopathology of Trypanosoma cruzi-induced megaoesophagus: Is there a role for mast cell proteases? Hum. Immunol. 2014, 75, 302–305. [Google Scholar] [CrossRef]
- Elderman, M.; Sovran, B.; Hugenholtz, F.; Graversen, K.; Huijskes, M.; Houtsma, E.; Belzer, C.; Boekschoten, M.; de Vos, P.; Dekker, J.; et al. The effect of age on the intestinal mucus thickness, microbiota composition and immunity in relation to sex in mice. PLoS ONE 2017, 12, e0184274. [Google Scholar] [CrossRef] [PubMed]
- Nash, T.E.; Herrington, D.A.; Losonsky, G.A.; Levine, M.M. Experimental human infections with Giardia lamblia. J. Infect. Dis. 1987, 156, 974–984. [Google Scholar] [CrossRef] [PubMed]
- Keister, D.B. Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Trans. R Soc. Trop Med. Hyg. 1983, 77, 487–488. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Akula, S.; Paivandy, A.; Fu, Z.; Thorpe, M.; Pejler, G.; Hellman, L. Quantitative In-Depth Analysis of the Mouse Mast Cell Transcriptome Reveals Organ-Specific Mast Cell Heterogeneity. Cells 2020, 9, 211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tchougounova, E.; Pejler, G.; Abrink, M. The chymase, mouse mast cell protease 4, constitutes the major chymotrypsin-like activity in peritoneum and ear tissue. A role for mouse mast cell protease 4 in thrombin regulation and fibronectin turnover. J. Exp. Med. 2003, 198, 423–431. [Google Scholar] [CrossRef] [PubMed]
- Stevens, R.L.; McNeil, H.P.; Wensing, L.A.; Shin, K.; Wong, G.W.; Hansbro, P.M.; Krilis, S.A. Experimental Arthritis Is Dependent on Mouse Mast Cell Protease-5. J. Biol. Chem. 2017, 292, 5392–5404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feyerabend, T.B.; Hausser, H.; Tietz, A.; Blum, C.; Hellman, L.; Straus, A.H.; Takahashi, H.K.; Morgan, E.S.; Dvorak, A.M.; Fehling, H.J.; et al. Loss of histochemical identity in mast cells lacking carboxypeptidase A. Mol. Cell Biol. 2005, 25, 6199–6210. [Google Scholar] [CrossRef] [Green Version]
- Forsberg, E.; Pejler, G.; Ringvall, M.; Lunderius, C.; Tomasini-Johansson, B.; Kusche-Gullberg, M.; Eriksson, I.; Ledin, J.; Hellman, L.; Kjellen, L. Abnormal mast cells in mice deficient in a heparin-synthesizing enzyme. Nature 1999, 400, 773–776. [Google Scholar] [CrossRef]
- Ohtsu, H.; Tanaka, S.; Terui, T.; Hori, Y.; Makabe-Kobayashi, Y.; Pejler, G.; Tchougounova, E.; Hellman, L.; Gertsenstein, M.; Hirasawa, N.; et al. Mice lacking histidine decarboxylase exhibit abnormal mast cells. FEBS Lett. 2001, 502, 53–56. [Google Scholar] [CrossRef] [Green Version]
- Tchougounova, E.; Lundequist, A.; Fajardo, I.; Winberg, J.O.; Abrink, M.; Pejler, G. A key role for mast cell chymase in the activation of pro-matrix metalloprotease-9 and pro-matrix metalloprotease-2. J. Biological. Chem. 2005, 280, 9291–9296. [Google Scholar] [CrossRef] [Green Version]
- Waern, I.; Jonasson, S.; Hjoberg, J.; Bucht, A.; Abrink, M.; Pejler, G.; Wernersson, S. Mouse Mast Cell Protease 4 Is the Major Chymase in Murine Airways and Has a Protective Role in Allergic Airway Inflammation. J. Immunol. 2009, 183, 6369–6376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scandiuzzi, L.; Beghdadi, W.; Daugas, E.; Abrink, M.; Tiwari, N.; Brochetta, C.; Claver, J.; Arouche, N.; Zang, X.X.; Pretolani, M.; et al. Mouse Mast Cell Protease-4 Deteriorates Renal Function by Contributing to Inflammation and Fibrosis in Immune Complex-Mediated Glomerulonephritis. J. Immunol. 2010, 185, 624–633. [Google Scholar] [CrossRef] [Green Version]
- Lin, L.; Bankaitis, E.; Heimbach, L.; Li, N.; Abrink, M.; Pejler, G.; An, L.J.; Diaz, L.A.; Werb, Z.; Liu, Z. Dual Targets for Mouse Mast Cell Protease-4 in Mediating Tissue Damage in Experimental Bullous Pemphigoid. J. Biol. Chem. 2011, 286, 37358–37367. [Google Scholar] [CrossRef] [Green Version]
- Magnusson, S.E.; Pejler, G.; Kleinau, S.; Abrink, M. Mast cell chymase contributes to the antibody response and the severity of autoimmune arthritis. Faseb J. 2009, 23, 875–882. [Google Scholar] [CrossRef] [PubMed]
- Reber, L.L.; Daubeuf, F.; Pejler, G.; Abrink, M.; Frossard, N. Mast Cells Contribute to Bleomycin-Induced Lung Inflammation and Injury in Mice through a Chymase/Mast Cell Protease 4-Dependent Mechanism. J. Immunol. 2014, 192, 1847–1854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vogel, P.; Janke, L.; Gravano, D.M.; Lu, M.; Sawant, D.V.; Bush, D.; Shuyu, E.; Vignali, D.A.A.; Pillai, A.; Rehg, J.E. Globule Leukocytes and Other Mast Cells in the Mouse Intestine. Vet. Pathol. 2018, 55, 76–97. [Google Scholar] [CrossRef] [Green Version]
- Friend, D.S.; Ghildyal, N.; Austen, K.F.; Gurish, M.F.; Matsumoto, R.; Stevens, R.L. Mast cells that reside at different locations in the jejunum of mice infected with Trichinella spiralis exhibit sequential changes in their granule ultrastructure and chymase phenotype. J. Cell Biol. 1996, 135, 279–290. [Google Scholar] [CrossRef] [Green Version]
- Roy, A.; Sawesi, O.; Pettersson, U.; Dagalv, A.; Kjellen, L.; Lunden, A.; Abrink, M. Serglycin proteoglycans limit enteropathy in Trichinella spiralis-infected mice. BMC Immunol. 2016, 17, 15. [Google Scholar] [CrossRef]
- Friend, D.S.; Ghildyal, N.; Gurish, M.F.; Hunt, J.; Hu, X.; Austen, K.F.; Stevens, R.L. Reversible expression of tryptases and chymases in the jejunal mast cells of mice infected with Trichinella spiralis. J. Immunol. 1998, 160, 5537–5545. [Google Scholar]
- Choi, H.W.; Bowen, S.E.; Miao, Y.; Chan, C.Y.; Miao, E.A.; Abrink, M.; Moeser, A.J.; Abraham, S.N. Loss of Bladder Epithelium Induced by Cytolytic Mast Cell Granules. Immunity 2016, 45, 1258–1269. [Google Scholar] [CrossRef] [Green Version]
- Barash, N.R.; Maloney, J.G.; Singer, S.M.; Dawson, S.C. Giardia Alters Commensal Microbial Diversity throughout the Murine Gut. Infect. Immun. 2017, 85. [Google Scholar] [CrossRef] [Green Version]
- Singer, S.M.; Nash, T.E. The role of normal flora in Giardia lamblia infections in mice. J. Infect. Dis. 2000, 181, 1510–1512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akahoshi, M.; Song, C.H.; Piliponsky, A.M.; Metz, M.; Guzzetta, A.; Abrink, M.; Schlenner, S.M.; Feyerabend, T.B.; Rodewald, H.R.; Pejler, G.; et al. Mast cell chymase reduces the toxicity of Gila monster venom, scorpion venom, and vasoactive intestinal polypeptide in mice. J. Clin. Investig. 2011, 121, 4180–4191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Casado-Bedmar, M.; Heil, S.D.S.; Myrelid, P.; Soderholm, J.D.; Keita, A.V. Upregulation of intestinal mucosal mast cells expressing VPAC1 in close proximity to vasoactive intestinal polypeptide in inflammatory bowel disease and murine colitis. Neurogastroenterol. Motil. 2019, 31, e13503. [Google Scholar] [CrossRef]
- Amat, C.B.; Motta, J.P.; Fekete, E.; Moreau, F.; Chadee, K.; Buret, A.G. Cysteine Protease-Dependent Mucous Disruptions and Differential Mucin Gene Expression in Giardia duodenalis Infection. Am. J. Pathol. 2017, 187, 2486–2498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barash, N.R.; Nosala, C.; Pham, J.K.; McInally, S.G.; Gourguechon, S.; McCarthy-Sinclair, B.; Dawson, S.C. Giardia Colonizes and Encysts in High-Density Foci in the Murine Small Intestine. mSphere 2017, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ekdahl, K.; Andersson, Y. Imported giardiasis: Impact of international travel, immigration, and adoption. Am. J. Trop Med. Hyg. 2005, 72, 825–830. [Google Scholar] [CrossRef] [Green Version]
- Neill, D.R.; Wong, S.H.; Bellosi, A.; Flynn, R.J.; Daly, M.; Langford, T.K.; Bucks, C.; Kane, C.M.; Fallon, P.G.; Pannell, R.; et al. Nuocytes represent a new innate effector leukocyte that mediates type-2 immunity. Nature 2010, 464, 1367–1370. [Google Scholar] [CrossRef] [Green Version]
- Kouzaki, H.; Tojima, I.; Kita, H.; Shimizu, T. Transcription of interleukin-25 and extracellular release of the protein is regulated by allergen proteases in airway epithelial cells. Am. J. Respir Cell Mol. Biol. 2013, 49, 741–750. [Google Scholar] [CrossRef] [Green Version]
- Lefrancais, E.; Duval, A.; Mirey, E.; Roga, S.; Espinosa, E.; Cayrol, C.; Girard, J.P. Central domain of IL-33 is cleaved by mast cell proteases for potent activation of group-2 innate lymphoid cells. Proc. Natl. Acad. Sci. USA 2014, 111, 15502–15507. [Google Scholar] [CrossRef] [Green Version]
- Fu, Z.; Thorpe, M.; Alemayehu, R.; Roy, A.; Kervinen, J.; de Garavilla, L.; Abrink, M.; Hellman, L. Highly Selective Cleavage of Cytokines and Chemokines by the Human Mast Cell Chymase and Neutrophil Cathepsin G. J. Immunol. 2017, 198, 1474–1483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roy, A.; Ganesh, G.; Sippola, H.; Bolin, S.; Sawesi, O.; Dagalv, A.; Schlenner, S.M.; Feyerabend, T.; Rodewald, H.R.; Kjellen, L.; et al. Mast cell chymase degrades the alarmins heat shock protein 70, biglycan, HMGB1, and interleukin-33 (IL-33) and limits danger-induced inflammation. J. Biol. Chem. 2014, 289, 237–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Solaymani-Mohammadi, S.; Singer, S.M. Host immunity and pathogen strain contribute to intestinal disaccharidase impairment following gut infection. J. Immunol. 2011, 187, 3769–3775. [Google Scholar] [CrossRef] [PubMed]
- Jimenez, J.C.; Fontaine, J.; Creusy, C.; Fleurisse, L.; Grzych, J.M.; Capron, M.; Dei-Cas, E. Antibody and cytokine responses to Giardia excretory/secretory proteins in Giardia intestinalis-infected BALB/c mice. Parasitol. Res. 2014, 113, 2709–2718. [Google Scholar] [CrossRef]
- Singer, S.M.; Nash, T.E. T-cell-dependent control of acute Giardia lamblia infections in mice. Infect. Immun. 2000, 68, 170–175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grit, G.H.; Van Coppernolle, S.; Devriendt, B.; Geurden, T.; Dreesen, L.; Hope, J.; Vercruysse, J.; Cox, E.; Geldhof, P.; Claerebout, E. Evaluation of cellular and humoral systemic immune response against Giardia duodenalis infection in cattle. Vet. Parasitol. 2014, 202, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Dreesen, L.; De Bosscher, K.; Grit, G.; Staels, B.; Lubberts, E.; Bauge, E.; Geldhof, P. Giardia muris infection in mice is associated with a protective interleukin 17A response and induction of peroxisome proliferator-activated receptor alpha. Infect. Immun. 2014, 82, 3333–3340. [Google Scholar] [CrossRef] [Green Version]
- Pham, C.T. Neutrophil serine proteases: Specific regulators of inflammation. Nat. Rev. Immunol. 2006, 6, 541–550. [Google Scholar] [CrossRef]
- Cole, A.M.; Shi, J.; Ceccarelli, A.; Kim, Y.H.; Park, A.; Ganz, T. Inhibition of neutrophil elastase prevents cathelicidin activation and impairs clearance of bacteria from wounds. Blood 2001, 97, 297–304. [Google Scholar] [CrossRef] [Green Version]
- Ribeiro-Gomes, F.L.; Moniz-de-Souza, M.C.; Alexandre-Moreira, M.S.; Dias, W.B.; Lopes, M.F.; Nunes, M.P.; Lungarella, G.; DosReis, G.A. Neutrophils activate macrophages for intracellular killing of Leishmania major through recruitment of TLR4 by neutrophil elastase. J. Immunol. 2007, 179, 3988–3994. [Google Scholar] [CrossRef] [Green Version]
- de Souza Carmo, E.V.; Katz, S.; Barbieri, C.L. Neutrophils reduce the parasite burden in Leishmania (Leishmania) amazonensis-infected macrophages. PLoS ONE 2010, 5, e13815. [Google Scholar] [CrossRef] [Green Version]
# Exp. | Gender | Number of Mice | Age (weeks) | Endpoint Days |
---|---|---|---|---|
#1 | F | +/+n = 7, +/− n = 9, −/− n = 5 | 23–36 | 22 |
#2 | F | +/+n = 5, +/− n = 6, −/− n = 9 | 22–29 | 13 |
M | +/+n = 5, +/− n = 6, −/− n = 3 | |||
#3a | F | +/+n = 1, +/− n = 2, −/− n = 2 | 18–20 | 13 |
M | +/+n = 0, +/− n = 4, −/− n = 1 | |||
#6 | F | +/+n = 3, +/− n = 6, −/− n = 3 | 24 | 8 |
M | +/+n = 6, +/− n = 5, −/− n = 1 | |||
#3b | F | +/+n = 1, +/− n = 5, −/− n = 1 | 7–13 | 13 |
M | +/+n = 1, +/− n = 5, −/− n = 2 | |||
#4 | F | +/+n = 1, +/− n = 3, −/− n = 3 | 10 | 13 |
M | +/+n = 1, +/− n = 4, −/− n = 0 | |||
#5 | F | +/+n = 0, +/− n = 2, −/− n = 1 | 10 | 8 |
M | +/+n = 2, +/− n = 3, −/− n = 2 |
Gene | Direction | Sequence |
---|---|---|
GAPDH | forward | CAAGCTCATTTCCTGGTATGACAAT |
reverse | CTCTCTTGCTCAGTGTCCTTGC | |
IL-25 | forward | GCTCCAGTCAGCCTCTCTC |
reverse | CTGCTCACCAGTCACAGGT | |
IL-33 | forward | TCTGCCCCTTCTTTGGTT |
reverse | GGGAGTAGGAGAGCCGTTAC | |
IL-6 | forward | TGGGACTGATGCTGGTGAC |
reverse | CACAACTCTTTTCTCATTTCCACG | |
TNF-ALFA (BOTH VARIANTS) | forward | ACGGCATGGATCTCAAAG |
reverse | TGGGAGTAGACAAGGTACAACC | |
CCL-2 | forward | CACTCACCTGCTGCTACTCATTC |
reverse | GGTGCTGAAGACCTTAGGGC | |
CXCL-2 | forward | ATACTGAACAAAGGCAAGGCTAACTG |
reverse | CTCAGACAGCGAGGCACATC | |
IL-2 | forward | TGTAAAACTAAAGGGCTCTGACA |
reverse | AGAAAGTCCACCACAGTTGCT | |
IL-12A (BOTH VARIANTS) | forward | GTCAATCACGCTACCTCCTCT |
reverse | CGGGACTGGCTAAGACAC | |
IL-4 (VARIANT 1) | forward | GCAACGAAGAACACCACAGAG |
reverse | GAAGCACCTTGGAAGCCCTA | |
IL-5 | forward | GAAATACATTGACCGCCAAAAAGT |
reverse | GCCTCAGCCTTCCATTGC | |
IL-9 | forward | CCTTGCCTCTGTTTTGCTCT |
reverse | ATCATCAGTTGGGACGGAGAG | |
IL-17A | forward | TCAGACTACCTCAACCGTTCC |
reverse | CTATCAGGGTCTTCATTGCG | |
IL-17C | forward | GAGATATCGCATCGACACAGA |
reverse | CATCCACGACACAAGCATT | |
TGFβ-1 | forward | CTGCTGACCCCCACTGATAC |
reverse | AAAGCCCTGTATTCCGTCTCC | |
IL-10 | forward | CCTGGTAGAAGTGATGCCCC |
reverse | ATTCAAATGCTCCTTGATTTCTGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Peirasmaki, D.; Svärd, S.; Åbrink, M. The Chymase Mouse Mast Cell Protease-4 Regulates Intestinal Cytokine Expression in Mature Adult Mice Infected with Giardia intestinalis. Cells 2020, 9, 925. https://doi.org/10.3390/cells9040925
Li Z, Peirasmaki D, Svärd S, Åbrink M. The Chymase Mouse Mast Cell Protease-4 Regulates Intestinal Cytokine Expression in Mature Adult Mice Infected with Giardia intestinalis. Cells. 2020; 9(4):925. https://doi.org/10.3390/cells9040925
Chicago/Turabian StyleLi, Zhiqiang, Dimitra Peirasmaki, Staffan Svärd, and Magnus Åbrink. 2020. "The Chymase Mouse Mast Cell Protease-4 Regulates Intestinal Cytokine Expression in Mature Adult Mice Infected with Giardia intestinalis" Cells 9, no. 4: 925. https://doi.org/10.3390/cells9040925