Chalcone Synthase-Encoding AeCHS is Involved in Normal Petal Coloration in Actinidia eriantha
Abstract
:1. Introduction
2. Materials and Methods
2.1. Flower Materials
2.2. Extraction and Determination of Anthocyanins and Precursors
2.3. Total RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis
2.4. Cloning and Sequencing of AeCHS
2.5. Subcellular Localization
2.6. Construction of Silencing Vector for Virus-induced Gene Silencing (VIGS)
2.7. Infiltration Grafting-mediated VIGS Experiment
2.8. Graph Making and Statistical Analysis
3. Results
3.1. Phenotype Observation and Anthocyanin Content Analysis
3.2. Expression and Cluster Analysis of Genes Involved in Anthocyanin Biosynthesis
3.3. Sequence Analysis and Alignment of AeCHS
3.4. Subcellular Localization Analysis of AeCHS
3.5. Silencing of AeCHS in A. eriantha Petals
4. Discussion
4.1. Anthocyanin Changes in Three Types of Petals
4.2. Screening, Cloning and Subcellular Localization of AeCHS
4.3. Infiltration Grafting-mediated VIGS
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Huang, H.W.; Ferguson, A.R. Actinidia in China: Natural diversity, phylogeographical evolution, interspecific gene flow and kiwifruit cultivar improvement. Acta Hortic. 2007, 753, 31–40. [Google Scholar] [CrossRef]
- Li, J.Q.; Li, X.W.; Soejarto, D.D. A revision of the genus Actinidia from China. Acta Hortic. 2007, 753, 41–44. [Google Scholar] [CrossRef]
- Zhang, Q.; Liu, C.Y.; Liu, Y.F.; VanBuren, R.; Yao, X.H.; Zhong, C.H.; Huang, H. High-density interspecific genetic maps of kiwifruit and the identification of sex-specific markers. DNA Res. 2015, 22, 367–375. [Google Scholar] [CrossRef] [PubMed]
- Guroo, I.; Wani, S.A.; Wani, S.M.; Ahmad, M.; Mir, S.A.; Masoodi, S.A. A review of production and processing of kiwifruit. J. Food Process. Technol. 2017, 8, 699. [Google Scholar] [CrossRef]
- Huang, H.W. The Genus Actinidia, a World Monograph; Science Press: Beijing, China, 2014. [Google Scholar]
- Montefiori, M.; Espley, R.V.; Stevenson, D.; Cooney, J.; Datson, P.M.; Saiz, A.; Atkinson, R.G.; Hellens, R.P.; Allan, A.C. Identification and characterisation of F3GT1 and F3GGT1, two glycosyltransferases responsible for anthocyanin biosynthesis in red-fleshed kiwifruit (Actinidia chinensis). Plant J. 2011, 65, 106–118. [Google Scholar] [CrossRef]
- Peng, Y.Y.; Wang, K.L.; Cooney, J.M.; Wang, T.C.; Espley, R.V.; Allan, A.C. Differential regulation of the anthocyanin profile in purple kiwifruit (Actinidia species). Hortic. Res. 2019, 6, 3. [Google Scholar] [CrossRef]
- Fraser, L.G.; Seal, A.G.; Montefiori, M.; McGhie, T.K.; Tsang, G.K.; Datson, P.M.; Hilario, E.; Marsh, H.E.; Dunn, J.K.; Hellens, R.P.; et al. An R2R3 MYB transcription factor determines red petal colour in an Actinidia (kiwifruit) hybrid population. BMC Genom. 2013, 14, 28. [Google Scholar] [CrossRef]
- Wu, R.M.; Wang, T.C.; McGie, T.; Voogd, C.; Allan, A.C.; Hellens, R.P.; Varkonyi-Gasic, E. Overexpression of the kiwifruit SVP3 gene affects reproductive development and suppresses anthocyanin biosynthesis in petals, but has no effect on vegetative growth, dormancy, or flowering time. J. Exp. Bot. 2014, 65, 4985–4995. [Google Scholar] [CrossRef]
- Allan, A.C.; Hellens, R.P.; Laing, W.A. MYB transcription factors that colour our fruit. Trends Plant Sci. 2008, 13, 99–102. [Google Scholar] [CrossRef]
- Glover, B.J.; Martin, C. Anthocyanin. Curr. Biol. 2012, 22, R147–R150. [Google Scholar] [CrossRef]
- Gould, K.S.; Lister, C. Flavonoid functions in plants. In Flavonoids: Chemistry, Biochemistry, and Applications; CRC Press: Boca Raton, FL, USA, 2006; pp. 397–411. ISBN 9780849320217. [Google Scholar]
- Grotewold, E. The genetics and biochemistry of floral pigments. Annu. Rev. Plant Biol. 2006, 57, 761–780. [Google Scholar] [CrossRef] [PubMed]
- Kay, C.D. Aspects of anthocyanin absorption, metabolism and pharmacokinetics in humans. Nutr. Res. Rev. 2006, 19, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, D.E.; Hurst, R.D. Polyphenolic phytochemicals—Just antioxidants or much more? Cell Mol. Life Sci. 2007, 64, 2900–2916. [Google Scholar] [CrossRef] [PubMed]
- Zafra-Stone, S.; Yasmin, T.; Bagchi, M.; Chatterjee, A.; Vinson, J.A.; Bagchi, D. Berry anthocyanins as novel antioxidants in human health and disease prevention. Mol. Nutr. Food Res. 2007, 51, 675–683. [Google Scholar] [CrossRef]
- de Pascual-Teresa, S.; Sanchez-Ballesta, M.T. Anthocyanins: From plant to health. Phytochem. Rev. 2008, 7, 281–299. [Google Scholar] [CrossRef]
- Quattrocchio, F.; Wing, J.F.; Leppen, H.; Mol, J.; Koes, R.E. Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell 1993, 5, 1497–1512. [Google Scholar] [CrossRef]
- Holton, T.A.; Cornish, E.C. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 1995, 7, 1071–1083. [Google Scholar] [CrossRef]
- Song, Y.H.; Yoo, C.M.; Hong, A.P.; Kim, S.H.; Jeong, H.J.; Shin, S.Y.; Kim, H.J.; Yun, D.J.; Lim, C.O.; Bahk, J.D.; et al. DNA-binding study identifies C-Box and hybrid C/G-Box or C/ABox motifs as high-affinity binding sites for STF1 and LONG HYPOCOTYL5 proteins. Plant Physiol. 2008, 146, 1862–1877. [Google Scholar] [CrossRef]
- Albert, N.W.; Lewis, D.H.; Zhang, H.; Schwinn, K.E.; Jameson, P.E.; Davies, K.M. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning. Plant J. 2011, 65, 771–784. [Google Scholar] [CrossRef]
- An, X.H.; Tian, Y.; Chen, K.Q.; Wang, X.F.; Hao, Y.J. The apple WD40 protein MdTTG1 interacts with bHLH but not MYB proteins to regulate anthocyanin accumulation. J Plant Physiol. 2012, 169, 710–717. [Google Scholar] [CrossRef]
- Schaart, J.G.; Dubos, C.; Romero, D.L.F.I.; van Houwelingen, A.M.; de Vos, R.C.; Jonker, H.H.; Xu, W.; Routaboul, J.M.; Lepiniec, L.; Bovy, A.G. Identification and characterization of MYB-bHLH-WD40 regulatory complexes controlling proanthocyanidin biosynthesis in strawberry (Fragaria × ananassa) fruits. New Phytol. 2012, 197, 454–467. [Google Scholar] [CrossRef] [PubMed]
- Patra, B.; Schluttenhofer, C.; Wu, Y.; Pattanaik, S.; Yuan, L. Transcriptional regulation of secondary metabolite biosynthesis in plants. Biochim. Biophys. Acta. 2013, 1829, 1236–1247. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Wang, B.; Wang, M.; Chen, M.; Yin, J.M.; Kaleri, G.M.; Zhang, G.M.; Zuo, T.N.; You, X.; Yang, Q. Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation. J. Integr. Plant Biol. 2014, 56, 364–372. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Grain, D.; Bobet, S.; Le Gourriere, J.; Thévenin, J.; Kelemen, Z.; Lepiniec, L.; Dubos, C. Complexity and robustness of the flavonoid transcriptional regulatory network revealed by comprehensive analyses of MYB-bHLH-WDR complexes and their targets in Arabidopsis seed. New Phytol. 2014, 202, 132–144. [Google Scholar] [CrossRef] [PubMed]
- El-Sharkawy, I.; Liang, D.; Xu, K.N. Transcriptome analysis of an apple (Malus x domestica) yellow fruit somatic mutation identifies a gene network module highly associated with anthocyanin and epigenetic regulation. J. Exp. Bot. 2015, 66, 7359–7376. [Google Scholar] [CrossRef]
- Montefiori, M.; Brendolise, C.; Darem, A.P.; Lin-Wang, K.; Davies, K.M.; Hellens, R.P.; Allan, A.C. In the Solanaceae, a hierarchy of bHLHs confer distinct target specificity to the anthocyanin regulatory complex. J. Exp. Bot. 2015, 66, 1427–1436. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Dubos, C.; Lepiniec, L. Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends Plant Sci. 2015, 20, 176–185. [Google Scholar] [CrossRef]
- Cho, K.; Cho, K.S.; Sohn, H.B.; Ha, I.J.; Hong, S.Y.; Lee, H.; Kim, Y.M.; Nam, M.H. Network analysis of the metabolome and transcriptome reveals novel regulation of potato pigmentation. J. Exp. Bot. 2016, 67, 1519–1533. [Google Scholar] [CrossRef]
- Springob, K.; Nakajima, J.; Yamazaki, M.; Saito, K. Recent advances in the biosynthesis and accumulation of anthocyanins. Nat. Prod. Rep. 2003, 20, 288–303. [Google Scholar] [CrossRef]
- Petroni, K.; Tonelli, C. Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant Sci. 2011, 181, 219–229. [Google Scholar] [CrossRef]
- Boss, P.K.; Davies, C.; Robinson, S.P. Analysis of the expression of anthocyanin pathway genes in developing Vitis vinifera L. cv Shiraz grape berries and the implications for pathway regulation. Plant Physiol. 1996, 111, 1059–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takos, A.M.; Jaffé, F.W.; Jacob, S.R.; Bogs, J.; Robinson, S.P.; Walker, A.R. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol. 2006, 142, 1216–1232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lou, Q.; Liu, Y.; Qi, Y.; Jiao, S.; Tian, F.; Jiang, L.; Wang, Y. Transcriptome sequencing and metabolite analysis reveals the role of delphinidin metabolism in flower colour in grape hyacinth. J. Exp. Bot. 2014, 65, 3157–3164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, S.; Ding, J.; Deng, D.; Tang, W.; Sun, H.; Liu, D.; Zhang, X.; Meng, M.; Yu, J.; Liu, J.; et al. Draft genome of the kiwifruit Actinidia chinensis. Nat. Commun. 2013, 4, 2640. [Google Scholar] [CrossRef]
- Pilkington, S.M.; Crowhurst, R.; Hilario, E.; Nardozza, S.; Fraser, L.; Peng, Y.Y.; Gunaseelan, K.; Simpson, R.; Tahir, J.; Deroles, S.C.; et al. A manually annotated Actinidia chinensis var. chinensis (kiwifruit) genome highlights the challenges associated with draft genomes and gene prediction in plants. BMC Genom. 2018, 19, 257. [Google Scholar] [CrossRef] [Green Version]
- Tang, W.; Sun, X.; Yue, J.; Tang, X.; Jiao, C.; Yang, Y.; Niu, X.; Miao, M.; Zhang, D.; Huang, S.; et al. Chromosome-scale genome assembly of kiwifruit Actinidia eriantha with single-molecule sequencing and chromatin interaction mapping. GigaScience 2019, 8. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Schiff, M.; Marathe, R.; Dinesh-Kumar, S. Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J. 2002, 30, 415–429. [Google Scholar] [CrossRef]
- Liu, Y.; Nakayama, N.; Schiff, M.; Litt, A.; Irish, V.F.; Dinesh-Kumar, S. Virus induced gene silencing of a DEFICIENS ortholog in Nicotiana benthamiana. Plant Mol. Biol. 2004, 54, 701–711. [Google Scholar] [CrossRef]
- Ma, N.; Xue, J.; Li, Y.; Liu, X.; Dai, F.; Jia, W.; Luo, Y.; Gao, J. Rh-PIP2; 1, a rose aquaporin gene, is involved in ethyleneregulated petal expansion. Plant Physiol. 2008, 148, 894–907. [Google Scholar] [CrossRef] [Green Version]
- Ito, H.; Ochiai, M.; Kato, H.; Shiratake, K.; Takemoto, D.; Otagaki, S. Rose phytoene desaturase gene silencing by apple latent spherical virus vectors. Hort. Sci. 2012, 47, 1278–1282. [Google Scholar] [CrossRef]
- Yan, H.; Shi, S.; Ma, N.; Cao, X.; Zhang, H.; Qiu, X.; Wang, Q.; Jian, H.; Zhou, N.; Zhang, Z.; et al. Graft-accelerated virus-induced gene silencing facilitates functional genomics in rose flowers. J. Integr. Plant. Biol. 2018, 60, 34–44. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Li, F.; Li, M.; Kianinejad, A.S.; Dever, J.K.; Wheeler, T.A.; Li, Z.; He, P.; Shan, L. Cotton GhBAK1 mediates Verticillium wilt resistance and cell death. J. Integr. Plant. Biol. 2013, 55, 586–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Jia, F.; Hu, J.; Pang, J.; Xu, L.; Wang, L. Virus-induced gene silencing of PEAM4 affects floral morphology by altering the expression pattern of PsSOC1a and PsPVP in pea. J. Plant Physiol. 2014, 171, 148–153. [Google Scholar] [CrossRef] [PubMed]
- Faivre-Rampant, O.; Gilroy, E.M.; Hrubikova, K.; Hein, I.; Millam, S.; Loake, G.J.; Birch, P.; Taylor, M.; Lacomme, C. Potato virus X-induced gene silencing in leaves and tubers of potato. Plant Physiol. 2004, 134, 1308–1316. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Schiff, M.; Dinesh-Kumar, S.P. Virus-induced gene silencing in tomato. Plant J. 2002, 31, 777–786. [Google Scholar] [CrossRef]
- Fu, D.Q.; Zhu, B.Z.; Zhu, H.L.; Jiang, W.B.; Luo, Y.B. Virus-induced gene silencing in tomato fruit. Plant J. 2005, 43, 299–308. [Google Scholar] [CrossRef]
- Zhu, H.L.; Zhu, B.Z.; Shao, Y.; Wang, X.G.; Lin, X.J.; Xie, Y.H. Tomato fruit development and ripening are altered by the silencing of LeEIN2 gene. J. Integr. Plant. Biol. 2006, 48, 1478–1485. [Google Scholar] [CrossRef]
- Yamagishi, N.; Yoshikawa, N. Highly efficient virus-induced gene silencing in apple and soybean by apple latent spherical virus vector and biolistic inoculation. Methods Mol. Biol. 2013, 975, 167–181. [Google Scholar] [CrossRef]
- Tian, J.; Cheng, L.; Han, Z.Y.; Yao, Y.C. Tobacco rattle virus mediated gene silencing in strawberry plants. Plant Cell Tissue Organ Cult. 2015, 120, 1131–1138. [Google Scholar] [CrossRef]
- Liu, Y.F.; Zhou, B.; Qi, Y.W.; Liu, C.H.; Liu, Z.D.; Ren, X.L. Biochemical and functional characterization of AcUFGT3a, a galactosyltransferase involved in anthocyanin biosynthesis in the red-fleshed kiwifruit (Actinidia chinensis). Physiol. Plant 2018, 162, 409–426. [Google Scholar] [CrossRef]
- Jeffree, C.E.; Yeoman, M.M. Development of intercellular connections between opposing cells in a graft union. New Phytologist. 1983, 93, 491–509. [Google Scholar] [CrossRef]
- Ampomah-Dwamena, C.; McGhie, T.; Wibisono, R.; Montefiori, M.; Hellens, R.P.; Allan, A.C. The kiwifruit lycopene β-cyclase plays a significant role in carotenoid accumulation in fruit. J. Exp. Bot. 2009, 60, 3765–3779. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.G.; Meng, D.; Wang, A.D.; Li, T.L.; Jiang, S.L.; Cong, P.H.; Li, T. The methylation of the PcMYB10 promoter is associated with green-skinned sport in max red bartlett pear. Plant Physiol. 2013, 162, 885–896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tuan, P.A.; Bai, S.L.; Yaegaki, H.; Tamura, T.; Hihara, S.; Moriguchi, T.; Oda, K. The crucial role of PpMYB10.1 in anthocyanin accumulation in peach and relationships between its allelic type and skin color phenotype. BMC Plant Biol. 2015, 15, 280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.K.; Fang, J.B.; Qi, X.J.; Lin, M.M.; Zhong, Y.P.; Sun, L.M. A key structural gene, AaLDOX, is involved in anthocyanin biosynthesis in all red-fleshed kiwifruit (Actinidia arguta) based on transcriptome analysis. Gene 2018, 648, 31–41. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
PAL | GGACTGGGCTTTTGACAGGA | CAGAGGTGCACCATTCCACT |
C4H | AGTCCAAATCACAGAGCCCG | GTATCCACCGAGCTTTGCCT |
4CL | TTGGCCAGGGCTATGGAATG | GCCAGTTTCGGGGTCGATAA |
CHS | ACAAAGCTCCTTGGTCTCCG | CCCCCTTGTTGTTCTCTGCT |
CHI | TGCCATTAACGGGCAAGGAA | TTGTAACGGCTTTGGCCTCT |
F3H | ACCATCACGCTCTTGCTTCA | TGCTTGGTGGTCTGCATTCT |
F3′H | CACCCTCCTTAACCGTCACC | CGGGCCATGGAAGCTATTGA |
F3′5′H | GTGGGAAAACCCGCTAGAGT | TCCCATCCTTATGCCTGCAC |
DFR | CTTCCATGTCGCCACTCGTA | CAGATTGGGGGTGTTGTTGC |
LDOX | TACCCGGAGGACAAAAGGGA | GAGCCGACCCTCTTCAAGTC |
UFGT | CGTGGCAATAGCTGAAGCAC | GAGTTCCACCCGCAATGAGT |
UFGGT | CACGTCCCGGAAACCCTAAA | TGCTCTCCCCAAAATCGCAT |
FLS | GGCAGTGTACCATCGGTCAA | TGTCATCCCCAACGAGCTTC |
LAR | GGTTCCTGCCATCGGAGTTT | GAAGTAGGGCCACGAAGCAA |
ANR | GTACAACGTCCCCACCGATT | TGAAGTAGGCGACGGATTGG |
β-actin | TGCATGAGCGATCAAGTTTCAAG | TGTCCCATGTCTGGTTGATGACT |
Anthocyanins and Precursors | PAL | C4H | 4CL | CHS | CHI | F3H | F3’H | F3’5’H | DFR | LDOX | UFGT | UFGGT | FLS | LAR | ANR |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Dihydroquercetin | 0.528 | −0.738 * | 0.432 | 0.423 | −0.746 * | −0.14 | 0.003 | 0.135 | 0.595 | 0.255 | 0.208 | −0.639 | 0.14 | 0.421 | −0.793 * |
Cyanidin | −0.163 | −0.529 | 0.925 ** | 0.939 ** | −0.625 | −0.742 * | 0.739 * | −0.387 | −0.102 | −0.586 | −0.585 | −0.858 ** | −0.665 | 0.951 ** | −0.437 |
Cyanidin-3-O-galactoside | −0.793 * | 0.169 | 0.657 | 0.688 * | 0.038 | −0.904 ** | 0.984 ** | −0.782 * | −0.742 * | −0.947 ** | −0.958 ** | −0.356 | −0.962** | 0.720 * | 0.253 |
Cyanidin-3-O-xylose-galactoside | −0.066 | −0.633 | 0.971 * | 0.977 ** | −0.703 * | −0.672 * | 0.584 | −0.295 | −0.011 | -0.528 | −0.514 | −0.923 ** | −0.608 | 0.965 | −0.496 |
Dihyromyricetin | 0.052 | −0.720 * | 0.960 ** | 0.960 ** | −0.790 * | −0.585 | 0.558 | −0.181 | 0.099 | −0.448 | −0.421 | −0.961 ** | −0.527 | 0.952 ** | −0.591 |
Delphinidin | −0.055 | −0.632 | 0.953 ** | 0.966 ** | −0.709 * | −0.682 * | 0.662 | −0.296 | −0.016 | −0.529 | −0.517 | −0.921 ** | −0.61 | 0.966 ** | −0.497 |
Delphinidin-3-O-galactoside | −0.122 | −0.598 | 0.985 ** | 0.995 ** | −0.679 * | −0.725 * | 0.668 * | −0.349 | −0.07 | −0.585 | −0.573 | −0.920 ** | −0.664 | 0.990 ** | −0.459 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Cui, W.; Qi, X.; Qiao, C.; Lin, M.; Zhong, Y.; Hu, C.; Fang, J. Chalcone Synthase-Encoding AeCHS is Involved in Normal Petal Coloration in Actinidia eriantha. Genes 2019, 10, 949. https://doi.org/10.3390/genes10120949
Li Y, Cui W, Qi X, Qiao C, Lin M, Zhong Y, Hu C, Fang J. Chalcone Synthase-Encoding AeCHS is Involved in Normal Petal Coloration in Actinidia eriantha. Genes. 2019; 10(12):949. https://doi.org/10.3390/genes10120949
Chicago/Turabian StyleLi, Yukuo, Wen Cui, Xiujuan Qi, Chengkui Qiao, Miaomiao Lin, Yunpeng Zhong, Chungen Hu, and Jinbao Fang. 2019. "Chalcone Synthase-Encoding AeCHS is Involved in Normal Petal Coloration in Actinidia eriantha" Genes 10, no. 12: 949. https://doi.org/10.3390/genes10120949