RNA-Sequencing, Physiological and RNAi Analyses Provide Insights into the Response Mechanism of the ABC-Mediated Resistance to Verticillium dahliae Infection in Cotton
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials, Growth Conditions and Innoculation with V. dahliae
2.2. RNA Isolation, Library Construction and Sequencing
2.3. Oxidant and Antioxidant Enzyme Assays
2.4. Quantitative Real-Time PCR (RT-qPCR) Analysis
2.5. RNA-Seq Data Quality Assessment and Bioinformatics Analysis
2.6. Functional Annotation and Enrichment Pathway Analysis of DEGs
2.7. Identification of ABC Gene Family, Chromosomal Mapping and Subcellular Localization Prediction of the ABC Proteins in G. raimondii
2.8. Phylogenetic Analyses and Gene Structure Organization of the ABC Proteins in Cotton
2.9. Functional Characterization of the ABC Novel Gene through Virus Induced Gene Silencing (VIGS)
3. Results
3.1. Different Response in the Three Cotton Species to V. dahliae Invasion
3.2. Physiological and Biochemical Characteristics of the Three Cotton Species to V. dahliae Infection
3.3. Sequencing Overview and Transcript Identification among the Three Cotton Species in Relation to V. dahliae Resistance
3.4. Identification of the Differentially Expressed Genes (DEGs)
3.5. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysis of the Differentially Expressed Genes
3.6. Identification, Phylogenetic and Sequence Analysis of the ABC Genes in the Diploid Cotton of the D Genome
3.7. RT-qPCR Validation of the ABC Genes
3.8. Virus Induced Gene Silencing (VIGS) Confirmation with the Gene Gh_D11G3432 (ABCF5) on Tetraploid Upland Cotton
3.9. Evaluation of Oxidant and Antioxidant Enzymes Concentration Levels in the Leaf Tissues of the Gh_D11G3432 (ABCF5)-Silenced Plants under V. dahliae Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Deketelaere, S.; Tyvaert, L.; França, S.C.; Hofte, M. Desirable traits of a good biocontrol agent against Verticillium wilt. Front. Microbiol. 2017, 8, 1186. [Google Scholar] [CrossRef] [PubMed]
- Masny, A.; Zurawicz, E.; Pruski, K.; Madry, W. Combining ability analysis in 10 strawberry genotypes used in breeding cultivars for tolerance to verticillium wilt. J. Am. Soc. Hortic. Sci. 2014, 139, 275–281. [Google Scholar]
- Banno, S.; Ikeda, K.; Saito, H.; Sakai, H.; Urushibara, T.; Shiraishi, T.; Fujimura, M. Characterization and distribution of two subtypes of Verticillium longisporum isolated from cabbage fields in Japan. J. Gen. Plant Pathol. 2015, 81, 118–126. [Google Scholar] [CrossRef]
- Klosterman, S.J.; Atallah, Z.K.; Vallad, G.E.; Subbarao, K.V. Diversity, Pathogenicity, and Management of Verticillium Species. Annu. Rev. Phytopathol. 2009, 47, 39–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Land, C.J.; Lawrence, K.S.; Burmester, C.H.; Meyer, B. Cultivar, irrigation, and soil contribution to the enhancement of Verticillium wilt disease in cotton. Crop Prot. 2017, 96, 1–6. [Google Scholar] [CrossRef]
- Majumdar, A. Selection of raw materials in textile spinning industry using fuzzy multi-criteria decision making approach. Fibers Polym. 2010, 11, 121–127. [Google Scholar] [CrossRef]
- Erdogan, O.; Sezener, V.; Ozbek, N.; Bozbek, T. The Effects of Verticillium Wilt (Verticilli1m dahliae Kleb.) on Cotton Yield and Fiber Quality. Asian J. Plant Sci. 2006. [Google Scholar] [CrossRef]
- Zhang, J.; Fang, H.; Zhou, H.; Sanogo, S.; Ma, Z. Genetics, breeding, and marker-assisted selection for Verticillium wilt resistance in cotton. Crop Sci. 2014, 54, 1289–1303. [Google Scholar] [CrossRef]
- Parkhi, V.; Kumar, V.; Le Anne, M.C.; Bell, A.A.; Rathore, K.S. Expression of Arabidopsis NPR1 in Transgenic Cotton Confers Resistance to Non-defoliating Isolates of Verticillium dahliae but not the Defoliating Isolates. J. Phytopathol. 2010, 158, 822–825. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, L.; Xu, X.; Cai, C.; Guo, W. Genome-wide identification of mitogen-activated protein kinase gene family in Gossypium raimondii and the function of their corresponding orthologs in tetraploid cultivated cotton. BMC Plant Biol. 2014, 14. [Google Scholar] [CrossRef]
- Yang, Y.; Chen, T.; Ling, X.; Ma, Z. Gbvdr6, a Gene Encoding a Receptor-Like Protein of Cotton (Gossypium barbadense), Confers Resistance to Verticillium Wilt in Arabidopsis and Upland Cotton. Front. Plant Sci. 2018, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Pei, Y.; Sun, Y.; Liu, N.; Wang, P.; Liu, D.; Ge, X.; Li, F.; Hou, Y. A Cotton Cyclin-Dependent Kinase E Confers Resistance to Verticillium dahliae Mediated by Jasmonate-Responsive Pathway. Front. Plant Sci. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.Q.; Han, L.B.; Yang, C.L.; Wu, X.M.; Zhong, N.Q.; Wu, J.H.; Wang, F.X.; Wang, H.Y.; Xia, G.X. The cotton MYB108 forms a positive feedback regulation loop with CML11 and participates in the defense response against Verticillium dahliae infection. J. Exp. Bot. 2016, 67, 1935–1950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, C.L.; Liang, S.; Wang, H.Y.; Han, L.B.; Wang, F.X.; Cheng, H.Q.; Wu, X.M.; Qu, Z.L.; Wu, J.H.; Xia, G.X. Cotton major latex protein 28 functions as a positive regulator of the ethylene responsive factor 6 in defense against verticillium dahliae. Mol. Plant 2015, 8, 399–411. [Google Scholar] [CrossRef]
- Li, C.; He, X.; Luo, X.; Xu, L.; Liu, L.; Min, L.; Jin, L.; Zhu, L.; Zhang, X. Cotton WRKY1 Mediates the Plant Defense-to-Development Transition during Infection of Cotton by Verticillium dahliae by Activating JASMONATE ZIM-DOMAIN1 Expression. Plant Physiol. 2014, 166, 2179–2194. [Google Scholar] [CrossRef] [Green Version]
- Duan, X.; Zhang, Z.; Wang, J.; Zuo, K. Characterization of a novel cotton subtilase gene GbSBT1 in response to extracellular stimulations and its role in verticillium resistance. PLoS ONE 2016, 11. [Google Scholar] [CrossRef]
- Mo, H.; Wang, X.; Zhang, Y.; Zhang, G.; Zhang, J.; Ma, Z. Cotton polyamine oxidase is required for spermine and camalexin signalling in the defence response to Verticillium dahliae. Plant J. 2015, 83, 962–975. [Google Scholar] [CrossRef] [Green Version]
- Jun, Z.; Zhang, Z.; Gao, Y.; Zhou, L.; Fang, L.; Chen, X.; Ning, Z.; Chen, T.; Guo, W.; Zhang, T. Overexpression of GbRLK, a putative receptor-like kinase gene, improved cotton tolerance to Verticillium wilt. Sci. Rep. 2015, 5. [Google Scholar] [CrossRef]
- Ji, H.; Peng, Y.; Meckes, N.; Allen, S.; Stewart, C.N.; Traw, M.B. ATP-Dependent Binding Cassette Transporter G Family Member 16 Increases Plant Tolerance to Abscisic Acid and Assists in Basal Resistance against Pseudomonas syringae DC3000. Plant Physiol. 2014, 166, 879–888. [Google Scholar] [CrossRef] [Green Version]
- Ji, H.; Peng, Y.; Meckes, N.; Allen, S.; Stewart, N.; Traw, M.B. ABC transporter AtABCG16 increases plant tolerance to abscisic acid and assists in basal resistance against Pseudomonas syringae DC3000. Plant Physiol. 2014. [Google Scholar] [CrossRef]
- Martinoia, E.; Klein, M.; Geisler, M.; Bovet, L.; Forestier, C.; Kolukisaoglu, Ü.; Müller-Röber, B.; Schulz, B. Multifunctionality of plant ABC transporters—More than just detoxifiers. Planta 2002, 214, 345–355. [Google Scholar] [CrossRef] [PubMed]
- Kretzschmar, T.; Burla, B.; Lee, Y.; Martinoia, E.; Nagy, R. Functions of ABC transporters in plants. Essays Biochem. 2011, 50, 145–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verrier, P.J.; Bird, D.; Burla, B.; Dassa, E.; Forestier, C.; Geisler, M.; Klein, M.; Kolukisaoglu, Ü.; Lee, Y.; Martinoia, E.; et al. Plant ABC proteins—A unified nomenclature and updated inventory. Trends Plant Sci. 2008, 13, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Çakır, B.; Kılıçkaya, O. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera. PLoS ONE 2013, 8, e78860. [Google Scholar] [CrossRef] [PubMed]
- Dean, M.; Rzhetsky, A.; Allikmets, R. The Human ATP-Binding Cassette (ABC) Transporter Superfamily The Human ATP-Binding Cassette ( ABC ) Transporter Superfamily. Genome Res. 2001, 11, 1156–1166. [Google Scholar] [CrossRef]
- Krattinger, S.G.; Lagudah, E.S.; Spielmeyer, W.; Singh, R.P.; Huerta-Espino, J.; McFadden, H.; Bossolini, E.; Selter, L.L.; Keller, B. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science 2009, 323, 1360–1363. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.N.T.; Moon, S.; Jung, K.-H. Genome-wide expression analysis of rice ABC transporter family across spatio-temporal samples and in response to abiotic stresses. J. Plant Physiol. 2014, 171, 1276–1288. [Google Scholar] [CrossRef]
- Kolukisaoglu, H.U.; Bovet, L.; Klein, M.; Eggmann, T.; Geisler, M.; Wanke, D.; Martinoia, E.; Schulz, B. Family business: The multidrug-resistance related protein (MRP) ABC transporter genes in Arabidopsis thaliana. Planta 2002, 216, 107–19. [Google Scholar] [CrossRef]
- Crouzet, J.; Roland, J.; Peeters, E.; Trombik, T.; Ducos, E.; Nader, J.; Boutry, M. NtPDR1, a plasma membrane ABC transporter from Nicotiana tabacum, is involved in diterpene transport. Plant Mol. Biol. 2013, 82, 181–192. [Google Scholar] [CrossRef]
- Eichhorn, H.; Klinghammer, M.; Becht, P.; Tenhaken, R. Isolation of a novel ABC-transporter gene from soybean induced by salicylic acid. J. Exp. Bot. 2006, 57, 2193–2201. [Google Scholar] [CrossRef] [Green Version]
- Stukkens, Y. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense. Plant Physiol. 2005, 139, 341–352. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wink, M.; Ashour, M.L.; El-Readi, M.Z. Secondary metabolites from plants inhibiting ABC transporters and reversing resistance of cancer cells and microbes to cytotoxic and antimicrobial agents. Front. Microbiol. 2012, 3, 130. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.Y.; Bovet, L.; Maeshima, M.; Martinoia, E.; Lee, Y. The ABC transporter AtPDR8 is a cadmium extrusion pump conferring heavy metal resistance. Plant J. 2007, 50, 207–218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tommasini, R.; Vogt, E.; Fromenteau, M.; Hörtensteiner, S.; Matile, P.; Amrhein, N.; Martinoia, E. An ABC-transporter of Arabidopsis thaliana has both glutathione-conjugate and chlorophyll catabolite transport activity. Plant J. 1998, 13, 773–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Borghi, L.; Kang, J.; Ko, D.; Lee, Y.; Martinoia, E. The role of ABCG-type ABC transporters in phytohormone transport. Biochem. Soc. Trans. 2015, 43, 924–930. [Google Scholar] [CrossRef] [Green Version]
- Fang, W.; Xie, D.; Zhu, H.; Li, W.; Xu, Z.; Yang, L.; Li, Z.; Sun, L.; Wang, J.; Nie, L.; et al. Comparative proteomic analysis of Gossypium thurberi in response to Verticillium dahliae inoculation. Int. J. Mol. Sci. 2015, 16, 25121–25140. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.W.; Jiang, T.F.; Cui, X.; Qi, F.J.; Jian, G.L. Colonization in cotton plants by a green fluorescent protein labelled strain of Verticillium dahliae. Eur. J. Plant Pathol. 2013, 135, 867–876. [Google Scholar] [CrossRef]
- Veronese, P.; Narasimhan, M.L.; Stevenson, R.A.; Zhu, J.K.; Weller, S.C.; Subbarao, K.V.; Bressan, R.A. Identification of a locus controlling Verticillium disease symptom response in Arabidopsis thaliana. Plant J. 2003, 35, 574–587. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, X.; Yang, S.; Chi, J.; Zhang, G.; Ma, Z. Cloning and characterization of a Verticillium wilt resistance gene from Gossypium barbadense and functional analysis in Arabidopsis thaliana. Plant Cell Rep. 2011, 30, 2085–2096. [Google Scholar] [CrossRef]
- Ma, Y.-L.; Wang, H.-F.; Wang, P.; Yu, C.-G.; Luo, S.-Q.; Zhang, Y.-F.; Xie, Y.-F. Effects of cadmium stress on the antioxidant system and chlorophyll fluorescence characteristics of two Taxodium clones. Plant Cell Rep. 2018, 37, 1547–1555. [Google Scholar] [CrossRef]
- Lu, P.; Magwanga, R.O.; Lu, H.; Kirungu, J.N.; Wei, Y.; Dong, Q.; Wang, X.; Cai, X.; Zhou, Z.; Wang, K.; et al. A novel G-protein-coupled receptors gene from upland cotton enhances salt stress tolerance in transgenic Arabidopsis. Genes 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar] [CrossRef]
- Magwanga, R.O.; Lu, P.; Kirungu, J.N.; Diouf, L.; Dong, Q.; Hu, Y.; Cai, X.; Xu, Y.; Hou, Y.; Zhou, Z.; et al. GBS mapping and analysis of genes conserved between gossypium tomentosum and gossypium hirsutum cotton cultivars that respond to drought stress at the seedling stage of the BC2F2generation. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [Green Version]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11. [Google Scholar] [CrossRef]
- Zheng, Y.; Jiao, C.; Sun, H.; Rosli, H.G.; Pombo, M.A.; Zhang, P.; Banf, M.; Dai, X.; Martin, G.B.; Giovannoni, J.J.; et al. iTAK: A Program for Genome-wide Prediction and Classification of Plant Transcription Factors, Transcriptional Regulators, and Protein Kinases. Mol. Plant 2016, 9, 1667–1670. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef] [Green Version]
- Voorrips, R.E. MapChart: Software for the Graphical Presentation of Linkage Maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Magwanga, R.O.; Lu, P.; Kirungu, J.N.; Dong, Q.; Hu, Y.; Zhou, Z.; Cai, X.; Wang, X.; Hou, Y.; Wang, K.; et al. Cotton Late Embryogenesis Abundant ( LEA2) Genes Promote Root Growth and Confers Drought Stress Tolerance in Transgenic Arabidopsis thaliana. G3 Genes Genomes Genet. 2018, 8, g3.200423.2018. [Google Scholar] [CrossRef]
- Métraux, J.P.; Boller, T. Local and systemic induction of chitinase in cucumber plants in response to viral, bacterial and fungal infections. Physiol. Mol. Plant Pathol. 1986, 28, 161–169. [Google Scholar] [CrossRef]
- Magwanga, R.O.; Lu, P.; Kirungu, J.N.; Lu, H.; Wang, X.; Cai, X.; Zhou, Z.; Zhang, Z.; Salih, H.; Wang, K.; et al. Characterization of the late embryogenesis abundant (LEA) proteins family and their role in drought stress tolerance in upland cotton. BMC Genet. 2018, 19. [Google Scholar] [CrossRef] [PubMed]
- Magwanga, R.; Lu, P.; Kirungu, J.; Cai, X.; Zhou, Z.; Wang, X.; Diouf, L.; Xu, Y.; Hou, Y.; Hu, Y.; et al. Whole Genome Analysis of Cyclin Dependent Kinase (CDK) Gene Family in Cotton and Functional Evaluation of the Role of CDKF4 Gene in Drought and Salt Stress Tolerance in Plants. Int. J. Mol. Sci. 2018, 19, 2625. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; He, M.; Zhu, Z.; Li, S.; Xu, Y.; Zhang, C.; Singer, S.D.; Wang, Y. Identification of the dehydrin gene family from grapevine species and analysis of their responsiveness to various forms of abiotic and biotic stress. BMC Plant Biol. 2012, 12. [Google Scholar] [CrossRef]
- Xu, J.; Wang, G.; Wang, J.; Li, Y.; Tian, L.; Wang, X.; Guo, W. The lysin motif-containing proteins, Lyp1, Lyk7 and LysMe3, play important roles in chitin perception and defense against Verticillium dahliae in cotton. BMC Plant Biol. 2017, 17. [Google Scholar] [CrossRef] [Green Version]
- Stergiopoulos, I.; de Wit, P.J.G.M. Fungal Effector Proteins. Annu. Rev. Phytopathol. 2009, 47, 233–263. [Google Scholar] [CrossRef]
- Gao, W.; Long, L.; Zhu, L.-F.; Xu, L.; Gao, W.-H.; Sun, L.-Q.; Liu, L.-L.; Zhang, X.-L. Proteomic and Virus-induced Gene Silencing (VIGS) Analyses Reveal That Gossypol, Brassinosteroids, and Jasmonic acid Contribute to the Resistance of Cotton to Verticillium dahliae. Mol. Cell. Proteom. 2013, 12, 3690–3703. [Google Scholar] [CrossRef]
- Zhou, Z.; Dai, X.; Pan, J.; Zhang, T.; Chen, Z. Analysis of resistance of upland cotton varieties to multi Verticillium dahliae isolates. Cott. Sci. 2001, 13, 3–6. [Google Scholar]
- Ghosh, S.; Meena, K.; Sinha, M.K.; Karmakar, P.G. Genetic Diversity in Corchorus olitorius Genotypes Using Jute SSRs. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2017, 87, 917–926. [Google Scholar] [CrossRef]
- Katiyar, A.; Smita, S.; Lenka, S.K.; Rajwanshi, R.; Chinnusamy, V.; Bansal, K.C. Genome-wide classification and expression analysis of MYB transcription factor families in rice and Arabidopsis. BMC Genomics 2012, 13, 544. [Google Scholar] [CrossRef] [PubMed]
- Pang, K.; Li, Y.; Liu, M.; Meng, Z.; Yu, Y. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.). Gene 2013, 526, 411–428. [Google Scholar] [CrossRef]
- Geisler, M.; Aryal, B.; Di Donato, M.; Hao, P. A critical view on ABC transporters and their interacting partners in auxin transport. Plant Cell Physiol. 2017, 58, 1601–1604. [Google Scholar] [CrossRef] [PubMed]
- Andolfo, G.; Ruocco, M.; Di Donato, A.; Frusciante, L.; Lorito, M.; Scala, F.; Ercolano, M.R. Genetic variability and evolutionary diversification of membrane ABC transporters in plants. BMC Plant Biol. 2015, 15. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Zheng, Y.; Xin, H.; Fang, L.; Li, S. Comprehensive analysis of NAC domain transcription factor gene family in Vitis vinifera. Plant Cell Rep. 2013, 32, 61–75. [Google Scholar] [CrossRef]
- Progar, V.; Jakše, J.; Štajner, N.; Radišek, S.; Javornik, B.; Berne, S. Comparative transcriptional analysis of hop responses to infection with Verticillium nonalfalfae. Plant Cell Rep. 2017, 36, 1599–1613. [Google Scholar] [CrossRef] [Green Version]
- Bailey-Serres, J. The Roles of Reactive Oxygen Species in Plant Cells. Plant Physiol. 2006, 141, 311–311. [Google Scholar] [CrossRef] [Green Version]
- Becker, A. Virus-induced gene silencing: Methods and protocols. Methods Mol. Biol. 2013, 975, 221. [Google Scholar]
- Liu, N.; Zhang, X.; Sun, Y.; Wang, P.; Li, X.; Pei, Y.; Li, F.; Hou, Y. Molecular evidence for the involvement of a polygalacturonase-inhibiting protein, GhPGIP1, in enhanced resistance to Verticillium and Fusarium wilts in cotton. Sci. Rep. 2017, 7. [Google Scholar] [CrossRef] [PubMed]
- Gong, Q.; Yang, Z.; Wang, X.; Butt, H.I.; Chen, E.; He, S.; Zhang, C.; Zhang, X.; Li, F. Salicylic acid-related cotton (Gossypium arboreum) ribosomal protein GaRPL18 contributes to resistance to Verticillium dahliae. BMC Plant Biol. 2017, 17. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Wheeler, T.; Li, Z.; Kenerley, C.M.; He, P.; Shan, L. Silencing GhNDR1 and GhMKK2 compromises cotton resistance to Verticillium wilt. Plant J. 2011, 66, 293–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
GhPAO | GGACAATCGCCTGAAACTGA | GAGGTCGCTTTGAAGAACACTA |
GhRPL18 | GCAGTTGAACAGATGTACGCT | ATTGCTTGGTGCTGTCCCTC |
GhPGIP1 | TCTGGTACAATCCCTGCCTC | CAGATCCAGCCTTGCCAAAC |
Sample | Raw Data | Valid Data | Valid Ratio (Reads) | Q20% | Q30% | GC Content% | ||
---|---|---|---|---|---|---|---|---|
Read | Base (G) | Read | Base (G) | |||||
Gr_0L | 45,671,298 | 6.85 | 45,174,949 | 6.77 | 98.89 | 99.42 | 95.62 | 46.67 |
Gr_12L | 44,184,191 | 6.63 | 43,550,318 | 6.53 | 98.57 | 99.36 | 95.79 | 44.50 |
Gr_48L | 41,258,547 | 6.19 | 40,872,607 | 6.13 | 99.07 | 99.45 | 95.43 | 44.67 |
Gr_0S | 44,446,223 | 6.67 | 44,021,567 | 6.60 | 99.05 | 99.46 | 94.47 | 44.50 |
Gr_12S | 46,330,216 | 6.95 | 45,813,186 | 6.87 | 98.88 | 99.50 | 94.66 | 44.17 |
Gr_48S | 43,325,707 | 6.50 | 42,853,911 | 6.43 | 98.91 | 99.43 | 94.48 | 44.50 |
Gr_0R | 46,091,584 | 6.91 | 45,704,989 | 6.86 | 99.16 | 99.50 | 94.28 | 44.33 |
Gr_12R | 46,517,417 | 6.98 | 46,111,933 | 6.92 | 99.13 | 99.45 | 94.23 | 44.17 |
Gr_48R | 44,322,955 | 6.65 | 43,866,601 | 6.58 | 98.98 | 99.47 | 94.56 | 44.00 |
Gth_0L | 40,268,095 | 6.04 | 39,685,912 | 5.95 | 98.55 | 99.31 | 95.57 | 45.50 |
Gth_12L | 46,036,569 | 6.91 | 45,436,039 | 6.82 | 98.68 | 99.28 | 95.50 | 45.00 |
Gth_48L | 43,532,067 | 6.53 | 41,902,559 | 6.28 | 96.48 | 98.29 | 93.11 | 45.83 |
Gth_0S | 43,844,243 | 6.58 | 43,353,597 | 6.50 | 98.88 | 99.36 | 94.00 | 45.00 |
Gth_12S | 47,615,319 | 7.14 | 46,946,61 | 7.04 | 98.60 | 99.17 | 92.61 | 44.50 |
Gth_48S | 43,248,223 | 6.49 | 42,695,944 | 6.40 | 98.72 | 99.27 | 93.47 | 44.67 |
Gth_0R | 44,767,686 | 6.71 | 44,295,005 | 6.65 | 98.95 | 99.16 | 91.83 | 44.50 |
Gth_12R | 52,161,200 | 7.82 | 51,588,587 | 7.74 | 98.91 | 99.15 | 92.61 | 44.17 |
Gth_48R | 48,449,214 | 7.27 | 47,914,659 | 7.19 | 98.90 | 99.28 | 93.45 | 44.33 |
Gtr_0L | 44,308,137 | 6.65 | 43,769,161 | 6.56 | 98.78 | 99.36 | 95.57 | 45.50 |
Gtr_12L | 42,008,271 | 6.30 | 41,421,274 | 6.21 | 98.59 | 99.23 | 94.87 | 45.50 |
Gtr_48L | 46,357,695 | 6.96 | 45,889,514 | 6.88 | 98.99 | 99.47 | 95.55 | 46.17 |
Gtr_0S | 44,317,347 | 6.65 | 43,840,067 | 6.58 | 98.92 | 99.29 | 92.52 | 44.50 |
Gtr_12S | 44,015,373 | 6.60 | 43,571,182 | 6.54 | 98.99 | 99.30 | 92.83 | 44.50 |
Gtr_48S | 49,119,885 | 7.37 | 48,625,743 | 7.29 | 98.99 | 99.24 | 92.62 | 45.33 |
Gtr_0R | 46,559,101 | 6.99 | 46,138,478 | 6.92 | 99.10 | 99.33 | 92.80 | 44.83 |
Gtr_12R | 43,146,409 | 6.47 | 42,689,842 | 6.40 | 98.95 | 99.47 | 94.06 | 44.00 |
Gtr_48R | 42,801,330 | 6.42 | 42,373,817 | 6.36 | 98.99 | 99.31 | 92.90 | 44.17 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, Q.; Magwanga, R.O.; Cai, X.; Lu, P.; Nyangasi Kirungu, J.; Zhou, Z.; Wang, X.; Wang, X.; Xu, Y.; Hou, Y.; et al. RNA-Sequencing, Physiological and RNAi Analyses Provide Insights into the Response Mechanism of the ABC-Mediated Resistance to Verticillium dahliae Infection in Cotton. Genes 2019, 10, 110. https://doi.org/10.3390/genes10020110
Dong Q, Magwanga RO, Cai X, Lu P, Nyangasi Kirungu J, Zhou Z, Wang X, Wang X, Xu Y, Hou Y, et al. RNA-Sequencing, Physiological and RNAi Analyses Provide Insights into the Response Mechanism of the ABC-Mediated Resistance to Verticillium dahliae Infection in Cotton. Genes. 2019; 10(2):110. https://doi.org/10.3390/genes10020110
Chicago/Turabian StyleDong, Qi, Richard Odongo Magwanga, Xiaoyan Cai, Pu Lu, Joy Nyangasi Kirungu, Zhongli Zhou, Xingfen Wang, Xingxing Wang, Yanchao Xu, Yuqing Hou, and et al. 2019. "RNA-Sequencing, Physiological and RNAi Analyses Provide Insights into the Response Mechanism of the ABC-Mediated Resistance to Verticillium dahliae Infection in Cotton" Genes 10, no. 2: 110. https://doi.org/10.3390/genes10020110
APA StyleDong, Q., Magwanga, R. O., Cai, X., Lu, P., Nyangasi Kirungu, J., Zhou, Z., Wang, X., Wang, X., Xu, Y., Hou, Y., Wang, K., Peng, R., Ma, Z., & Liu, F. (2019). RNA-Sequencing, Physiological and RNAi Analyses Provide Insights into the Response Mechanism of the ABC-Mediated Resistance to Verticillium dahliae Infection in Cotton. Genes, 10(2), 110. https://doi.org/10.3390/genes10020110