Assembly of a G-Quadruplex Repair Complex by the FANCJ DNA Helicase and the REV1 Polymerase
Abstract
:1. Introduction
1.1. What are G-Quadruplexes?
1.2. How Are G4s Removed in Cells?
1.3. What Is the Role of FANCJ in G4 Repair?
2. Materials and Methods
2.1. Buffers and Reagents
2.2. FANCJ Peptides and DNA Oligos
2.3. Recombinant Proteins
2.4. Fluorescence Spectroscopy
2.5. Circular Dichroism (CD)
2.6. Biolayer Interferometry (BLI)
2.7. Data Repository
3. Results
3.1. FANCJ AKKQ Binds to G4 DNA
3.2. An Optical Biosensor for AKKQ-G4 Binding
3.3. FANCJ PIP Recruits REV1 and PCNA
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bochman, M.L.; Paeschke, K.; Zakian, V.A. DNA secondary structures: Stability and function of G-quadruplex structures. Nat. Rev. Genet. 2012, 13, 770–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, F.; Ma, Y.; Guan, Y. Effects of Central Loop Length and Metal Ions on the Thermal Stability of G-Quadruplexes. Molecules 2019, 24, 1863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burge, S.; Parkinson, G.N.; Hazel, P.; Todd, A.K.; Neidle, S. Quadruplex DNA: Sequence, topology and structure. Nucleic Acids Res. 2006, 34, 5402–5415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. G-Quadruplex Secondary Structure Obtained from Circular Dichroism Spectroscopy. Angew. Chem. Int. Ed. Engl. 2018, 57, 7171–7175. [Google Scholar] [CrossRef] [PubMed]
- Rhodes, D.; Lipps, H.J. G-quadruplexes and their regulatory roles in biology. Nucleic Acids Res. 2015, 43, 8627–8637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siddiqui-Jain, A.; Grand, C.L.; Bearss, D.J.; Hurley, L.H. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598. [Google Scholar] [CrossRef] [Green Version]
- Song, J.; Perreault, J.P.; Topisirovic, I.; Richard, S. RNA G-quadruplexes and their potential regulatory roles in translation. Translation 2016, 4, e1244031. [Google Scholar] [CrossRef] [Green Version]
- Wolfe, A.L.; Singh, K.; Zhong, Y.; Drewe, P.; Rajasekhar, V.K.; Sanghvi, V.R.; Mavrakis, K.J.; Jiang, M.; Roderick, J.E.; van der Meulen, J.; et al. RNA G-quadruplexes cause eIF4A-dependent oncogene translation in cancer. Nature 2014, 513, 65–70. [Google Scholar] [CrossRef] [Green Version]
- Bidzinska, J.; Cimino-Reale, G.; Zaffaroni, N.; Folini, M. G-Quadruplex Structures in the Human Genome as Novel Therapeutic Targets. Molecules 2013, 18, 12368–12395. [Google Scholar] [CrossRef]
- Marin-Garcia, J. Mitochondrial DNA repair: A novel therapeutic target for heart failure. Heart Fail. Rev. 2016, 21, 475–487. [Google Scholar] [CrossRef]
- Neidle, S. Quadruplex Nucleic Acids as Novel Therapeutic Targets. J. Med. Chem. 2016, 59, 5987–6011. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Shin-ya, K.; Brosh, R.M. FANCJ helicase defective in Fanconia anemia and breast cancer unwinds G-quadruplex DNA to defend genomic stability. Mol. Cell. Biol. 2008, 28, 4116–4128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, B.; Geng, Y.; Liu, C.; Miao, H.; Ren, Y.; Xu, N.; Shi, X.; You, Y.; Lee, T.; Zhu, G. Characterizations of distinct parallel and antiparallel G-quadruplexes formed by two-repeat ALS and FTD related GGGGCC sequence. Sci. Rep. 2018, 8, 2366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.; Brosh, R.M. G-quadruplex nucleic acids and human disease. FEBS J. 2010, 277, 3470–3488. [Google Scholar] [CrossRef] [PubMed]
- Chambers, V.S.; Marsico, G.; Boutell, J.M.; di Antonio, M.; Smith, G.P.; Balasubramanian, S. High-throughput sequencing of DNA G-quadruplex structures in the human genome. Nat. Biotechnol. 2015, 33, 877–881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marsico, G.; Chambers, V.S.; Sahakyan, A.B.; McCauley, P.; Boutell, J.M.; Antonio, M.D.; Balasubramanian, S. Whole genome experimental maps of DNA G-quadruplexes in multiple species. Nucleic Acids Res. 2019, 47, 3862–3874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castillo Bosch, P.; Segura-Bayona, S.; Koole, W.; van Heteren, J.T.; Dewar, J.M.; Tijsterman, M.; Knipscheer, P. FANCJ promotes DNA synthesis through G-quadruplex structures. EMBO J. 2014, 33, 2521–2533. [Google Scholar] [CrossRef] [Green Version]
- Eddy, S.; Ketkar, A.; Zafar, M.K.; Maddukuri, L.; Choi, J.Y.; Eoff, R.L. Human Rev1 polymerase disrupts G-quadruplex DNA. Nucleic Acids Res. 2014, 42, 3272–3285. [Google Scholar] [CrossRef] [Green Version]
- Budhathoki, J.B.; Ray, S.; Urban, V.; Janscak, P.; Yodh, J.G.; Balci, H. RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP. Nucleic Acids Res. 2014, 42, 11528–11545. [Google Scholar] [CrossRef] [Green Version]
- Vannier, J.B.; Pavicic-Kaltenbrunner, V.; Petalcorin, M.I.; Ding, H.; Boulton, S.J. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity. Cell 2012, 149, 795–806. [Google Scholar] [CrossRef] [Green Version]
- Sanders, C.M. Human Pif1 helicase is a G-quadruplex DNA-binding protein with G-quadruplex DNA-unwinding activity. Biochem. J. 2010, 430, 119–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, G.; Xing, Z.; Tran, E.J.; Yang, D. DDX5 helicase resolves G-quadruplex and is involved in MYC gene transcriptional activation. Proc. Natl. Acad. Sci. USA 2019, 116, 20453–20461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, S.P.; Soranno, A.; Sparks, M.A.; Galletto, R. Branched unwinding mechanism of the Pif1 family of DNA helicases. Proc. Natl. Acad. Sci. USA 2019, 116, 24533–24541. [Google Scholar] [CrossRef] [PubMed]
- Voter, A.F.; Callaghan, M.M.; Tippana, R.; Myong, S.; Dillard, J.P.; Keck, J.L. Antigenic variation in Neisseria gonorrhoeae occurs independently of RecQ-mediated unwinding of the pilE G-quadruplex. J. Bacteriol. 2019. [Google Scholar] [CrossRef]
- Lohman, T.M.; Bjornson, K.P. Mechanisms of helicase-catalyzed DNA unwinding. Annu. Rev. Biochem. 1996, 65, 169–214. [Google Scholar] [CrossRef]
- Patel, S.S.; Donmez, I. Mechanisms of Helicases. J. Biol. Chem. 2006, 281, 18265–18268. [Google Scholar] [CrossRef] [Green Version]
- Steitz, T.A. DNA polymerases: Structural diversity and common mechanisms. J. Biol. Chem. 1999, 274, 17395–17398. [Google Scholar] [CrossRef] [Green Version]
- Lohman, T.M.; Tomko, E.J.; Wu, C.G. Non-hexameric DNA helicases and translocases: Mechanisms and regulation. Nat. Rev. Mol. Cell Biol. 2008, 9, 391–401. [Google Scholar] [CrossRef]
- Wu, C.G.; Spies, M. Overview: What Are Helicases? In DNA Helicases and DNA Motor Proteins; Springer: New York, NY, USA, 2013; pp. 1–16. [Google Scholar]
- Bandwar, R.P.; Patel, S.S. The energetics of consensus promoter opening by T7 RNA polymerase. J. Mol. Biol. 2002, 324, 63–72. [Google Scholar] [CrossRef]
- Cowart, M.; Gibson, K.J.; Allen, D.J.; Benkovic, S.J. DNA substrate structural requirements for the exonuclease and polymerase activities of procaryotic and phage DNA polymerases. Biochemistry 1989, 28, 1975–1983. [Google Scholar] [CrossRef]
- Reynolds, K.A.; Cameron, C.E.; Raney, K.D. Melting of Duplex DNA in the Absence of ATP by the NS3 Helicase Domain through Specific Interaction with a Single-Strand/Double-Strand Junction. Biochemistry 2015, 54, 4248–4258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wong, C.J.; Lucius, A.L.; Lohman, T.M. Energetics of DNA end binding by E.coli RecBC and RecBCD helicases indicate loop formation in the 3’-single-stranded DNA tail. J. Mol. Biol. 2005, 352, 765–782. [Google Scholar] [CrossRef] [PubMed]
- van Wietmarschen, N.; Merzouk, S.; Halsema, N.; Spierings, D.C.J.; Guryev, V.; Lansdorp, P.M. BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes. Nat. Commun. 2018, 9, 271. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnson, J.E.; Cao, K.; Ryvkin, P.; Wang, L.S.; Johnson, F.B. Altered gene expression in the Werner and Bloom syndromes is associated with sequences having G-quadruplex forming potential. Nucleic Acids Res. 2010, 38, 1114–1122. [Google Scholar] [CrossRef] [PubMed]
- Paeschke, K.; Capra, J.A.; Zakian, V.A. DNA replication through G-quadruplex motifs is promoted by the Saccharomyces cerevisiae Pif1 DNA helicase. Cell 2011, 145, 678–691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schiavone, D.; Guilbaud, G.; Murat, P.; Papadopoulou, C.; Sarkies, P.; Prioleau, M.N.; Balasubramanian, S.; Sale, J.E. Determinants of G quadruplex-induced epigenetic instability in REV1-deficient cells. EMBO J. 2014, 33, 2507–2520. [Google Scholar] [CrossRef]
- Lerner, L.K.; Sale, J.E. Replication of G Quadruplex DNA. Genes 2019, 10, 95. [Google Scholar] [CrossRef] [Green Version]
- Huber, M.D.; Duquette, M.L.; Shiels, J.C.; Maizels, N. A conserved G4 DNA binding domain in RecQ family helicases. J. Mol. Biol. 2006, 358, 1071–1080. [Google Scholar] [CrossRef] [PubMed]
- Lattmann, S.; Giri, B.; Vaughn, J.P.; Akman, S.A.; Nagamine, Y. Role of the amino terminal RHAU-specific motif in the recognition and resolution of guanine quadruplex-RNA by the DEAH-box RNA helicase RHAU. Nucleic Acids Res. 2010, 38, 6219–6233. [Google Scholar] [CrossRef] [Green Version]
- Heddi, B.; Cheong, V.V.; Martadinata, H.; Phan, A.T. Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex. Proc. Natl. Acad. Sci. USA 2015, 112, 9608–9613. [Google Scholar] [CrossRef] [Green Version]
- Wu, C.G.; Spies, M. G-quadruplex recognition and remodeling by the FANCJ helicase. Nucleic Acids Res. 2016, 44, 8742–8753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bielskute, S.; Plavec, J.; Podbevsek, P. Impact of Oxidative Lesions on the Human Telomeric G-Quadruplex. J. Am. Chem. Soc. 2019, 141, 2594–2603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vorlickova, M.; Tomasko, M.; Sagi, A.J.; Bednarova, K.; Sagi, J. 8-oxoguanine in a quadruplex of the human telomere DNA sequence. FEBS J. 2012, 279, 29–39. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, T.; D’Andrea, A.D. Molecular pathogenesis of Fanconi anemia: Recent progress. Blood 2006, 107, 4223–4233. [Google Scholar] [CrossRef] [Green Version]
- Brosh, R.M.; Cantor, S.B. Molecular and cellular functions of the FANCJ DNA helicase defective in cancer and in Fanconi anemia. Front. Genet. 2014, 5, 372. [Google Scholar] [CrossRef] [Green Version]
- Palovcak, A.; Liu, W.; Yuan, F.; Zhang, Y. Maintenance of genome stability by Fanconi anemia proteins. Cell Biosci. 2017, 7, 8. [Google Scholar] [CrossRef] [Green Version]
- Datta, A.; Brosh, R.M. Holding All the Cards-How Fanconi Anemia Proteins Deal with Replication Stress and Preserve Genomic Stability. Genes (Basel) 2019, 10, 170. [Google Scholar] [CrossRef] [Green Version]
- Cantor, S.B.; Xie, J. Assessing the link between BACH1/FANCJ and MLH1 in DNA crosslink repair. Environ. Mol. Mutagen. 2010, 51, 500–507. [Google Scholar] [CrossRef]
- Sarkies, P.; Murat, P.; Phillips, L.G.; Patel, K.J.; Balasubramanian, S.; Sale, J.E. FANCJ coordinates two pathways that maintain epigenetic stability at G-quadruplex DNA. Nucleic Acids Res. 2012, 40, 1485–1498. [Google Scholar] [CrossRef]
- Nelson, J.R.; Lawrence, C.W.; Hinkle, D.C. Deoxycytidyl transferase activity of yeast REV1 protein. Nature 1996, 382, 729–731. [Google Scholar] [CrossRef]
- Boehm, E.M.; Gildenberg, M.S.; Washington, M.T. The Many Roles of PCNA in Eukaryotic DNA Replication. Enzymes 2016, 39, 231–254. [Google Scholar] [PubMed] [Green Version]
- Masuda, Y.; Kanao, R.; Kaji, K.; Ohmori, H.; Hanaoka, F.; Masutani, C. Different types of interaction between PCNA and PIP boxes contribute to distinct cellular functions of Y-family DNA polymerases. Nucleic Acids Res. 2015, 43, 7898–7910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boehm, E.M.; Powers, K.T.; Kondratick, C.M.; Spies, M.; Houtman, J.C.; Washington, M.T. The Proliferating Cell Nuclear Antigen (PCNA)-interacting Protein (PIP) Motif of DNA Polymerase eta Mediates Its Interaction with the C-terminal Domain of Rev1. J. Biol. Chem. 2016, 291, 8735–8744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boehm, E.M.; Washington, M.T. R.I.P. to the PIP: PCNA-Binding Motif no Longer Considered Specific: PIP Motifs and other Related Sequences are not Distinct Entities and can Bind Multiple Proteins Involved in Genome Maintenance. Bioessay 2016, 38, 1117–1122. [Google Scholar] [CrossRef]
- Prestel, A.; Wichmann, N.; Martins, J.M.; Marabini, R.; Kassem, N.; Broendum, S.S.; Otterlei, M.; Nielsen, O.; Willemoes, M.; Ploug, M.; et al. The PCNA interaction motifs revisited: Thinking outside the PIP-box. Cell Mol. Life Sci. 2019, 1–21. [Google Scholar] [CrossRef] [Green Version]
- Petraccone, L.; Spink, C.; Trent, J.O.; Garbett, N.C.; Mekmaysy, C.S.; Giancola, C.; Chaires, J.B. Structure and stability of higher-order human telomeric quadruplexes. J. Am. Chem. Soc. 2011, 133, 20951–20961. [Google Scholar] [CrossRef] [Green Version]
- Ogloblina, A.M.; Bannikova, V.A.; Khristich, A.N.; Oretskaya, T.S.; Yakubovskaya, M.G.; Dolinnaya, N.G. Parallel G-Quadruplexes Formed by Guanine-Rich Microsatellite Repeats Inhibit Human Topoisomerase, I. Biochem. (Mosc.) 2015, 80, 1026–1038. [Google Scholar] [CrossRef]
- Azmiri, S.; Lee, J.E. Measuring Protein-Protein and Protein-Nucleic Acid Interactions by Biolayer Interferometry. Curr. Protoc. Protein Sci. 2015, 79, 19–25. [Google Scholar]
- Ciesielski, G.L.; Hytonen, V.P.; Kaguni, L.S. Biolayer Interferometry: A Novel Method to Elucidate Protein-Protein and Protein-DNA Interactions in the Mitochondrial DNA Replisome. Methods Mol. Biol. 2016, 1351, 223–231. [Google Scholar]
- Concepcion, J.; Witte, K.; Wartchow, C.; Choo, S.; Yao, D.; Persson, H.; Wei, J.; Li, P.; Heidecker, B.; Ma, W.; et al. Label-free detection of biomolecular interactions using BioLayer interferometry for kinetic characterization. Comb. Chem. High Throughput Screen 2009, 12, 791–800. [Google Scholar] [CrossRef]
- Castrec, B.; Rouillon, C.; Henneke, G.; Flament, D.; Querellou, J.; Raffin, J.P. Binding to PCNA in Euryarchaeal DNA Replication requires two PIP motifs for DNA polymerase D and one PIP motif for DNA polymerase B. J. Mol. Biol. 2009, 394, 209–218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gulbis, J.M.; Kelman, Z.; Hurwitz, J.; O’Donnell, M.; Kuriyan, J. Structure of the C-terminal region of p21(WAF1/CIP1) complexed with human PCNA. Cell 1996, 87, 297–306. [Google Scholar] [CrossRef] [Green Version]
- Gueneau, E.; Dherin, C.; Legrand, P.; Tellier-Lebegue, C.; Gilquin, B.; Bonnesoeur, P.; Londino, F.; Quemener, C.; le Du, M.H.; Marquez, J.A.; et al. Structure of the MutLalpha C-terminal domain reveals how Mlh1 contributes to Pms1 endonuclease site. Nat. Struct Mol. Biol. 2013, 20, 461–468. [Google Scholar] [CrossRef] [PubMed]
- De March, M.; Merino, N.; Barrera-Vilarmau, S.; Crehuet, R.; Onesti, S.; Blanco, F.J.; de Biasio, A. Structural basis of human PCNA sliding on DNA. Nat. Commun. 2017, 8, 13935. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pozhidaeva, A.; Pustovalova, Y.; D’Souza, S.; Bezsonova, I.; Walker, G.C.; Korzhnev, D.M. NMR structure and dynamics of the C-terminal domain from human Rev1 and its complex with Rev1 interacting region of DNA polymerase eta. Biochemistry 2012, 51, 5506–5520. [Google Scholar] [CrossRef] [Green Version]
- Boehm, E.M.; Spies, M.; Washington, M.T. PCNA tool belts and polymerase bridges form during translesion synthesis. Nucleic Acids Res. 2016, 44, 8250–8260. [Google Scholar] [CrossRef] [Green Version]
- Ohashi, E.; Hanafusa, T.; Kamei, K.; Song, I.; Tomida, J.; Hashimoto, H.; Vaziri, C.; Ohmori, H. Identification of a novel REV1-interacting motif necessary for DNA polymerase kappa function. Genes Cells 2009, 14, 101–111. [Google Scholar] [CrossRef] [Green Version]
- Hishiki, A.; Hashimoto, H.; Hanafusa, T.; Kamei, K.; Ohashi, E.; Shimizu, T.; Ohmori, H.; Sato, M. Structural basis for novel interactions between human translesion synthesis polymerases and proliferating cell nuclear antigen. J. Biol. Chem. 2009, 284, 10552–10560. [Google Scholar] [CrossRef] [Green Version]
- Gilljam, K.M.; Feyzi, E.; Aas, P.A.; Sousa, M.M.; Muller, R.; Vagbo, C.B.; Catterall, T.C.; Liabakk, N.B.; Slupphaug, G.; Drablos, F.; et al. Identification of a novel, widespread, and functionally important PCNA-binding motif. J. Cell Biol. 2009, 186, 645–654. [Google Scholar] [CrossRef] [Green Version]
Peptide Sequences | |||
Name | Sequence (N→C) | Molar Extinction Coefficient (M−1cm−1) | Purpose |
FANCJ AKKQ-W | SPEKTTLAAKLSAKKQASIW | 5500 | Fluorescence and BLI |
bioFANCJ PIP | Biotin-SWSSFNSLGQYFTGKIP | 6990 | BLI |
bioFANCJ PIP AA | Biotin-SWSSFNSLGQAATGKIP | 5500 | BLI |
DNA Sequences | |||
Name | Sequence (5’→3’) | Molar Extinction Coefficient (M−1cm−1) | Purpose |
(TTAGGG)4 | TTAGGGTTAGGGTTAGGGTTAGGG | 244,600 | Fluorescence and CD |
(TTAGGG)4 8oxo1 | TTA/i8oxodG/GGTTAGGGTTAGGGTTAGGG | 239,000 | Fluorescence and CD |
(TTAGGG)4 8oxo5 | TTAGGGTTAG/i8oxodG/GTTAGGGTTAGGG | 239,000 | Fluorescence and CD |
(GGGT)4 | GGGTGGGTGGGTGGGT | 157,200 | Fluorescence and CD |
(GGGT)4 8oxo1 | T/i8oxodG/GGTGGGTGGGTGGGT | 159,100 | Fluorescence and CD |
(GGGT)4 8oxo5 | GGGTG/i8oxodG/GTGGGTGGGT | 151,600 | Fluorescence and CD |
5’bioPEG12-(TTAGGG)4 | /5Biosg//iSp18//iSp18/TTAGGGTTAGGGTTAGGTTAGGG | 244,600 | BLI |
5’bioPEG12-(TTAGGG)4-8oxo1 | /5Biosg//iSp18//iSp18/TTA/i8oxodG/GGTTAGGGTTAGGGTTAGGG | 239,000 | BLI |
5’bioPEG12-(TTAGGG)4-8oxo5 | /5Biosg//iSp18//iSp18/TTAGGGTTAG/i8oxodG/GTTAGGGTTAGGG | 239,000 | BLI |
DNA Sequence | K (M−1) | A | R2 |
---|---|---|---|
(TTAGGG)4 | 1.6 ± 0.7 × 106 | 0.88 ± 0.05 | 0.9961 |
(TTAGGG)4 8oxo1 | 1.3 ± 0.4 × 106 | 0.90 ± 0.04 | 0.9974 |
(TTAGGG)4 8oxo5 | 1.4 ± 0.5 × 106 | 0.91 ± 0.05 | 0.9967 |
(GGGT)4 | 2.7 ± 0.4 × 105 | 0.93 ± 0.04 | 0.9977 |
(GGGT)4 8oxo1 | 7.7 ± 0.7 × 105 | 0.93 ± 0.01 | 0.9988 |
(GGGT)4 8oxo5 | 4.4 ± 0.6 × 105 | 0.91 ± 0.03 | 0.9972 |
DNA Sequence | K (M−1) | A | R2 |
---|---|---|---|
bioPEG12-(TTAGGG)4 | 9.4 ± 1.1 × 104 | 0.74 ± 0.03 | 0.9973 |
bioPEG12-(TTAGGG)4-8oxo1 | 2.3 ± 0.8 × 105 | 0.49 ± 0.06 | 0.9807 |
bioPEG12-(TTAGGG)4-8oxo5 | 1.8 ± 0.2 × 105 | 0.69 ± 0.03 | 0.9954 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lowran, K.; Campbell, L.; Popp, P.; Wu, C.G. Assembly of a G-Quadruplex Repair Complex by the FANCJ DNA Helicase and the REV1 Polymerase. Genes 2020, 11, 5. https://doi.org/10.3390/genes11010005
Lowran K, Campbell L, Popp P, Wu CG. Assembly of a G-Quadruplex Repair Complex by the FANCJ DNA Helicase and the REV1 Polymerase. Genes. 2020; 11(1):5. https://doi.org/10.3390/genes11010005
Chicago/Turabian StyleLowran, Kaitlin, Laura Campbell, Phillip Popp, and Colin G. Wu. 2020. "Assembly of a G-Quadruplex Repair Complex by the FANCJ DNA Helicase and the REV1 Polymerase" Genes 11, no. 1: 5. https://doi.org/10.3390/genes11010005