Characterization, Knockdown and Parental Effect of Hexokinase Gene of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) Revealed by RNA Interference
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. RNA Isolation, cDNA Synthesis and RT-PCR
2.3. Sequence Retrieval and Analysis
2.4. Phylogenetic Analysis of CmHK
2.5. Tissue and Developmental Expression Patterns of CmHK
2.6. Synthesis and Effect of dsCmHK
2.7. Parental RNAi
2.8. Statistical Analyses
3. Results
3.1. Sequence and Expression Pattern Analyes of CmHK
3.2. Phylogenetic Analysis and 3D Structure of CmHK
3.3. Effects of RNAi
3.3.1. Effects of RNAi on CmHK Gene Expression
3.3.2. Phenotypic Effects of RNAi on C. medinalis
3.3.3. Parental RNAi
G1-Generation
G2-Generation
G3-Generation
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Merzendorfer, H.; Zimoch, L. Chitin metabolism in insects: Structure, function and regulation of chitin synthases and chitinases. J. Exp. Biol. 2003, 206, 4393–4412. [Google Scholar] [CrossRef] [PubMed]
- Merzendorfer, H. Insect chitin synthases: A review. J. Comp. Physiol. 2006, 176, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Van Dellen, K.L.; Bulik, D.A.; Specht, C.A.; Robbins, P.W.; Samuelson, J.C. Heterologous expression of an Entamoeba histolytica chitin synthase in Saccharomyces cerevisiae. Eukaryotic Cell 2006, 5, 203–206. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kramer, K.J. Chitin metabolism in insects. Compr. Mol. Insect Sci. 2005, 4, 111–144. [Google Scholar]
- Zhuo, W.; Fang, Y.; Kong, L.; Li, X.; Sima, Y.; Xu, S. Chitin synthase A: A novel epidermal development regulation gene in the larvae of Bombyx mori. Mol. Biol. Rep. 2014, 41, 4177–4186. [Google Scholar] [CrossRef]
- Moreira, M.F.; dos Santos, A.S.; Marotta, H.R.; Mansur, J.F.; Ramos, I.B.; Machado, E.A.; Souza, G.H.; Eberlin, M.N.; Kaiser, C.R.; Kramer, K.J.; et al. A chitin-like component in Aedes aegypti eggshells, eggs and ovaries. Insect Biochem. Mol. Biol. 2007, 37, 1249–1261. [Google Scholar] [CrossRef]
- Bixby-Brosi, A.J.; Potter, D.A. Can a chitin-synthesis-inhibiting turfgrass fungicide enhance black cutworm susceptibility to a baculovirus? Pest Manag. Sci. 2012, 68, 324–329. [Google Scholar] [CrossRef]
- Niederacher, D.; Entian, K.D. Characterization of Hex2 protein, a negative regulatory element necessary for glucose repression in yeast. Eur. J. Biochem. 1991, 200, 311–319. [Google Scholar] [CrossRef]
- Herrero, P.; Galindez, J.; Ruiz, N.; Martínez-Campa, C.; Moreno, F. Transcriptional regulation of the Saccharomyces cerevisiae HXK1, HXK2 and GLK1 genes. Yeast 1995, 11, 137–144. [Google Scholar] [CrossRef]
- Bryson, J.M.; Coy, P.E.; Gottlob, K.; Hay, N.; Robey, R.B. Increased hexokinase activity, of either ectopic or endogenous origin, protects renal epithelial cells against acute oxidant-induced cell death. J. Biol. Chem. 2002, 277, 11392–11400. [Google Scholar] [CrossRef]
- Denlinger, D.L.; Yocum, G.D.; Rinehart, J.P. Chapter 10—Hormonal Control of Diapause. In Insect Endocrinology; Gilbert, L.I., Ed.; Elsevier: Amsterdam, The Netherlands, 2011; pp. 430–463. [Google Scholar]
- Gurney, M.E.; Heinrich, S.P.; Lee, M.R.; Yin, H.S. Molecular cloning and expression of neuroleukin, a neurotrophic factor for spinal and sensory neurons. Science 1986, 234, 566–574. [Google Scholar] [CrossRef] [PubMed]
- Chaput, M.; Claes, V.; Portetelle, D.; Cludts, I.; Cravador, A.; Burny, A.; Gras, H.; Tartar, A. The neurotrophic factor neuroleukin is 90% homologous with phosphohexose isomerase. Nature 1988, 332, 454–455. [Google Scholar] [CrossRef] [PubMed]
- Faik, P.; Walker, J.I.; Redmill, A.A.; Morgan, M.J. Mouse glucose-6-phosphate isomerase and neuroleukin have identical 3′ sequences. Nature 1988, 332, 455–456. [Google Scholar] [CrossRef]
- Zhang, W.Q.; Chen, X.F.; Tang, B.; Tian, H.G.; Chen, J.; Yao, Q. Insect chitin biosynthesis and its regulation. Chin. J. Appl. Entomol. 2011, 48, 475–479. [Google Scholar]
- Cuomo, C.A.; Desjardins, C.A.; Bakowski, M.A.; Goldberg, J.; Ma, A.T.; Becnel, J.J.; Didier, E.S.; Fan, L.; Heiman, D.I.; Levin, J.Z.; et al. Microsporidian genome analysis reveals evolutionary strategies for obligate intracellular growth. Genome Res. 2012, 22, 2478–2488. [Google Scholar] [CrossRef] [PubMed]
- Senderskiy, I.V.; Timofeev, S.A.; Seliverstova, E.V.; Pavlova, O.A.; Dolgikh, V.V. Secretion of Antonospora (Paranosema) locustae proteins into infected cells suggests an active role of microsporidia in the control of host programs and metabolic processes. PLoS ONE 2014, 9, e93585. [Google Scholar] [CrossRef] [PubMed]
- Timofeev, S.A.; Senderskiy, I.V.; Tsarev, A.A.; Tokarev, Y.S.; Dolgikh, V.V. Heterologous expression of Paranosema (Antonospora) locustae hexokinase in lepidopteran, Sf9, cells is followed by accumulation of the microsporidian protein in insect cell nuclei. J. Invertebr. Pathol. 2017, 143, 104–107. [Google Scholar] [CrossRef] [PubMed]
- Reinke, A.W.; Balla, K.M.; Bennett, E.J.; Troemel, E.R. Identification of microsporidia host-exposed proteins reveals a repertoire of large paralogous gene families and rapidly evolving proteins. BioRxiv 2016, 056788. [Google Scholar] [CrossRef]
- Ferguson, S.; Lucocq, J.M. The invasive cell coat at the microsporidian Trachipleistophora hominis–host cell interface contains secreted hexokinases. Microbiology 2018, 8, e00696. [Google Scholar] [CrossRef]
- Iwasaki, S.; Sasaki, H.M.; Sakaguchi, Y.; Suzuki, T.; Tadakuma, H.; Tomari, Y. Defining fundamental steps in the assembly of the Drosophila RNAi enzyme complex. Nat. Cell Biol. 2015, 521, 533–536. [Google Scholar] [CrossRef]
- Hammond, S.M. Dicing and slicing: The core machinery of the RNA interference pathway. FEBS Lett. 2005, 579, 5822–5829. [Google Scholar] [CrossRef]
- Vodovar, N.; Saleh, M.-C. Of Insects and Viruses: The Role of Small RNAs in Insect Defence. In Advances in Insect Physiology; Elsevier: Amsterdam, The Netherlands, 2012; pp. 1–36. [Google Scholar]
- Yang, G.; You, M.-S.; Vasseur, L.; Zhao, Y.; Liu, C. Development of RNAi in insects-based pest control. In Pesticides in the Modern World—Pests Control and Pesticides Exposure and Toxicity Assessment; InTech Publisher: Rijeka, Croatia, 2011; Volume 3, pp. 27–38. [Google Scholar] [CrossRef][Green Version]
- Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391, 806–811. [Google Scholar] [CrossRef]
- Fire, A.Z. Gene silencing by double-stranded RNA (Nobel lecture). Angew. Chem. 2007, 46, 6966–6984. [Google Scholar] [CrossRef]
- Hussain, M.; Abraham, A.M.; Asgari, S. An Ascovirus-encoded RNase iii autoregulates its expression and suppresses RNA interference-mediated gene silencing. J. Virol. 2010, 84, 3624–3630. [Google Scholar] [CrossRef] [PubMed]
- Huvenne, H.; Smagghe, G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: A review. J. Insect Physiol. 2010, 56, 227–235. [Google Scholar] [CrossRef]
- Scott, J.G.; Michel, K.; Bartholomay, L.C.; Siegfried, B.D.; Hunter, W.B.; Smagghe, G.; Zhu, K.Y.; Douglas, A.E. Towards the elements of successful insect RNAi. J. Insect Physiol. 2013, 59, 1212–1221. [Google Scholar] [CrossRef] [PubMed]
- Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.-L.; Barthel, A.; et al. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Shu, Y.H.; Wang, J.W.; Lu, K.; Zhou, J.L.; Zhou, Q.; Zhang, G.R. The first vitellogenin receptor from a Lepidopteran insect: Molecular characterization, expression patterns and RNA interference analysis. Insect Mol. Biol. 2010, 20, 61–73. [Google Scholar] [CrossRef]
- Bucher, G.; Scholten, J.; Klingler, M. Parental RNAi in Tribolium (Coleoptera). Curr. Biol. 2002, 12, R85–R86. [Google Scholar] [CrossRef]
- Tomoyasu, Y.; Denell, R.E. Larval RNAi in Tribolium (Coleoptera) for analyzing adult development. Dev. Genes Evol. 2004, 214, 575–578. [Google Scholar] [CrossRef]
- Ohde, T.; Masumoto, M.; Morita-Miwa, M.; Matsuura, H.; Yoshioka, H.; Yaginuma, T.; Niimi, T. Vestigial and scalloped in the ladybird beetle: A conserved function in wing development and a novel function in pupal ecdysis. Insect Mol. Biol. 2009, 18, 571–581. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.; Wang, S.; Zhang, F. Two storage hexamerins from the beet armyworm Spodoptera exigua: Cloning, characterization and the effect of gene silencing on survival. BMC Mol. Biol. 2010, 11, 65. [Google Scholar] [CrossRef] [PubMed]
- Rajagopal, R.; Sivakumar, S.; Agrawal, N.; Malhotra, P.; Bhatnagar, R.K. Silencing of Midgut Aminopeptidase N ofSpodoptera lituraby Double-stranded RNA Establishes Its Role asBacillus thuringiensisToxin Receptor. J. Biol. Chem. 2002, 277, 46849–46851. [Google Scholar] [CrossRef]
- Levin, D.M.; Breuer, L.N.; Zhuang, S.; Anderson, S.A.; Nardi, J.B.; Kanost, M.R. A hemocyte-specific integrin required for hemocytic encapsulation in the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 2005, 35, 369–380. [Google Scholar] [CrossRef]
- Ohnishi, A.; Hull, J.J.; Matsumoto, S. Targeted disruption of genes in the Bombyx mori sex pheromone biosynthetic pathway. Proc. Natl. Acad. Sci. USA 2006, 103, 4398–4403. [Google Scholar] [CrossRef]
- Xu, W.-H.; Lu, Y.-X.; Denlinger, D.L. Cross-talk between the fat body and brain regulates insect developmental arrest. Proc. Natl. Acad. Sci. USA 2012, 109, 14687–14692. [Google Scholar] [CrossRef]
- Li, S.-W.; Yang, H.; Liu, Y.-F.; Liao, Q.-R.; Du, J.; Jin, D.-C. Transcriptome and gene expression analysis of the rice leaf folder, Cnaphalocrosis medinalis. PLoS ONE 2012, 7, e47401. [Google Scholar] [CrossRef]
- Ronco, M.; Uda, T.; Mito, T.; Minelli, A.; Noji, S.; Klingler, M. Antenna and all gnathal appendages are similarly transformed by homothorax knock-down in the cricket Gryllus bimaculatus. Dev. Biol. 2008, 313, 80–92. [Google Scholar] [CrossRef] [PubMed]
- Grossmann, D.; Scholten, J.; Prpic, N.-M. Separable functions of wingless in distal and ventral patterning of the Tribolium leg. Dev. Genes Evol. 2009, 219, 469–479. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lavore, A.; Pagola, L.; Esponda-Behrens, N.; Rivera-Pomar, R. The gap gene giant of Rhodnius prolixus is maternally expressed and required for proper head and abdomen formation. Dev. Biol. 2012, 361, 147–155. [Google Scholar] [CrossRef]
- Sato, A.; Sokabe, T.; Kashio, M.; Yasukochi, Y.; Tominaga, M.; Shiomi, K. Embryonic thermosensitive TRPA1 determines transgenerational diapause phenotype of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2014, 111, E1249–E1255. [Google Scholar] [CrossRef]
- Xu, H.-J.; Chen, T.; Ma, X.-F.; Xue, J.; Pan, P.-L.; Zhang, X.-C.; Cheng, J.-A.; Zhang, C.-X. Genome-wide screening for components of small interfering RNA (siRNA) and micro-RNA (miRNA) pathways in the brown planthopper, Nilaparvata lugens(Hemiptera: Delphacidae). Insect Mol. Biol. 2013, 22, 635–647. [Google Scholar] [CrossRef]
- Beeman, R.W.; Stuart, J.J.; Haas, M.; Denell, R.E. Genetic analysis of the homeotic gene complex (HOM-C) in the beetle Tribolium castaneum. Dev. Biol. 1989, 133, 196–209. [Google Scholar] [CrossRef]
- Boggs, R.T.; Gregor, P.; Idriss, S.; Belote, J.M.; McKeown, M. Regulation of sexual differentiation in D. melanogaster via alternative splicing of RNA from the transformer gene. Cell 1987, 50, 739–747. [Google Scholar] [CrossRef]
- Shukla, J.N.; Palli, S.R. Sex determination in beetles: Production of all male progeny by Parental RNAi knockdown of transformer. Sci. Rep. 2012, 2, 602. [Google Scholar] [CrossRef]
- Lehmann, R.; Nüsslein-Volhard, C. hunchback, a gene required for segmentation of an anterior and posterior region of the Drosophila embryo. Dev. Biol. 1987, 119, 402–417. [Google Scholar] [CrossRef]
- Liu, P.Z. hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development 2004, 131, 1515–1527. [Google Scholar] [CrossRef]
- Mao, J.; Liu, C.; Zeng, F. Hunchbackis required for abdominal identity suppression and germband growth in the parthenogenetic embryogenesis of the pea aphid, Acyrthosiphonpisum. Arch. Insect Biochem. Physiol. 2013, 84, 209–221. [Google Scholar] [CrossRef]
- Khajuria, C.; Vélez, A.M.; Rangasamy, M.; Wang, H.; Fishilevich, E.; Frey, M.L.; Carneiro, N.P.; Gandra, P.; Narva, K.E.; Siegfried, B.D. Parental RNA interference of genes involved in embryonic development of the western corn rootworm, Diabrotica virgifera virgifera LeConte. Insect Biochem. Mol. Biol. 2015, 63, 54–62. [Google Scholar] [CrossRef]
- Zheng, X.; Ren, X.; Jianya, S. Insecticide Susceptibility of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) in China. J. Econ. Èntomol. 2011, 104, 653–658. [Google Scholar] [CrossRef] [PubMed]
- Heinrichs, E.A.; Camanag, E.; Romena, A. Evaluation of Rice Cultivars for Resistance to Cnaphalocrocis medinalis Guenee (Lepidoptera: Pyralidae). J. Econ. Èntomol. 1985, 78, 274–278. [Google Scholar] [CrossRef]
- Nanda, U.K.; Bisoi, R.C. Bionomics of rice leaffolder, Cnaphalocrocis medinalis Guenee (Pyralidae, Lepidoptera). Orissa J. Agric. Res. 1990, 3, 130–135. [Google Scholar]
- Shah, S.M.; Rehman, A.; Abassi, F.M.; Khalil, I.H.; Ali, A. Characterization of wild rice species in response to leaffolder Cnaphalocrocis medinalis. Sarhad J. Agric. 2008, 24, 69–74. [Google Scholar]
- Huang, J.; Hu, R.; Pray, C.; Qiao, F.; Rozelle, S. Biotechnology as an alternative to chemical pesticides: A case study of Bt cotton in China. Agric. Econ. 2003, 29, 55–67. [Google Scholar] [CrossRef]
- Khan, Z.R.; Barrion, A.T.; Litsinger, J.A.; Castilla, N.P.; Joshi, R.C. A Bibliography of Rice Leaffolders (Lepidoptera: Pyralidae). Int. J. Trop. Insect Sci. 1988, 9, 129–174. [Google Scholar] [CrossRef]
- Shanmugam, T.R.; Sendhil, R.; Thirumalvalavan, V. Quantification and prioritization of constraints causing yield loss in rice (Oryza sativa) in India. Agric. Trop. Subtropica 2006, 39, 194–201. [Google Scholar]
- Kaushik, C. Extent of damage by leaf folder, Cnaphalocrocis medinalis (Guenee) in paddy cultivars at Raiganj, Uttar Dinajpur, West Bengal. Curr. Biot. 2010, 4, 365–367. [Google Scholar]
- Zhang, S.K.; Ren, X.B.; Wang, Y.C.; Su, J. Resistance in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) to new chemistry insecticides. J. Econ. Entomol. 2014, 107, 815–820. [Google Scholar] [CrossRef]
- Kang, C.Y.; Zhao, C.Q.; Wu, G. Progress in molecular mechanisms of insect resistance to insecticides. Entomol. J. East China 2007, 2, 11. [Google Scholar]
- Guan, S.P.; Mok, Y.K.; Koo, K.N.; Chu, K.L.; Wong, W.S. Chitinases: Biomarkers for human diseases. Protein Pept. Lett. 2009, 16, 490–498. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Chem. Biol. 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Marks, D.S.; Colwell, L.J.; Sheridan, R.; Hopf, T.A.; Pagnani, A.; Zecchina, R.; Sander, C. Protein 3D structure computed from evolutionary sequence variation. PLoS ONE 2011, 6, e28766. [Google Scholar] [CrossRef] [PubMed]
- Vastenhouw, N.L.; Brunschwig, K.; Okihara, K.L.; Müller, F.; Tijsterman, M.; Plasterk, R.H.A. Long-term gene silencing by RNAi. Nat. Cell Biol. 2006, 442, 882. [Google Scholar] [CrossRef]
- Chen, M.; Shelton, A.; Ye, G.-Y. Insect-resistant genetically modified rice in China: From research to commercialization. Annu. Rev. Entomol. 2011, 56, 81–101. [Google Scholar] [CrossRef]
- Abudulai, M.; Shepard, B.M.; Mitchell, P.L. Parasitism and predation on eggs of Leptoglossus phyllopus (Hemiptera: Coreidae) in cowpea: Impact of endosulfan sprays. J. Agric. Urban Entomol. 2001, 18, 105–115. [Google Scholar]
- Yu, H.-Z.; Wen, D.-F.; Wang, W.-L.; Geng, L.; Zhang, Y.; Xu, J.-P. Identification of genes putatively involved in chitin metabolism and insecticide detoxification in the rice leaf folder (Cnaphalocrocis medinalis) larvae through transcriptomic analysis. Int. J. Mol. Sci. 2015, 16, 21873–21896. [Google Scholar] [CrossRef]
- Ge, L.-Q.; Gu, H.-T.; Li, X.; Zheng, S.; Zhou, Z.; Miao, H.; Wu, J.-C. Silencing of triazophos-induced Hexokinase-1-like reduces fecundity in Nilaparvata lugens (Stål) (Hemiptera: Delphacidae). Pestic. Biochem. Physiol. 2019, 153, 176–184. [Google Scholar] [CrossRef]
- Vandenborre, G.; Smagghe, G.; Ghesquière, B.; Menschaert, G.; Rao, R.N.; Gevaert, K.; Van Damme, E.J.M. Diversity in protein glycosylation among insect species. PLoS ONE 2011, 6, e16682. [Google Scholar] [CrossRef]
- Burkhard, P.; Stetefeld, J.; Strelkov, S.V. Coiled coils: A highly versatile protein folding motif. Trends Cell Biol. 2001, 11, 82–88. [Google Scholar] [CrossRef]
- Yanagawa, H.-A. Tissue distribution, purifications, and properties of multiple forms of hexokinase in the silkworm, Bombyx mori. Insect Biochem. 1978, 8, 293–305. [Google Scholar] [CrossRef]
- Tadano, T. Genetic studies on hexokinase in the mosquito Aedes togoi. Biochem. Genet. 1987, 25, 375–384. [Google Scholar] [CrossRef] [PubMed]
- Gakhar, S.K.; Nagpal, V. Developmental expression and properties of hexokinase in the malarial vector Anopheles stephensi (Culicidae: Diptera). Cytobios 1996, 87, 7–18. [Google Scholar]
- Tao, X.Y.; Xue, X.Y.; Huang, Y.P.; Chen, X.Y.; Mao, Y.B. Gossypol-enhanced P450 gene pool contributes to cotton bollworm tolerance to a pyrethroid insecticide. Mol. Ecol. 2012, 21, 4371–4385. [Google Scholar] [CrossRef]
- Yilmazel, B.; Hu, Y.; Sigoillot, F.; Smith, J.A.; Shamu, C.E.; Perrimon, N.; Mohr, S.E. Online GESS: Prediction of miRNA-like off-target effects in large-scale RNAi screen data by seed region analysis. BMC Bioinform. 2014, 15, 192. [Google Scholar] [CrossRef]
- Liu, S.; Ding, Z.; Zhang, C.; Yang, B.; Liu, Z. Gene knockdown by intro-thoracic injection of double-stranded RNA in the brown planthopper, Nilaparvata lugens. Insect Biochem. Mol. Biol. 2010, 40, 666–671. [Google Scholar] [CrossRef]
- Guan, R.B.; Li, H.C.; Miao, X.X. Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis. Insect Sci. 2018, 25, 356–367. [Google Scholar] [CrossRef]
- Cooper, A.M.; Silver, K.; Zhang, J.; Park, Y.; Zhu, K.Y. Molecular mechanisms influencing efficiency of RNA interference in insects. Pest Manag. Sci. 2018, 75, 18–28. [Google Scholar] [CrossRef]
- Paim, R.M.; Araujo, R.N.; Lehane, M.J.; Gontijo, N.F.; Pereira, M.H. Long-term effects and parental RNAi in the blood feeder Rhodnius prolixus (Hemiptera; Reduviidae). Insect Biochem. Mol. Biol. 2013, 43, 1015–1020. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence | Primer Usage |
---|---|---|
HK-F | TCGCAGAAGAGGTATTGACTCA | RT-PCR |
HK-R | GATATGACTCGACGTTGGTGTT | |
HK-iF | AGGTCCTGCATATGACAGACAAAC | dsRNA Synthesis |
HK-iR | CACAATGTGTATGAGGAACGTCT | |
HK-dsF | taatacgactcactatagggAGGTCCTGCATATGACAGACAAAC | |
HK-dsR | taatacgactcactatagggAGACGTTCCTCATACACATTGTG | |
GFP-iF | GCCAACACTTGTCACTACTT | |
GFP-iR | GGAGTATTTTGTTGATAATGGTCTG | |
GFP-dsF | taatacgactcactatagggGCCAACACTTGTCACTACTT | |
GFP-dsR | taatacgactcactatagggGGAGTATTTTGTTGATAATGGTCTG | |
HK-qF | ACTCACACGCTACATCTATCG | RT-qPCR |
HK-qR | GACGCCAGTACCAGTCATAA | |
Actin-F | ATGGTCGGCATGGGACAG | |
Actin-R | GAGTTCATTGTAGAAGGTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shakeel, M.; Du, J.; Li, S.-W.; Zhou, Y.-J.; Sarwar, N.; Bukhari, S.A.H. Characterization, Knockdown and Parental Effect of Hexokinase Gene of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) Revealed by RNA Interference. Genes 2020, 11, 1258. https://doi.org/10.3390/genes11111258
Shakeel M, Du J, Li S-W, Zhou Y-J, Sarwar N, Bukhari SAH. Characterization, Knockdown and Parental Effect of Hexokinase Gene of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) Revealed by RNA Interference. Genes. 2020; 11(11):1258. https://doi.org/10.3390/genes11111258
Chicago/Turabian StyleShakeel, Muhammad, Juan Du, Shang-Wei Li, Yuan-Jin Zhou, Naeem Sarwar, and Syed Asad Hussain Bukhari. 2020. "Characterization, Knockdown and Parental Effect of Hexokinase Gene of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) Revealed by RNA Interference" Genes 11, no. 11: 1258. https://doi.org/10.3390/genes11111258
APA StyleShakeel, M., Du, J., Li, S.-W., Zhou, Y.-J., Sarwar, N., & Bukhari, S. A. H. (2020). Characterization, Knockdown and Parental Effect of Hexokinase Gene of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) Revealed by RNA Interference. Genes, 11(11), 1258. https://doi.org/10.3390/genes11111258