Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton

Round 1

Reviewer 1 Report

The manuscript titled, “Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton” is an interesting study of the multi-functional cotton EXO70 gene family, spanning comprehensive bioinformatics and molecular analyses. They identified 165 family members in the EXO70 gene family of cotton, analyzed their expression pattern and found that over 4000 genes were altered by the silencing of GhEXO70A1-A gene, which expresses a plasma membrane-localized protein. Through Yeast-two-hybrid assay, they found that GhEXO70A1-1 interacts with GhEXO84A, GhEXO84B, and GhEXO84C.

The title may be modified as “Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton”.

Some minor points to revise in the manuscript are;

The results must be discussed appropriately in the Discussion section. The Discussion section should be improved.

Please italicize gene names (symbols) throughout the manuscript.

Please cite more recent literature in Introduction and Discussion sections.

A few errors in the language are;

Section 1: Please put a comma after “cells” in the second sentence of Introduction’s first paragraph.

Section 2.4: Please rewrite the last sentence. “T vector was connected to it” seems a bit awkward.

Section 3.1: Please shift the third and fourth sentences to “Discussion” section.

Figure 3 Caption: Rewrite (C).

Figure 4: Remove the word “Tissue” from “Tissue::Root”, “Tissue::Stem…”.

Section 4.1: Paragraph 2 Rewrite second sentence.

Author Response

Dear Reviewers:

Thank you for your comments on our manuscript entitled " Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton" (genes-1393683). Those comments were very helpful for improving our manuscript. We believed we have answered all reviewers’ comments. The main corrections in the paper and the responds to the editors’ and reviewers’ comments are as follows:

 

Comments to the Author

The manuscript titled, “Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton” is an interesting study of the multi-functional cotton EXO70 gene family, spanning comprehensive bioinformatics and molecular analyses. They identified 165 family members in the EXO70 gene family of cotton, analyzed their expression pattern and found that over 4000 genes were altered by the silencing of GhEXO70A1-A gene, which expresses a plasma membrane-localized protein. Through Yeast-two-hybrid assay, they found that GhEXO70A1-1 interacts with GhEXO84A, GhEXO84B, and GhEXO84C.

 

Point 1: The title may be modified as “Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton”.


 

Response 1: Thank you for your suggestion. We have corrected it in the manuscript (L2-L3).

 

Point 2: The results must be discussed appropriately in the Discussion section. The Discussion section should be improved.

 

Response 2: Thank you for your comment. We have improved the Discussion section. We have added “The latest research shows that AtEXO70A1 recruits the entire complex to the cytoplasmic membrane by binding to negatively charged phospholipids, providing an important research basis for the study of plant cell polarity and morphogenesis [50].” in Discussion sections (L422-L424).

 

Point 3: Please italicize gene names (symbols) throughout the manuscript.

Response 3: We are sorry for this mistake and we have corrected them in the current manuscript.

 

Point 4: Please cite more recent literature in Introduction and Discussion sections.

Response 4: Thank you for your comment. We have improved the Introduction and Discussion sections. We have added “AtEXO70B1 and AtEXO70B2 regulate FLS2 to participate in plant immune response [25]. AtEXO70D regulates cytokinin sensitivity by mediating the selective autophagy of Type-A ARR protein, thereby maintaining cell homeostasis and normal plant growth and development [26].” in Introduction sections (L64-L67). We have added “The latest research shows that AtEXO70A1 recruits the entire complex to the cytoplasmic membrane by binding to negatively charged phospholipids, providing an important research basis for the study of plant cell polarity and morphogenesis [50].” in Discussion sections (L422-L424).

 

Point 5: Section 1: Please put a comma after “cells” in the second sentence of Introduction’s first paragraph.

 

Response 5: Thank you for your comments. We have corrected it in the current manuscript (L32).

 

Point 6: Section 2.4: Please rewrite the last sentence. “T vector was connected to it” seems a bit awkward.

 

Response 6: Thank you for your comments. We have replaced “T vector was connected to it” with “It was cloned into the B-zero vector” in the manuscript (L147-L148).

 

Point 7: Section 3.1: Please shift the third and fourth sentences to “Discussion” section.

 

Response 7: Thank you for your comments. We have shifted the third and fourth sentences (Section 3.1) to “Discussion” section in the current manuscript (L419-L421).

 

Point 8: Figure 3 Caption: Rewrite (C).

 

Response 8: Thank you for your comments. We have replaced “gene structure of exons and introns in GhEXO70 genes.” with “Gene structure of the GhEXO70 family” in the manuscript (L595).

 

Point 9: Figure 4: Remove the word “Tissue” from “Tissue::Root”, “Tissue::Stem…”.

 

Response 9: Thank you for your comments. We have corrected it in the figure 4.

 

Point 10: Section 4.1: Paragraph 2 Rewrite second sentence.

 

Response 10: Thank you for your comments. We have corrected it in the current manuscript. We have replaced “Genes within the same subgroup structures had similar structures.” with “Genes within the same subgroup had similar structures.” in the manuscript (L407-L408).

Author Response File: Author Response.docx

Reviewer 2 Report

The manuscript describes cotton Exo70s identified in database and their features including phylogenetic relationships and genome structures. In addition, authors focused on GhEXO70A1-A, and demonstrated its localization on ER and plasma membrane, interactions with other exocyst members and the effects of knockdown on transcriptome. These data suggest the involvement of GhEXO70A1-A in vesicle trafficking as shown in other plant species. Genomic and functional characterization of cotton Exo70s will be fundamental and important information to understand diverse functions of plant Exo70s. 

 

• Authors focused on not only the number of cotton Exo70 genes and their phylogenetic relationships but also their gene structures (for example exon-intron organization and the presence of transmembrane domain). To clarify whether the gene structures are conserved among several plant species or unique in cotton Exo70s, authors should describe them in comparison with Exo70s of other model plants including arabidopsis and rice.
• If authors can find relationships between cotton Exo70 subgroups and promoter organization, discuss it in Figure 5.　The information may support to predict the Exo70 functions at subgroup level, Moreover, if the motifs unique in cotton Exo70 promoter can be found in comparison with arabidopsis and rice Exo70 promoters, please describe it, which may lead to identification of novel functions of cotton Exo70s.
• In Figure 6, the data of GhEXO70A1-A localization is not clear. If authors want to conclude that GhEXO70A1-A localized at ER and plasma membranes, subcellular localization of GhEXO70A1-A must be demonstrated as co-localization with marker proteins for ER and plasma membranes. In tabacco, several useful marker proteins are available.
• In Figure 7, protein expression of GhEXO70A1-A and other exocyst members in yeast cells should be checked. In addition, if there is the data of combinations of AD-GhEXO70A1-A and BD-other exocyst members, please show them.
• In Figure 8, the effects of GhEXO70A1-A knockdown on transcriptome were analyzed by NGS analysis. GhEXO70A1-A knockdown was performed by VIGS. Because VIGS can affect expression levels of other Exo70 members as off-target, authors should confirm expression levels of other members of Exo70 family in the NGS data.
• In a sentence of Discussion “for vesicle transport, cell secretion, growth, and division, ”, delete “and”.

 

• If authors can find relationships between cotton Exo70 subgroups and promoter organization, discuss it in Figure 5.　The information may support to predict the Exo70 functions at subgroup level, Moreover, if the motifs unique in cotton Exo70 promoter can be found in comparison with arabidopsis and rice Exo70 promoters, please describe it, which may lead to identification of novel functions of cotton Exo70s.
• In Figure 6, the data of GhEXO70A1-A localization is not clear. If authors want to conclude that GhEXO70A1-A localized on ER and plasma membranes, subcellular localization of GhEXO70A1-A should be demonstrated as co-localization of marker proteins for ER and plasma membranes. In tabacco, several useful marker proteins are available.
• In Figure 7, protein expression of GhEXO70A1-A and other exocyst members in yeast cells must be checked. In addition, if there is the data of combinations of AD-GhEXO70A1-A and BD-other exocyst members, please show them.
• In Figure 8, the effects of GhEXO70A1-A knockdown on transcriptome were analyzed by NGS analysis. GhEXO70A1-A knockdown was performed by VIGS. Because VIGS can affect expression levels of other Exo70 members as off-target, authors should confirm expression levels of other members of Exo70 family in the NGS data.
• In a sentence of Discussion “for vesicle transport, cell secretion, growth, and division, ”, delete “and”.

 

Author Response

Dear Reviewer:

Thank you for your comments on our manuscript entitled " Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton" (genes-1393683). Those comments were very helpful for improving our manuscript. We believed we have answered all reviewers’ comments. The main corrections in the paper and the responds to the editors’ and reviewers’ comments are as follows:

 

Comments to the Author

The manuscript describes cotton Exo70s identified in database and their features including phylogenetic relationships and genome structures. In addition, authors focused on GhEXO70A1-A, and demonstrated its localization on ER and plasma membrane, interactions with other exocyst members and the effects of knockdown on transcriptome. These data suggest the involvement of GhEXO70A1-A in vesicle trafficking as shown in other plant species. Genomic and functional characterization of cotton Exo70s will be fundamental and important information to understand diverse functions of plant Exo70s.

 

Point 1: Authors focused on not only the number of cotton Exo70 genes and their phylogenetic relationships but also their gene structures (for example exon-intron organization and the presence of transmembrane domain). To clarify whether the gene structures are conserved among several plant species or unique in cotton Exo70s, authors should describe them in comparison with Exo70s of other model plants including Arabidopsis and rice.

 

Response 1: Thank you for your comment. Through the exon analysis of the EXO70 gene of Arabidopsis and rice, the results showed that only the EXO70 of group A contained more exons in Arabidopsis and rice. The number of EXO70 in Arabidopsis A group ≥9, and the number of EXO70 in rice A group ≥12 (Table S2 and Table S3). This phenomenon is not unique to cotton Exo70s, but conserved in plants.

We have added “Further analysis of the exons of the EXO70 gene in Arabidopsis and rice showed that only Group A EXO70 contained more exons in Arabidopsis and rice. The number of EXO70 in Arabidopsis A group ≥9, and the number of EXO70 in rice A group ≥12,Therefore, this phenomenon is not unique to cotton EXO70s, but is conserved in plants (Table S2 and Table S3).” in the manuscript (L223-L227).

We have added “Table S2. Predicted EXO70 genes from Arabidopsis thaliana and the corresponding proteins. Table S3. Predicted EXO70 proteins and the corresponding gene from Oryza sativa.” in the manuscript (L458-L459).

Table S2. Predicted EXO70 genes from Arabidopsis thaliana and the corresponding proteins.

Gene Name	Gene ID	Gene Models	Exon Number	Protein Length (aa)
AtEXO70A1-1	AT5G03540	AT5G03540.1	12	638
AtEXO70A1-2	AT5G03540	AT5G03540.2	11	523
AtEXO70A1-3	AT5G03540	AT5G03540.3	13	664
AtEXO70A2	AT5G52340	AT5G52340.1	11	631
AtEXO70A3	AT5G52350	AT5G52350.1	9	586
AtEXO70B1	AT5G58430	AT5G58430.1	1	624
AtEXO70B2	AT1G07000	AT1G07000.1	2	599
AtEXO70C1	AT5G13150	AT5G13150.1	1	653
AtEXO70C2	AT5G13990	AT5G13990.1	1	695
AtEXO70D1	AT1G72470	AT1G72470.1	1	633
AtEXO70D2	AT1G54090	AT1G54090.1	1	622
AtEXO70D3	AT3G14090	AT3G14090.1	1	623
AtEXO70E1	AT3G29400	AT3G29400.1	1	658
AtEXO70E2-1	AT5G61010	AT5G61010.1	1	639
AtEXO70E2-2	AT5G61010	AT5G61010.2	1	639
AtEXO70F1	AT5G50380	AT5G50380.1	1	683
AtEXO70G1	AT4G31540	AT4G31540.1	1	687
AtEXO70G2	AT1G51640	AT1G51640.1	1	660
AtEXO70H1	AT3G55150	AT3G55150.1	1	636
AtEXO70H2	AT2G39380	AT2G39380.1	1	637
AtEXO70H3	AT3G09530	AT3G09530.1	1	637
AtEXO70H4	AT3G09520	AT3G09520.1	1	628
AtEXO70H5	AT2G28640	AT2G28640.1	2	605
AtEXO70H6	AT1G07725	AT1G07725.1	2	615
AtEXO70H7-1	AT5G59730	AT5G59730.1	1	634
AtEXO70H7-2	AT5G59730	AT5G59730.2	1	632
AtEXO70H8	AT2G28650	AT2G28650.1	1	573

 

 

 

Table S3. Predicted EXO70 proteins and the corresponding gene from Oryza sativa.

Gene name	Gene Locus	Exon Number	Protein Length (aa)
OsEXO70A1	Os04g0685600	12	634
OsEXO70A2	Os11g0157400	12	643
OsEXO70A3	Os12g0159700	18	976
OsEXO70A4	Os04g0685500	12	661
OsEXO70B1	Os01g0827500	1	652
OsEXO70B2	Os05g0473500	1	661
OsEXO70B3	Os01g0827600	4	553
OsEXO70C1	Os12g0165600	1	700
OsEXO70C2	Os11g0167600	1	692
OsEXO70D1	Os08g0455700	1	632
OsEXO70D2	Os09g0439600	1	638
OsEXO70E1	Os01g0763700	1	602
OsEXO70F1	Os02g0505400	1	689
OsEXO70F2	Os04g0382200	1	688
OsEXO70F3	Os01g0921400	3	556
OsEXO70F4	Os08g0530300	1	606
OsEXO70F5	Os10g33850	3	461
OsEXO70G1	Os02g0149700	1	494
OsEXO70G2	Os06g0698600	1	673
OsEXO70G3	Os08g0519900	2	687
OsEXO70H1a	Os11g0650100	1	579
OsEXO70H1b	Os11g0649900	1	579
OsEXO70H2	Os03g0448200	1	556
OsEXO70H3	Os12g0100700	3	590
OsEXO70H4	Os11g0100800	3	590
OsEXO70I1	Os01g0905300	1	381
OsEXO70I2	Os01g0905200	2	557
OsEXO70I3	Os04g0111500	3	398
OsEXO70I4	Os07g0210300	5	691
OsEXO70I5	Os07g0210900	5	588
OsEXO70I6	Os07g0210000	4	646
OsEXO70J1	Os08g0232700	1	526
OsEXO70J2	Os09g0347300	1	598
OsEXO70J3	Os05g0369500	1	528
OsEXO70J5	Os05g0369300	1	520
OsEXO70J6	Os01g0383100	3	681
OsEXO70J7	Os02g0575900	3	700
OsEXO70J8	Os06g0183600	1	486
OsEXO70K1	Os06g0255900	1	412
OsEXO70K2	Os07g0211000	3	426
OsEXO70L1	Os11g0572200	2	433

 

We have added “Prediction of the transmembrane domain of Arabidopsis EXO70, the results showed that AtEXO70C1, AtEXO70C2, AtEXO70H5, AtEXO70H8, AtEXO70A3 have transmembrane domains, but they are not obvious, and the other EXO70s have no transmembrane domains (Figure S2). The prediction results of rice EXO70 show that OsEXO70A3, OsEXO70A4, OsEXO70H1a, OsEXO70H1b, OsEXO70H2, OsEXO70H3, OsEXO70H4, OsEXO70I3, OsEXO70I4, OsEXO70L1, OsEXO6K1, OsEXO70L, OsEXO70J1, OsEXO70J1, OsEXO70J2, OsEXO70J6, OsEXO70J8, OsEXO70K1, OsEXO7K2, OsEXO70L1 have a transmembrane domain. And OsEXO70A4 has a more obvious transmembrane domain at the C-terminus, and none of the other rice EXO70s has a transmembrane domain (Figure S3). Among the prediction results of the transmembrane domain of cotton EXO70, only GhEXO70E2-D has a transmembrane domain, and the others have no transmembrane domain. Both Arabidopsis and cotton contain fewer EXO70s with transmembrane domains. As rice is a monocot, it may be evolving to have more EXO70, and there are more EXO70s with transmembrane domains.” in the manuscript (L287-L300).

We have added “Figure S2. Analysis of transmembrane domains of EXO70 gene family in Arabidopsis. Figure S3. Analysis of transmembrane domains of EXO70 gene family in rice.” in the manuscript(L460-L462).

 

Figure S2. Analysis of transmembrane domains of EXO70 gene family in Arabidopsis.

 

Figure S3. Analysis of transmembrane domains of EXO70 gene family in rice.

 

Point 2: If authors can find relationships between cotton Exo70 subgroups and promoter organization, discuss it in Figure 5. The information may support to predict the Exo70 functions at subgroup level, Moreover, if the motifs unique in cotton Exo70 promoter can be found in comparison with arabidopsis and rice Exo70 promoters, please describe it, which may lead to identification of novel functions of cotton Exo70s.

 

Response 2: Thank you for your comment. Through the analysis of the promoters of the EXO70 gene in Arabidopsis and rice, the results show that the promoters of the EXO70 gene in Arabidopsis and rice also contain cis-acting elements that respond to environmental stress and plant hormones (Figure S5 and Figure S6). This phenomenon is not unique to cotton Exo70s, but conserved in plants.

We have added “To further verify whether the above cis-acting elements are unique to cotton EXO70s, we also analyzed the EXO70s gene promoters in Arabidopsis and rice. The results indicate that the promoters of EXO70 genes in Arabidopsis and rice also contain cis-acting elements that respond to environmental stress and plant hormones (Figure S5 and Figure S6). It shows that this phenomenon is not unique to cotton EXO70, but is conserved in plants.” in the manuscript (L339-L344).

We have added “Figure S5. Cis-acting elements in Arabidopsis EXO70s promoter. Figure S6. Cis-acting elements in rice EXO70s promoter.” in the manuscript (L463-L464).

 

Figure S5. Cis-acting elements in Arabidopsis EXO70s promoter.

 

 

Figure S6. Cis-acting elements in rice EXO70s promoter.

 

Point 3: In Figure 6, the data of GhEXO70A1-A localization is not clear. If authors want to conclude that GhEXO70A1-A localized at ER and plasma membranes, subcellular localization of GhEXO70A1-A must be demonstrated as co-localization with marker proteins for ER and plasma membranes. In tabacco, several useful marker proteins are available.

Response 3: Thank you for your comment and suggestion. Our subcellular localization results can clearly observe that 2300-GhEXO70A1-A-GFP is located on the plasma membrane, but due to the lack of plasma membrane and endoplasmic reticulum markers in the laboratory, the article’s localization on the endoplasmic reticulum membrane was changed to the plasma membrane. And it is not necessary to add a marker in most articles, for example "Identification and Characterization of the EXO70 Gene Family in Polyploid Wheat and Related Species. International journal of molecular sciences, 2018.”

 

Point 4: In Figure 7, protein expression of GhEXO70A1-A and other exocyst members in yeast cells should be checked. In addition, if there is the data of combinations of AD-GhEXO70A1-A and BD-other exocyst members, please show them.

 

Response 4: Thank you for your suggestion, I think it's very good. We designed primers for the CDS partial fragments of GhEXO70A1-A and other subunits of the secretory complex. Then the co-transformed yeasts were selected, shaken and identified by PCR to determine whether the subunits of GhEXO70A1-A and other cytokine complexes were expressed in yeast. The test results are shown in Figure A below. GhEXO70A1-A and other subunits of the secretory complex are all expressed in yeast.

We performed yeast double hybridization on AD-GhEXO70A1-A and BD-other exocyst members. As shown in Figure B below, because AD-GhEXO70A1-A has self-activation with BD, it has spots on the four-deficiency plate with BD-other exocyst members, so this result cannot be used as evidence of the interaction between subunits.

 

Figure  Expression and identification of EXO70 and secretory complex subunits and interaction analysis of AD-GhEXO70A1-A and BD-other exocyst members

 

Table Primers used in this study.

Primer name	Sequence（5’-3’）
GhEXO84A-F1	ATGTCTATCGGAGATGTTTCTGAG
GhEXO84A-R1	AAAGAAGATGTTGTAGCACCACC
GhEXO84B-F1	ATGGCTACTGCTAAGGCTAAGACT
GhEXO84B-R1	GTAGAAGATGGATGCAAAGAAAGC
GhEXO84C-F1	ATGATGGAATCTTCTGAAGAGGAT
GhEXO84C-R1	AATCCAGATTCTCTAGTAGTTAAAGAAATC
GhSEC5-F1	ATGTCTACTGATAGTGATGATGAAGATG
GhSEC5-R1	CAATCAAAGTTATCCTTGACCAAT
GhSEC6-F1	ATGATGGTTGAAGATCTCGGAG
GhSEC6-R1	TGAACCTTGAACTTTTGTTGAGC
GhSEC8-F1	ATGGGAATCTTTGATGGATTCC
GhSEC8-R1	TATGATCCATCAACGATTCCTTG
GhSEC10-F1	ATGCCTGAAAGATCTAAATCTTCC
GhSEC10-R1	TGTGAAGCAGCATCGAATCTAG
GhSEC15A-F1	ATGGATAGTAAGCCTAAGAAGAGAGGT
GhSEC15A-R1	CAGAATCCTCATCCACTTCCTC
GhSEC15B-F1	ATGAAGTCTACTAGACCTAGAAGAAAGATG
GhSEC15B-R1	TCCTCATCATCTTCCAATGCG
GhEXO70A1-F1	ATGGGAATAGCAGTTGCAGG
GhEXO70A1-R1	TTCTGGACATCATCTTTGCCA

 

 

Point 5: In Figure 8, the effects of GhEXO70A1-A knockdown on transcriptome were analyzed by NGS analysis. GhEXO70A1-A knockdown was performed by VIGS. Because VIGS can affect expression levels of other Exo70 members as off-target, authors should confirm expression levels of other members of Exo70 family in the NGS data.

 

Response 5: Thank you for your comments. We sorted out the expression of other EXO70 genes in the NGS data, and the results are shown in the figure below, GhEXO70B-D, GhEXO70B-A, GhEXO70E6-D, GhEXO70F1-D, GhEXO70E3-D, GhEXO70H6-D, GhEXO70E1-D, GhEXO70H6-A, GhEXO70H3-D, GhEXO70D1-D, GhEXO70E3-A, GhEXO70C1-A, GhEXO70E5-A, GhEXO70C5-A have significant changes, and there are no significant changes in other EXO70 genes. However, except for GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A, which decreased to 32.1%, 46.9%, and 56.6% of the control, all other genes fell to more than 60% of the control, and the fold increase was also less than 1. Although the three genes GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A declined slightly, their expression abundance was also very low. The above results show that the knockdown of GhEXO70A1-A by VIGS does affect the expression of other EXO70 genes, but the effect is not significant after analysis. The changes in differential genes should be mainly caused by the changes in GhEXO70A1-A.

 

 

Point 6: In a sentence of Discussion “for vesicle transport, cell secretion, growth, and division, ”, delete “and”.

 

Response 6: Thank you for your suggestion. We are sorry for this mistake and we have deleted the “and”(L418) in the manuscript as suggested.

 

 

Author Response File: Author Response.pdf

Round 2

Reviewer 2 Report

In this revised manuscript, authors added some descriptions about genome structures of cotton EXO70s including exon-intron organization, presence of transmembrane domain and cis-element of promoter sequences in comparison with those of arabidopsis and rice. On the other hand, authors should briefly describe the effects of EXO70A1 knockdown on other EXO70 members and add the data in supplementary Figure, even if the effect is minor. Although co-localization of GhEXO70A1 with plasma membrane marker was not shown, this manuscript seems to be enough to explain cotton Exo70 family. Therefore, I recommend the publication of this manuscript.

Author Response

Dear Reviewer:

Thank you for your comments on our manuscript entitled "Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton" (genes-1393683). Those comments were very helpful for improving our manuscript. We believed we have answered all reviewers’ comments. The main corrections in the paper and the responds to the editors’ and reviewers’ comments are as follows:

 

Comments to the Author

In this revised manuscript, authors added some descriptions about genome structures of cotton EXO70s including exon-intron organization, presence of transmembrane domain and cis-element of promoter sequences in comparison with those of arabidopsis and rice. On the other hand, authors should briefly describe the effects of EXO70A1 knockdown on other EXO70 members and add the data in supplementary Figure, even if the effect is minor. Although co-localization of GhEXO70A1 with plasma membrane marker was not shown, this manuscript seems to be enough to explain cotton Exo70 family. Therefore, I recommend the publication of this manuscript.

 

Response: Thank you for your comments and suggestion. We have added “We sorted out the expression of other EXO70 genes in the NGS data, and the results are shown in the figure S7, GhEXO70B-D, GhEXO70B-A, GhEXO70E6-D, GhEXO70F1-D, GhEXO70E3-D, GhEXO70H6-D, GhEXO70E1-D, GhEXO70H6-A, GhEXO70H3-D, GhEXO70D1-D, GhEXO70E3-A, GhEXO70C1-A, GhEXO70E5-A, GhEXO70C5-A have significant changes, and there are no significant changes in other EXO70 genes. However, except for GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A, which decreased to 32.1%, 46.9%, and 56.6% of the control, all other genes fell to more than 60% of the control, and the fold increase was also less than 1. Although the three genes GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A declined slightly, their expression abundance was also very low. The above results show that the knockdown of GhEXO70A1-A by VIGS does affect the expression of other EXO70 genes, but the effect is not significant after analysis. The changes in differential genes should be mainly caused by the changes in GhEXO70A1-A.” in the manuscript (L375-L387).

We have added “Figure S7. Expression analysis of other changed EXO70 genes in NGS data.” in the manuscript (L476-L477).

Author Response File: Author Response.docx