Next Article in Journal
Prediction of Eye Colour in Scandinavians Using the EyeColour 11 (EC11) SNP Set
Next Article in Special Issue
Transcriptome-Wide Association Study of Blood Cell Traits in African Ancestry and Hispanic/Latino Populations
Previous Article in Journal
The Crossroads between RAS and RHO Signaling Pathways in Cellular Transformation, Motility and Contraction
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 12
Issue 6
10.3390/genes12060820
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population

by
Nika V. Petrova
1,
Andrey V. Marakhonov
1,*,
Natalia V. Balinova
1,
Anna V. Abrukova
2,
Fedor A. Konovalov
3,
Sergey I. Kutsev
1 and
Rena A. Zinchenko
1,4
1
Research Centre for Medical Genetics, 115522 Moscow, Russia
2
Presidential Perinatal Center of the Public Health Ministry of Chuvashia, Genetic Counseling Department, 428018 Cheboksary, Russia
3
Independent Clinical Bioinformatics Laboratory, 123181 Moscow, Russia
4
N.A. Semashko National Research Institute of Public Health, 105064 Moscow, Russia
*
Author to whom correspondence should be addressed.
Genes 2021, 12(6), 820; https://doi.org/10.3390/genes12060820
Submission received: 1 May 2021 / Revised: 23 May 2021 / Accepted: 25 May 2021 / Published: 27 May 2021
(This article belongs to the Special Issue Genomics of Disease Risk in Diverse Populations)
Browse Figures
Review Reports Versions Notes

Abstract

:
Hereditary nonsyndromic sensorineural hearing loss is a disease in which hearing loss occurs due to damage to the organ of the inner ear, the auditory nerve, or the center in the brain that is responsible for the perception of sound, characterized by wide locus and allelic heterogeneity and different types of inheritance. Given the diversity of population of the Russian Federation, it seems necessary to study the ethnic characteristics of the molecular causes of the disease. The aim is to study the molecular and genetic causes of hereditary sensorineural hearing loss in Chuvash, the fifth largest ethnic group in Russia. DNA samples of 26 patients from 21 unrelated Chuvash families from the Republic of Chuvashia, in whom the diagnosis of hereditary sensorineural hearing loss had been established, were analyzed using a combination of targeted Sanger sequencing, multiplex ligase-dependent probe amplification, and whole exome sequencing. The homozygous variant NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) is the major molecular cause of hereditary sensorineural hearing loss in 23% of Chuvash patients (OMIM #601869). Its frequency was 25% in patients and 1.1% in healthy Chuvash population. Genotyping of the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant in five neighboring populations from the Volga-Ural region (Russian, Udmurt, Mary, Tatar, Bushkir) found no evidence that this variant is common in those populations.

1. Introduction

Congenital hearing loss is one of the most frequent human diseases, occurring in 1–2 out of 1000 newborns, among which hereditary forms account for more than 50% [1,2,3]. According to the World Health Organization, about 360 million people, which is about 5% of the world’s population, have hearing loss leading to disability, and 32 million of them are children [4]. Sensorineural hearing loss (91.4% of patients) prevails in children’s prelingual isolated hearing loss; mixed hearing loss is found in 7.1% of patients and conductive hearing loss is found in only 1.5% of cases [5].
Most of the hereditary hearing loss forms (about 70%) are nonsyndromic, characterized by wide locus and allelic heterogeneity. To date, more than 6000 pathogenic variants associated with nonsyndromic hearing loss (NSHL) have been identified in more than 120 genes.
The structure of hereditary nonsyndromic hearing loss is dominated by autosomal recessive (AR) forms (70–80%). The share of autosomal dominant (AD) accounts for up to 10–20%; X-linked (1–2%) and mitochondrial (about 1%) forms of hearing loss are relatively rare [5,6,7].
Pathogenic variants in the same genes may be the cause of both AD and AR hearing loss, and digenic inheritance of the disease has been described [7]. In general, 20–30% of hereditary hearing disorders are detected as part of various hereditary syndromes, i.e., hearing loss is accompanied by damage to other organs and systems which are not always simultaneously manifested in the patient’s clinical picture [8,9,10]. More than 400 hereditary syndromes with hearing loss have been described.
Early detection of hearing impairment and subsequent clinical and accurate DNA diagnostics of the genetic form of patient’s hearing loss allows medical practitioners to determine the cause of the disease at an early age, and the timely adoption of measures for the rehabilitation of children with hearing impairment determines the success of their social adaptation.
Hereditary nonsyndromic hearing loss (NSHL) is a disease in which hearing loss occurs due to damage to the organs of the inner ear, the auditory nerve, or the center in the brain that is responsible for the perception of sound. Mapping of the genes responsible for hearing loss was undoubtedly a breakthrough in understanding molecular mechanisms of hearing loss. Mutations in the GJB2 gene have shown to be the most common cause of NSHL [11]. On average, about 50% of AR NSHL cases in European populations are associated with GJB2 mutations [12]. The highest contribution of GJB2 pathogenic variants was shown in European countries (27.1%), while the lowest contribution was in sub-Saharan Africa (5.6%) [13]. In most European countries, the most common pathogenic GJB2 variant in AR NSHL patients was c.35delG [13,14]. In the Russian population the c.35delG variant also prevails in NSHL (81% of GJB2 mutant alleles) [2]. The variants in genes STRC, USH2A, SLC26A4, MYO7A, OTOF, MYO15A, and TECTA found both in Europe and worldwide were less frequent. Mutations in other genes were observed, as a rule, in individual cases [10].
Given that the population of the Russian Federation is represented by many ethnic groups, it is necessary to study different population-specific molecular causes. This is currently being carried out by the staff of the Laboratory of Genetic Epidemiology for other common hereditary diseases [15,16,17,18].
Our previous studies have shown that both allelic and locus heterogeneity of NSHL was observed in populations and ethnic groups of the Russian Federation [19,20,21,22,23,24,25,26]. For example, in Karachay population the frequency of c.35delG mutation was 0.14%, in Bashkirs and Udmurts—0.25%, in Chuvash—0.48%, with the same birth prevalence of the disease as in Russians, 1:2000–2500. Sequencing of the GJB2 gene allowed further identification of only 1–2 mutations with extremely low frequencies.
The study of molecular and genetic causes of NSHL in Chuvash, the fifth largest ethnic group in the Russian Federation, living mainly in the Republic of Chuvashia, inhabiting the east of the East European Plain, was performed.

2. Materials and Methods

2.1. Ethical Statement

Written informed consent was obtained from participants of the 21 Chuvash families (consent from parents was obtained in the case of minors under the age of 18). The study was approved by the local Ethics Committee of the Research Centre for Medical Genetics (RCMG), Moscow, Russian Federation (Protocol No.17/2006 dated 2 February 2006 and Protocol No.5/2010 dated 20 December 2010).

2.2. Characteristics of Patients

In total, 26 patients with NSHL from 21 unrelated families were examined. All patients and their parents are Chuvash from the Republic of Chuvashia. Ethnicity up to the third generation was established in the survey. All patients were examined by a surdologist and had bilateral (except for family #17) prelingual sensorineural hearing loss of severe to profound or complete deafness. In the patients’ medical history, there were no possible external environmental risk factors for the development of hearing loss. The diagnosis was made on the basis of the clinical presentation in the surdological center of Cheboksary city. The patients were also examined by a geneticist at the RCMG in order to exclude syndromic forms of hearing loss.
The average age of patients at the time of the examination was 18.57±2.10 years (SD 10.72; range 1.00–42.00). In all the examined patients, venous blood was collected for molecular genetic research. The clinical information on probands is summarized in Table 1.

2.3. Characteristics of Healthy Individuals

DNA samples of healthy unrelated individuals from six neighboring populations of the Volga-Ural region (Russians from Kirov region, Mari, Udmurts, Chuvash, Tatars, Bashkirs) from the biobank of the Laboratory of Genetic Epidemiology, collected during genetic and epidemiological expeditions in 2000–2015, were used.

2.4. Molecular Genetic Methods

2.4.1. Sequencing of GJB2, GJB3, and GJB6 Genes

Sanger sequencing of noncoding and coding exons of GJB2 gene and coding exons of GJB3 and GJB6 genes was performed in 26 patients as described previously [2]. The sequences of the primers used are shown in Table 2. Sequence chromatogram analysis was performed using the ChromasPro Version 1.42 software (Technolysium Pty Ltd., Queensland, Australia).

2.4.2. Multiplex Ligase-Dependent Probe Amplification (MLPA) Analysis

The search for copy number variations (CNV) affecting loci of GJB3 (1p34.3), WFS1 (4p16.1), GJB2 (13q12.11), GJB6 (13q12.11), POU3F4 (Xq21.1) genes was performed in 26 patients by multiplex ligase-dependent amplification of samples (MLPA) using the SALSA MLPA Probemix P163-D1 (MRC Holland, Amsterdam, The Netherlands) reagent kit, in accordance with the manufacturer’s protocol. The interpretation of MLPA results was carried out using the Coffalyzer v.140721.1958 software (MRC Holland, Amsterdam, The Netherlands).

2.4.3. Whole Exome Sequencing

Whole exome sequencing (WES) was performed on Illumina HiSeq 2000 instrument (Illumina, San Diego, CA, USA) in 2 × 100 bp paired-end mode in the Genotek Ltd. (Moscow, Russia). A bioinformatics pipeline of WES data analysis was performed as described previously [27]. Further filtering was performed by functional consequences, population frequencies as well as clinical relevance. All variants were named according to the NM_133261.3(GIPC3_v001) reference transcript variant. NGS findings of definite/probable diagnostic value were verified by Sanger sequencing in patient, sibling, and parents (family #07).

2.4.4. Sequencing of GIPC3 Gene Coding Region

Sanger sequencing of 6 exons and exon–intron junction regions of the GIPC3 gene in 22 patients was performed using the primers presented in Table 2.

2.4.5. Analysis for the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) Variant in GIPC3 Gene

The population screening for the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant in GIPC3 gene was carried out by polymerase chain reaction followed by restriction fragment length polymorphism analysis (PCR-RFLP). For PCR, primers, direct GIPC3-Fmut and reverse GIPC3-Rmut (Table 2) were used. The length of the amplification product was 532 bp. After restriction by endonuclease BstDEI (Sibenzyme, Moscow, Russia), in the case of the normal allele, fragments—298 bp and 234 bp—were formed; in the case of the variant NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser)—192 bp, 104 bp, and 234 bp.
The frequency of identified allele was calculated according to the formula: pi = ni/n, where ni is the number of i-th allele, n is the sample size (the number of tested chromosomes) [28]. The Exact test was used for calculating 95% confidence intervals (95% CI) [29].

3. Results

At first, sequencing of coding regions of GJB2, GJB6, and GJB3 genes and analysis of copy number variations affecting loci of GJB3, WFS1, GJB2, GJB6, POU3F4 genes were carried out in 26 patients with NSHL. No pathogenic changes were detected in any patient.
Then, DNA of patient III-1 from family #07, in which both parents and sibling were affected by NSHL (congenital deafness of 4th degree of severity) (Figure 1) was analyzed by whole exome sequencing (WES). All grandparents had no hearing impairment, but deafness was observed in both parents and their siblings.
A homozygous single nucleotide variant NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) in GIPC3 gene leading to a missense substitution (p.Asn82Ser) was identified. This substitution affects the conservative position within the N-terminal GIPC homologous domain 1 (GH1). The frequency of the variant in gnomAD database is 0.00003596 (in 9 affected chromosomes out of 250288); no homozygous carriers were registered [28]. Most pathogenicity prediction tools, such as SIFT (https://sift.bii.a-star.edu.sg/ accessed on 26 February 2021), Polyphen2 (http://genetics.bwh.harvard.edu/pph2/ accessed on 26 February 2021), and MutationTaster (http://www.mutationtaster.org/ accessed on 26 February 2021), classify the variant as damaging. The genetic variant identified by WES was verified by Sanger sequencing in family #07. Sanger sequencing of the GIPC3 gene fragment in the affected subjects of family #07 (parents and siblings) revealed that all of them carried c.245A>G variant in the homozygous state.
After that, bidirectional sequencing of all six exons of the GIPC3 gene was performed in 22 Chuvash patients with NSHL (Figure 2). Additionally, two patients, homozygous for variant c.245A>G (families #01 and #20), and one patient, heterozygous for variant c.245A>G in the GIPC3 gene (family #04), were identified. The total number of homozygous patients appeared to be six, with one additional patient carrying this variant in the heterozygous state (Table 1). Thus, the frequency of NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant in Chuvash NSHL patients was 25.0% (13/52 chromosomes). Based on sequencing results of the entire GIPC3 gene it became possible to determine the haplotype of common single nucleotide polymorphisms (SNP) linked to the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant in the GIPC3 gene. In all cases, it was the same haplotype (Table 3). This pointed to the common origin of the pathogenic allele.
To confirm that the pathogenic variant is distributed in the healthy Chuvash population and other neighboring ethnic groups of the Volga-Ural region, we tested the carriage rate of the c.245A>G variant in the GIPC3 gene by PCR-RFLP (Figure 3). In a sample of 175 healthy Chuvash individuals, four heterozygous carriers of NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant of GIPC3 gene were revealed. The frequency of carriage of the variant in the Chuvash population was 1:44 (175/4), the population frequency was 0.0114 (95% CI 0.0031–0.0290), i.e., over 1%.
Healthy individuals from other populations neighboring the Chuvash population of the Volga-Ural region (93 Russians from the Kirov region, 320 Mari, 42 Udmurts, 183 Tatars, and 283 Bashkirs) were tested. In the tested samples, no carriers of the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant were found. Thus, we can conclude that the c.245A>G variant in the GIPC3 gene is exceedingly rare, if it exists, in other nearby ethnic groups and is specific to the Chuvash.

4. Discussion

According to the 2010 Census, ethnic Chuvash make up 67.7% (814,750 persons) of the Chuvash Republic’s population. Due to the high genetic heterogeneity of hereditary hearing pathology, the analysis of the molecular causes of hearing loss in Chuvash patients was carried out according to the developed algorithm of molecular genetic examination of NSHL in Russia and European countries.
In many populations around the world, the most common cause of NSHL is the c.35delG mutation in the GJB2 gene, as well as some other pathogenic variants in the GJB2, GJB6, and GJB3 genes. Therefore, at the first stage of this study, the genes of these connexins were selected as candidate genes. Both point mutations by Sanger sequencing and CNV by MLPA were analyzed. In the examined group of 26 Chuvash patients, pathogenic variants in the GJB2, GJB6, and GJB3 genes were not detected.
Due to the high genetic heterogeneity, the next method of searching for the molecular causes of NSHL in Chuvash people was whole exome sequencing performed in a patient whose parents and siblings are also affected. A single nucleotide variant g.chr19:3586512A>G, NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser), in the homozygous state was identified in the proband leading to the substitution of asparagine to serine p.(N82S) in the evolutionarily conservative position of the protein encoded by the GIPC3 gene. The GIPC3 gene encodes a protein 312 amino acid residues long that is involved in the functioning of sensitive inner ear cells and spiral ganglion neurons. Mutations in this gene are associated with nonsyndromic sensorineural hearing loss, type 15 (DFNB15) [29] with autosomal recessive inheritance. In mice, mutations of this gene are associated with nonsyndromic hearing loss or with juvenile audiogenic monogenic seizure syndrome. In patients with sensorineural hearing loss, there are biallelic nonsense, missense, and frameshifting mutations of the GIPC3 gene [30,31,32,33,34,35]. Most of the described cases were found in Pakistan, India, and The Netherlands as single cases (Table 4). All the described patients were diagnosed with bilateral prelingual hearing loss. These mutations cause variable hearing impairment, from moderate to profound [30,31,32,33,34,35,36,37,38]. In the Russian Federation, cases of DFNB15 hearing loss have not been previously reported to date.
Although the variant is noted in the general population, its frequency is insufficient to rule out its pathogenic role. Computer prediction tools and conservativeness analysis suggest that the variant may disrupt protein function, but this information is not sufficient to determine pathogenicity. The variant reported here as the most likely cause of the disease was found by two groups of researchers [39,40] in two Iranian closely related families in three patients with NSHL in a homozygous state (Table 4).
There is some interfamily variability in the manifestations of the disease in homozygous patients of the variant (Table 1). All affected members of family #07 have profound bilateral prelingual hearing loss, starting from the first months of life. Whereas family proband #1 has severe bilateral prelingual hearing loss, the age of onset is early childhood. Proband from family #20 was diagnosed with bilateral prelingual hearing loss: complete hearing loss at right-side and severe at left-side. It should be noted that the described Iranian patients also showed interfamily and intrafamily phenotype variability. The patient described by Bitarafan F. et al. [39] had severe hearing impairment from birth; the siblings described by Kannan-Sundhari A. et al. [40] had the onset of the disease from birth, but the severity varied: one had moderate, the other, from moderate to severe (Table 4). Noncoding changes, such as variants located deep in intronic sequence regions which were out of our study, may explain the phenotype variability in carriers of NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant, although, of course, their phenotype may be explained by variants in other genes.
Table
Table 4. Mutations in the GIPC3 gene associated with hearing loss described in the literature.
Table 4. Mutations in the GIPC3 gene associated with hearing loss described in the literature.
No.Nucleotide Variant
(Amino Acid Change)		Mutation TypeDomainNumber of Patients/Number of FamiliesHearing Loss SeverityPopulationReference
1NM_133261.3(GIPC3):c.122C>A (p.Thr41Lys)MissenseGH11/1Severe to profoundSaudi Arabia[33]
2NM_133261.3(GIPC3):c.136G>A (p.Gly46Arg)MissenseGH11/1Severe to profoundPakistan[32]
3NM_133261.3(GIPC3):c.226-1G>TSplicing siteNA11/1Severe to profoundPakistan[35]
4NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser)MissenseGH11/1SevereIran[39]
2/1Moderate; moderate to severeIran[40]
5NM_133261.3(GIPC3):c.264G>A (p.Met88Ile)MissenseGH11/1Mild to severePakistan[32]
6NM_133261.3(GIPC3):c.281G>A (p.Gly94Asp)MissenseGH11/1Mild to severePakistan[32]
7NM_133261.3(GIPC3):c.472G>A (p.Glu158Lys)MissensePDZ5/1Severe to profoundIran (Arab origin)[36]
8NM_133261.3(GIPC3):c.508C>A (p.His170Asn)MissensePDZ1/1AR NSHLTurkey[34]
1/1AR NSHLTurkey[35]
9NM_133261.3(GIPC3):c.565C>T (p.Arg189Cys)MissensePDZ1/1Severe to profoundPakistan[32]
10NM_133261.3(GIPC3):c.662C>T (p.Thr221Ile)MissenseGH21/1ProfoundPakistan[32]
11NM_133261.3(GIPC3):c.685dupG (p.Ala229GlyfsTer10)FrameshiftH2 1/1Moderate to severePakistan[32]
12NM_133261.3(GIPC3):c.767G>A (p.Gly256Asp)MissenseGH2 1/1Moderate to severePakistan [32]
13NM_133261.3(GIPC3):c.785T>G (p.Leu262Arg)MissenseGH2 1/1Stable, profoundIndia [31]
14NM_133261.3(GIPC3):c.903G>A (p.Trp301Ter)NonsenseGH2 1/1Progressive, profoundHolland [31]
15NM_133261.3(GIPC3):c.759C>G (p.Ser253Arg)MissenseGH21/1SeverePakistan[37]
16NM_133261.3(GIPC3):c.764T>A (p.Met255Lys)MissenseGH22/1Severe to profoundAlgeria[38]
17NM_133261.3(GIPC3):c.937T>C (p.Ter313GlnextTer98)Stop-lossGH25/1NDPakistan [41]
ND—no data.
In our study, the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant was found in 25.0% of mutant chromosomes in Chuvash patients with NSHL (13/52), in six patients in the homozygous state and in one in the heterozygous state. In the latter, no other pathogenic variants in the GIPC3 gene were detected during Sanger sequencing, so it can be assumed that the molecular genetic causes of the disease are pathogenic variants in another gene, and heterozygous carriage is due to a high population frequency of the NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant in Chuvash population. This is supported by the fact that the heterozygous carriage was found in a healthy mother in family #13, whereas proband does not carry this variant.
Indeed, in the Chuvash population of healthy individuals, the frequency of NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant is more than 1% (0.0114, 95% CI 0.0031–0.0290; 4/350 chromosomes). While in five neighboring populations of the Volga-Ural region with a different ethnic composition (Russians of the Kirov region, Mari, Udmurts, Tatars, Bashkirs), this variant was not detected (0 out of 1842 chromosomes, frequency = 0.0000, 95% CI 0.0000–0.0016).
To explain this specifically for Chuvash population result, data on the formation of the Chuvash ethnic group are used. Based on numerous historical, cultural, and linguistic data, most researchers recognize the Chuvash as descendants of the Bulgarian and Suvar tribes that appeared on the Middle Volga in the VII–VIII centuries. The settlement of the Chuvash region by the Bulgarian-Suvars was intensive until the middle of the XIV century. The ancestral home of the local Chuvash population—the State of Volga Bulgaria, flourished until the XIII century, and its population was approaching 1.5 million. The territory of the State was inhabited by the Prachuvash, Mari (Cheremis), Udmurts, Bashkirs, Tatars, and Russians. As a result of the invasion of the Tatar–Mongol Golden Horde and the plague epidemic, at least ⅘ of the population of the state was destroyed, and it ceased to exist. Thus, the gene pool of the remaining Bulgarian population formed the basis of the modern Chuvash ethnic group. According to the published data, at the beginning of the XV century, i.e., after six generations, there were about 100 thousand Chuvash people. Official statistics on the number of Chuvash people could not be found in literary sources until the XV century. The Chuvash were known as “mountain Cheremis”. It can be assumed that by the beginning of the XIII century, after the events that took place, about 40–50 thousand Prachuvash remained in Volga Bulgaria, who mixed with other peoples of Volga Bulgaria. Until the middle of the twentieth century, 90% of the Chuvash people lived in rural areas, preserving their traditional culture and positive ethnic marital assortativeness. Over the past five centuries, the population has grown to 1.5 million people, i.e., increased by 15 times, which could possibly lead to the population effect of the “bottle neck” [42,43]. In such a situation, with social isolation and reduced migration activity of the population (which has been observed for almost three centuries), it is possible to “fix” certain alleles in the population, which caused a high accumulation of a number of hereditary diseases or specific genetic variants for the Chuvash people [19]. Among these diseases were identified: osteopetrosis, infantile malignant, type 1 (variant NM_006019.4(TCIRG1):c.807+5G>A, population frequency 1.68%) [44]; familial erythrocytosis, type 2 (variant NM_000551.4(VHL):c.598C>T (p.Arg200Trp), frequency 1.84%) [45]; hypotrichosis type 7 (variant LIPH EX4 DEL, frequency 2.72%) [46]; woolly hair, autosomal recessive type 3, with hypotrichosis (variant NM_181534.4(KRT25):c.712G>T (p.Val238Leu), frequency 1.5%) [47]; cystic fibrosis (variant NM_000492.4(CFTR):c.274G>A (p.Glu92Lys), frequency 0.73%) [48].

5. Conclusions

Thus, as a result of the conducted study, the genetic variant c.245A>G in the GIPC3 gene was identified with high frequency. This is the molecular cause of hereditary sensorineural hearing loss in the Chuvash people, and it was previously described in patients with NSHL of Iranian origin [37,38]. Its high frequency in the Chuvash population may be due to a number of consecutive events that occurred in the historical past of the Chuvash population: the founder effect, the “bottleneck,” and/or gene drift.

Author Contributions

Conceptualization, R.A.Z. and N.V.P.; methodology, F.A.K., A.V.M.; software, A.V.M.; validation, N.V.B., A.V.M.; investigation, N.V.B., N.V.P.; resources, A.V.A.; data curation, R.A.Z. and A.V.A.; writing—original draft preparation, N.V.P.; writing—review and editing, A.V.M. and R.A.Z.; supervision, A.V.M.; project administration, R.A.Z. and S.I.K.; funding acquisition, S.I.K. and R.A.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Russian Science Foundation, grant no. 17-15-01051, and the state assignment of the Ministry of Science and Higher Education of the Russian Federation.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the Research Centre for Medical Genetics, Moscow Russia (protocol No. 17/2006 dated 02.02.2006 and protocol No. 5/2010 dated 20.12.2010).

Informed Consent Statement

Written informed consent has been obtained from each participant and/or their legal representative, as appropriate, to publish this paper.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Korver, A.M.; Smith, R.J.; Van Camp, G.; Schleiss, M.R.; Bitner-Glindzicz, M.A.; Lustig, L.R.; Usami, S.I.; Boudewyns, A.N. Congenital hearing loss. Nat. Rev. Dis. Primers 2017, 12, 16094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Markova, T.G.; Bliznetz, E.A.; Polyakov, A.V.; Tavartkiladze, G.A. Twenty years of clinical studies of GJB2-linked hearing loss in Russia. Vestn. Otorinolaringol. 2018, 83, 31–36. [Google Scholar] [CrossRef] [PubMed]
  3. Meena, R.; Ayub, M. Genetics of human hereditary hearing impairment. J. Ayub. Med. Coll. Abbottabad 2017, 29, 671–676. [Google Scholar] [PubMed]
  4. World Health Organization. Available online: https://www.who.int/topics/deafness/ru/ (accessed on 2 October 2020).
  5. Yang, T.; Guo, L.; Wang, L.; Yu, X. Diagnosis, Intervention, and Prevention of Genetic Hearing Loss. Adv. Exp. Med. Biol. 2019, 1130, 73–92. [Google Scholar]
  6. Online Mendelian Inheritance in Man. Available online: http://www.ncbi.nlm.nih.gov/OMIM (accessed on 31 March 2021).
  7. Shearer, A.; Hildebrand, M.S.; Smith, R.J.H. Hereditary Hearing Loss and Deafness Overview. GeneReviews® [Internet] Initial Posting: 14 February 1999; Last Update: 27 July 2017. Available online: https://www.ncbi.nlm.nih.gov/books/NBK1434/ (accessed on 2 October 2020).
  8. Van Camp, G.; Willems, P.J.; Smith, R.J. Nonsyndromic hearing impairment: Unparalleled heterogeneity. Am. J. Hum. Genet. 1997, 60, 758–764. [Google Scholar]
  9. Morton, N.E. Genetic epidemiology of hearing impairment. Ann. N. Y. Acad. Sci. 1991, 630, 16–31. [Google Scholar] [CrossRef]
  10. Tekin, M.; Arnos, K.S.; Pandya, A. Advances in hereditary deafness. Lancet 2001, 358, 1082–1090. [Google Scholar] [CrossRef]
  11. Lee, S.W.; Tomasetto, C.; Paul, D.; Keyomarsi, K.; Sager, R. Transcriptional downregulation of gap-junction proteins blocks junctional communication in human mammary tumor cell lines. J. Cell Biol. 1992, 118, 1213–1221. [Google Scholar] [CrossRef]
  12. Kenneson, A.; Van Naarden Braun, K.; Boyle, C. GJB2 (connexin 26) variants and nonsyndromic sensorineural hearing loss: A HuGE review. Genet. Med. 2002, 4, 258–274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Chan, D.K.; Chang, K.W. GJB2-associated hearing loss: Systematic review of worldwide prevalence, genotype, and auditory phenotype. Laryngoscope 2014, 124, E34–E53. [Google Scholar] [CrossRef]
  14. Dzhemileva, L.U.; Barashkov, N.A.; Posukh, O.L.; Khusainova, R.I.; Akhmetova, V.L.; Kutuev, I.A.; Gilyazova, I.R.; Tadinova, V.N.; Fedorova, S.A.; Khidiyatova, I.M.; et al. Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia. J. Hum. Genet. 2010, 55, 749–754. [Google Scholar] [CrossRef]
  15. Zinchenko, R.A.; El’chinova, G.I.; Baryshnikova, N.V.; Polyakov, A.V.; Ginter, E.K. Prevalences of hereditary diseases in different populations of Russia. Russ. J. Genet. 2007, 43, 1038–1045. [Google Scholar] [CrossRef]
  16. Zinchenko, R.A.; Ginter, E.K.; Kutsev, S.I. Features of the diversity of hereditary diseases in different regions and multiethnic populations of the Russian Federation. Med. Genet. 2020, 19, 13–14. (In Russian) [Google Scholar]
  17. Vasilyeva, T.A.; Marakhonov, A.V.; Voskresenskaya, A.A.; Kadyshev, V.V.; Käsmann-Kellner, B.; Pozdeyeva, N.A.; Katargina, L.A.; Kutsev, S.I.; Zinchenko, R.A. Analysis of Genotype–Phenotype Correlations in Aniridia. J. Med. Genet. 2020. [Google Scholar] [CrossRef]
  18. Petrova, N.V.; Kashirskaya, N.Y.; Vasilyeva, T.A.; Kondratyeva, E.I.; Zhekaite, E.K.; Voronkova, A.Y.; Sherman, V.D.; Galkina, V.A.; Ginter, E.K.; Kutsev, S.I.; et al. Analysis of CFTR Mutation Spectrum in Ethnic Russian Cystic Fibrosis Patients. Genes 2020, 11, 554. [Google Scholar] [CrossRef] [PubMed]
  19. Zinchenko, S.P.; Kirillov, A.G.; Abrukova, A.V.; Sorokina, T.V.; Sharonova, E.I.; Khidiyatova, I.M.; Jemileva, L.U.; Shokarev, R.A.; Bliznetz, E.A.; Zinchenko, R.A.; et al. Epidemiology study of hereditary deafness (nonsyndromal and syndromal) Chuvashia Republic. Med. Genet. 2007, 6, 18–28. (In Russian) [Google Scholar]
  20. Petrina, N.E.; Bliznetz, E.A.; Zinchenko, R.A.; Makaov, A.K.; Petrova, N.A.; Vasilyeva, T.A.; Chudakova, L.V.; Petrin, A.N.; Polyakov, A.V.; Ginter, E.K. The frequency of GJB2 gene mutations in patients with hereditary non-syndromic sensoneural hearing loss in eight populations of Karachay-Cherkess Republic. Med. Genet. 2017, 16, 19–25. (In Russian) [Google Scholar]
  21. Petrina, N.E.; Bliznetz, E.A.; Zinchenko, R.A.; Makaov, A.Ê.-M.; Petrova, N.A.; Vasilyeva, T.A.; Chudakova, L.V.; Petrin, A.N.; Polyakov, A.V.; Ginter, E.K. Analysis of pedigrees with nonsyndromic sensorineural hearing loss in assortative marriages. Med. Genet. 2018, 17, 47–50. [Google Scholar]
  22. Shokarev, R.A.; Amelina, S.S.; Kriventsova, N.V.; El’chinova, G.I.; Khlebnikova, O.V.; Bliznetz, E.A.; Tverskaya, S.M.; Polyakov, A.V.; Zinchenko, R.A. Genetic epidemiological and medical genetic study of hereditary deafness in Rostov Oblast. Med. Genet. 2005, 4, 556–565. (In Russian) [Google Scholar]
  23. Sharonova, E.I.; Osetrova, A.A.; Zinchenko, R.A. Hereditary hearing disorders in Kirov Oblast. Yakut Med. J. 2009, 2, 28–31. (In Russian) [Google Scholar]
  24. Zinchenko, R.A.; Osetrova, A.A.; Sharonova, E.I. Hereditary Deafness in Kirov Oblast: Estimation of the Incidence Rate and DNA Diagnosis in Children. Russ. J. Genet. 2012, 48, 542–550. [Google Scholar] [CrossRef]
  25. Zinchenko, R.A.; Makaov, A.K.; Kadyshev, V.V.; Galkina, V.A.; Dadali, E.L.; Mikhailova, L.K.; Shurygina, M.F.; Marakhonov, A.V.; Petrova, N.V.; Petrona, N.E.; et al. Diversity and prevalence of hereditary diseases among Nogais of the Karachay-Cherkess Republic. Russ. J. Genet. 2018, 54, 858–865. [Google Scholar] [CrossRef]
  26. Petrina, N.E.; Marakhonov, A.V.; Balinova, N.V.; Mironovich, O.L.; Polyakov, A.V.; Zinchenko, R.A. Description of a rare case of hereditary hearing loss with X-linked recessive type of inheritance associated with the POU3F4 gene in the Nogai family. Vestn. Otorhinolaryngol. 2020, 85, 65–69. [Google Scholar] [CrossRef]
  27. Lozier, E.R.; Konovalov, F.A.; Kanivets, I.V.; Pyankov, D.V.; Koshkin, P.A.; Baleva, L.S.; Sipyagina, A.E.; Yakusheva, E.N.; Kuchina, A.E.; Korostelev, S.A. De novo nonsense mutation in WHSC1 (NSD2) in patient with intellectual disability and dysmorphic features. J. Hum. Genet. 2018. [Google Scholar] [CrossRef]
  28. Zhivotovsky, L.A. Population-Based Biometrics; Nauka: Moscow, Russia, 1991. (In Russian) [Google Scholar]
  29. Clopper, C.J.; Pearson, S. The use of confidence or fiducial limits illustrated in the canse of the binomial. Biometrika 1934, 26, 404–413. [Google Scholar] [CrossRef]
  30. The Genome Aggregation Database. Available online: http://gnomad.broadinstitute.org (accessed on 31 March 2021).
  31. Charizopoulou, N.; Lelli, A.; Schraders, M.; Ray, K.; Hildebrand, M.S.; Ramesh, A.; Srisailapathy, C.R.; Oostrik, J.; Admiraal, R.J.; Neely, H.R.; et al. Gipc3 mutations associated with audiogenic seizures and sensorineural hearing loss in mouse and human. Nat. Commun. 2011, 15, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Rehman, A.U.; Gul, K.; Morell, R.J.; Lee, K.; Ahmed, Z.M.; Riazuddin, S.; Ali, R.A.; Shahzad, M.; Jaleel, A.U.; Andrade, P.B.; et al. Mutations of GIPC3 cause nonsyndromic hearing loss DFNB72 but not DFNB81 that also maps to chromosome 19p. Hum. Genet. 2011, 130, 759–765. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Ramzan, K.; Al-Owain, M.; Allam, R.; Berhan, A.; Abuharb, G.; Taibah, K.; Imtiaz, F. Homozygosity mapping identifies a novel GIPC3 mutation causing congenital nonsyndromic hearing loss in a Saudi family. Gene 2013, 521, 195–199. [Google Scholar] [CrossRef] [PubMed]
  34. Diaz-Horta, O.; Duman, D.; Foster, J., 2nd; Sırmacı, A.; Gonzalez, M.; Mahdieh, N.; Fotouhi, N.; Bonyadi, M.; Cengiz, F.B.; Menendez, I.; et al. Whole-exome sequencing efficiently detects rare mutations in autosomal recessive nonsyndromic hearing loss. PLoS ONE 2012, 7, e50628. [Google Scholar]
  35. Sirmaci, A.; Edwards, Y.J.; Akay, H.; Tekin, M. Challenges in whole exome sequencing: An example from hereditary deafness. PLoS ONE 2012, 7, e32000. [Google Scholar] [CrossRef]
  36. Asgharzade, S.; Tabatabaiefar, M.A.; Mohammadi-Asl, J.; Chaleshtori, M.H. A novel missense mutation in GIPC3 causes sensorineural hearing loss in an Iranian family revealed by targeted next-generation sequencing. Int. J. Pediatr. Otorhinolaryngol. 2018, 108, 8–11. [Google Scholar] [CrossRef]
  37. Ahmad, W.; Zhang, X. Sequence variants in genes causing nonsyndromic hearing loss in a Pakistani cohort. Mol. Genet. Genom. Med. 2019, 7, e917. [Google Scholar]
  38. Ammar-Khodja, F.; Bonnet, C.; Dahmani, M.; Ouhab, S.; Lefèvre, G.M.; Ibrahim, H.; Hardelin, J.P.; Weil, D.; Louha, M.; Petit, C. Diversity of the causal genes in hearing impaired Algerian individuals identified by whole exome sequencing. Mol. Genet. Genom. Med. 2015, 3, 189–196. [Google Scholar] [CrossRef] [PubMed]
  39. Bitarafan, F.; Seyedena, S.Y.; Mahmoudi, M.; Garshasbi, M. Identification of novel variants in Iranian consanguineous pedigrees with nonsyndromic hearing loss by next-generation sequencing. J. Clin. Lab. Anal. 2020, 34, e23544. [Google Scholar] [CrossRef]
  40. Kannan-Sundhari, A.; Yan, D.; Saeidi, K.; Sahebalzamani, A.; Blanton, S.H.; Liu, X.Z. Screening Consanguineous Families for Hearing Loss Using the MiamiOtoGenes Panel. Genet. Test Mol. Biomark. 2020, 24, 674–680. [Google Scholar] [CrossRef]
  41. Zhou, Y.; Tariq, M.; He, S.; Abdullah, U.; Zhang, J.; Baig, S.M. Whole exome sequencing identified mutations causing hearing loss in five consanguineous Pakistani families. BMC Med. Genet. 2020, 21, 151. [Google Scholar] [CrossRef]
  42. Alekseev, V. The Geography of Human Races, 1st ed.; Nauka: Moscow, Russia, 1974. [Google Scholar]
  43. Kuzeev, R. The Peoples of the Volga and Ural Regions, 1st ed.; Nauka: Moscow, Russia, 1985. [Google Scholar]
  44. Bliznetz, E.A.; Tverskaya, S.M.; Zinchenko, R.A.; Abrukova, A.V.; Savaskina, E.N.; Nikulin, M.V.; Kirillov, A.G.; Ginter, E.K.; Polyakov, A.V. Genetic analysis of autosomal recessive osteopetrosis in Chuvashiya: The unique splice site mutation in TCIRG1 gene spread by the founder effect. Eur. J. Hum. Genet. 2009, 17, 664–672. [Google Scholar] [CrossRef]
  45. Vasserman, N.N.; Zinchenko, R.A.; Polyakov, A.V. The age of Arg200Trp mutation in VHL gene, the cause of autosomal recessive erythrocytosis in Chuvashia. Med. Genet. 2007, 6, 31–36. (In Russian) [Google Scholar]
  46. Kazantseva, A.; Goltsov, A.; Zinchenko, R.; Grigorenko, A.P.; Abrukova, A.V.; Moliaka, Y.K.; Kirillov, A.G.; Guo, Z.; Lyle, S.; Ginter, E.K.; et al. Human Hair Growth Deficiency Is Linked to a Genetic Defect in the Phospholipase Gene LIPH. Science 2006, 314, 982–985. [Google Scholar] [CrossRef] [Green Version]
  47. Zernov, N.V.; Skoblov, M.Y.; Marakhonov, A.V.; Shimomura, Y.; Vasilyeva, T.A.; Konovalov, F.A.; Abrukova, A.V.; Zinchenko, R.A. Autosomal Recessive Hypotrichosis with Woolly Hair Caused by a Mutation in the Keratin 25 Gene Expressed in Hair Follicles. J. Investig. Dermatol. 2016, 136, 1097–1105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Stepanova, A.A.; Abrukova, A.V.; Savaskina, E.N.; Polyakov, A.V. Mutation p.E92K is the Primary Cause of Cystic Fibrosis in Chuvashes. Russ. J. Genet. 2012, 48, 731–737. [Google Scholar] [CrossRef]
Genes 12 00820 g001 550
Figure 1. Pedigree of family #07 affected by hereditary nonsyndromic sensorineural hearing loss. P indicates proband.
Figure 1. Pedigree of family #07 affected by hereditary nonsyndromic sensorineural hearing loss. P indicates proband.
Genes 12 00820 g001
Genes 12 00820 g002a 550Genes 12 00820 g002b 550
Figure 2. Chromatograms of sequencing results of the GIPC3 exon 2 fragment. (a) Homozygous for NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant proband III.2 from family #07. (b) Heterozygous for NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant proband from family #04. (c) Homozygous for wild type proband from family #16.
Figure 2. Chromatograms of sequencing results of the GIPC3 exon 2 fragment. (a) Homozygous for NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant proband III.2 from family #07. (b) Heterozygous for NM_133261.3(GIPC3):c.245A>G (p.Asn82Ser) variant proband from family #04. (c) Homozygous for wild type proband from family #16.
Genes 12 00820 g002aGenes 12 00820 g002b
Genes 12 00820 g003 550
Figure 3. Electrophoregram of PCR-RFLP test-system performance for population screening for c.245A>G variant in GIPC3 gene. Lanes: 1—uncut fragment; 2—wild type fragment cut with BstDEI restriction endonuclease; 3—heterozygous fragment cut with BstDEI; 4—homozygous fragment cut with BstDEI.
Figure 3. Electrophoregram of PCR-RFLP test-system performance for population screening for c.245A>G variant in GIPC3 gene. Lanes: 1—uncut fragment; 2—wild type fragment cut with BstDEI restriction endonuclease; 3—heterozygous fragment cut with BstDEI; 4—homozygous fragment cut with BstDEI.
Genes 12 00820 g003
Table
Table 1. Patients included in the study.
Table 1. Patients included in the study.
Family #Patient’s AgeAge of OnsetAge of ManifestationDegree of Hearing LossGenotype for GIPC3 Coding Region
0124Early childhoodnoticed in 2 years Bilateral;
severe		NM_133261.3(GIPC3):c.[245A>G];[245A>G] (p.[Asn82Ser];[Asn82Ser])
0214Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
038Congenitalfrom the first months of lifeBilateral;
severe.		NM_133261.3(GIPC3):c.[=];[=]
0414Congenitalat 5 monthsBilateral;
complete 		NM_133261.3(GIPC3):c.[245A>G];[=] (p.[Asn82Ser];[=])
0518Congenitalnoticed in 2 yearsBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
0633Congenitalnoticed in 2 yearsBilateral;
severe		NM_133261.3(GIPC3):c.[=];[=]
071Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[245A>G];[245A>G] (p.[Asn82Ser];[Asn82Ser])
0728Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[245A>G];[245A>G] (p.[Asn82Ser];[Asn82Ser])
0732Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[245A>G];[245A>G] (p.[Asn82Ser];[Asn82Ser])
074Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[245A>G];[245A>G] (p.[Asn82Ser];[Asn82Ser])
0812Congenitalnoticed in 3 yearsOD-moderate, OS severeNM_133261.3(GIPC3):c.[=];[=]
0910Congenitalnoticed in 1 yearOD-moderate, OS severeNM_133261.3(GIPC3):c.[=];[=]
1018Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
1114Congenitalfrom the first months of lifeOD-severe, OS profoundNM_133261.3(GIPC3):c.[=];[=]
126Congenitalnoticed in 3 yearsBilateral;
profound.		NM_133261.3(GIPC3):c.[=];[=]
1310Congenitalfrom the first months of lifeOD-severe, OS profoundNM_133261.3(GIPC3):c.[=];[=]
1415Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
1516Congenitalnoticed in 1.5 yearsBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
1619Congenitalfrom the first months of lifeBilateral;
complete		NM_133261.3(GIPC3):c.[=];[=]
1714Childhood5–6 yearsUnilateral;
OD moderate		NM_133261.3(GIPC3):c.[=];[=]
1742Childhood13–14 yearsUnilateral;
OS moderate to severe		NM_133261.3(GIPC3):c.[=];[=]
1813Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
1838Congenitalnoticed in 1.5 yearsBilateral;
profound		NM_133261.3(GIPC3):c.[=];[=]
1936Congenitalnoticed by 6–7 monthsOD complete, OS profoundNM_133261.3(GIPC3):c.[=];[=]
2022Congenitalfrom the first months of lifeBilateral;
profound		NM_133261.3(GIPC3):c.[245A>G];[245A>G] (p.[Asn82Ser];[Asn82Ser])
2122Congenitalnoticed by 12–13 monthsOD moderate, OS severeNM_133261.3(GIPC3):c.[=];[=]
Table
Table 2. Primers used in the study.
Table 2. Primers used in the study.
GenePrimer Name and Sequence in 5′—3′ Direction
GJB2F1 TCATGGGGGCTCAAAGGAAC
R1 AAGGACGTGTGTTGGTCCAG
F2 GTTCTGTCCTAGCTAGTGATT
R2 GGTTGCCTCATCCCTCTCAT
GJB3F1 CGTTGTGAGTATTGAACAAGTCAGAACTCAG
R1 GTTGATCCCTTCCTGGTTA
F2 CTCTGCTACCTCATCTGCCA
R2 GTTGATCCCTTCCTGGTTGA
GJB6F1 CTTTCAGGGTGGGCATTCCT
R1 AGCACAACTCTGCCACGTTA
F2 CTTCGTCTGCAACACACTGC
R2 GCAATGCTCCTTTGTCAAGCA
GIPC3-ex1F1 CTTATTTGTGGTCCCTGTTCTTC
R1 AGTCCTAAGACCTGCCCATCT
GIPC3-ex2–4F2 CTCTCTCTGTTCTGGGGGTCC
R2 ACCTACGAGTTTCTGATACCCTG
GIPC3-ex5–6F3 GGCATGGAACTGGGATGTTA
R3 GCACATAGCTTGGCCTCAGAT
GIPC3-c.245A>GGIPC3-Fmut TCTCCACCTGCTGGAAGTCT
GIPC3-Rmut CCTCGATCCGGTTGATGAT
Table
Table 3. Haplotype linked to the c.245A>G variant in GIPC3 gene.
Table 3. Haplotype linked to the c.245A>G variant in GIPC3 gene.
Single
Nucleotide
Polymorphism
(SNP)		rs112835547rs34722692rs8100350rs8113232rs4806942rs10406702rs10426399rs28532669rs78077103rs78077103rs17348907
Possible genotypes (ref/alt)C/T C/T G/A A/G A/G T/C C/T G/A G/T G/A C/T
Haplotype linked to the variantTCGGGTCGGGT
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Petrova, N.V.; Marakhonov, A.V.; Balinova, N.V.; Abrukova, A.V.; Konovalov, F.A.; Kutsev, S.I.; Zinchenko, R.A. Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population. Genes 2021, 12, 820. https://doi.org/10.3390/genes12060820

AMA Style

Petrova NV, Marakhonov AV, Balinova NV, Abrukova AV, Konovalov FA, Kutsev SI, Zinchenko RA. Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population. Genes. 2021; 12(6):820. https://doi.org/10.3390/genes12060820

Chicago/Turabian Style

Petrova, Nika V., Andrey V. Marakhonov, Natalia V. Balinova, Anna V. Abrukova, Fedor A. Konovalov, Sergey I. Kutsev, and Rena A. Zinchenko. 2021. "Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population" Genes 12, no. 6: 820. https://doi.org/10.3390/genes12060820

APA Style

Petrova, N. V., Marakhonov, A. V., Balinova, N. V., Abrukova, A. V., Konovalov, F. A., Kutsev, S. I., & Zinchenko, R. A. (2021). Genetic Variant c.245A>G (p.Asn82Ser) in GIPC3 Gene Is a Frequent Cause of Hereditary Nonsyndromic Sensorineural Hearing Loss in Chuvash Population. Genes, 12(6), 820. https://doi.org/10.3390/genes12060820

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop