Gene Polymorphisms of NOD2, IL23R, PTPN2 and ATG16L1 in Patients with Crohn’s Disease: On the Way to Personalized Medicine?
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Characteristics of the Included Patients
3.2. Associations of SNPs with Therapy Responses
3.3. Secondary Study Objectives
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kaplan, G.G. The global burden of IBD: From 2015 to 2025. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 720–727. [Google Scholar] [CrossRef]
- Etienne-Mesmin, L.; Chassaing, B.; Gewirtz, A.T. Tryptophan: A gut microbiota-derived metabolites regulating inflammation. World J. Gastrointest. Pharmacol. Ther. 2017, 8, 7–9. [Google Scholar] [CrossRef] [PubMed]
- Peña, R.D.; Valdés, E.; Cofré, C.; Castro-Santos, P. Th17 response and autophagy—Main pathways implicated in the development of inflammatory bowel disease by genome-wide association studies. Rev. Esp. Enferm. Dig. 2015, 107, 560–566. [Google Scholar]
- Kennedy, N.A.; Lamb, C.A.; Berry, S.H.; Walker, A.W.; Mansfield, J.; Parkes, M.; Simpkins, R.; Tremelling, M.; Nutland, S.; UK IBD Genetics Consortium; et al. The impact of NOD2 variants on fecal microbiota in Crohn’s disease and controls without gastrointestinal disease. Inflamm. Bowel Dis. 2018, 24, 583–592. [Google Scholar] [CrossRef] [Green Version]
- Iida, T.; Onodera, K.; Nakase, H. Role of autophagy in the pathogenesis of inflammatory bowel disease. World J. Gastroenterol. 2017, 23, 1944–1953. [Google Scholar] [CrossRef] [PubMed]
- Boukercha, A.; Mesbah-Amroun, H.; Bouzidi, A.; Saoula, H.; Nakkemouche, M.; Roy, M.; Hugot, J.; Touil-Boukoffa, C. NOD2/CARD15 gene mutations in north Algerian patients with inflammatory bowel disease. World J. Gastroenterol. 2015, 21, 7786–7794. [Google Scholar] [CrossRef] [PubMed]
- Sidiq, T.; Yoshihama, S.; Downs, I.; Kobayashi, K.S. Nod2: A critical regulator of ileal microbiota and Crohn’s disease. Front. Immunol. 2016, 20, 367. [Google Scholar] [CrossRef]
- Pranculienė, G.; Steponaitienė, R.; Skiecevičienė, J.; Kučinskienė, R.; Kiudelis, G.; Adamonis, K.; Labanauskas, L.; Kupčinskas, L. Associations between NOD2, IRGM and ORMDL3 polymorphisms and pediatric-onset inflammatory bowel disease in the Lithuanian population. Medicina (Kaunas) 2016, 52, 325–330. [Google Scholar] [CrossRef]
- Schäffler, H.; Geiss, D.; Gittel, N.; Rohde, S.; Huth, A.; Glass, Ä.; Brandhorst, G.; Jaster, R.; Lamprecht, G. Mutations in the NOD2 gene are associated with a specific phenotype and lower anti-tumor necrosis factor trough levels in Crohn’s disease. J. Dig. Dis. 2018, 19, 678–684. [Google Scholar] [CrossRef] [PubMed]
- Juanola, O.; Moratalla, A.; Gutiérrez, A.; Sempere, L.; Zapater, P.; Giménez, P.; Almenta, I.; Peiró, G.; González-Navajas, J.M.; Such, J.F.; et al. Anti-TNF-α loss of response is associated with a decreased percentage of FoxP3+ T cells and a variant NOD2 genotype in patients with Crohn’s disease. J. Gastroenterol. 2015, 50, 758–768. [Google Scholar] [CrossRef]
- Wang, S.L.; Shao, B.Z.; Zhao, S.B.; Fang, J.; Gu, L.; Miao, C.Y.; Li, Z.S.; Bai, Y. Impact of Paneth Cell Autophagy on Inflammatory Bowel Disease. Front. Immunol. 2018, 9, 693. [Google Scholar] [CrossRef] [Green Version]
- Nuij, V.J.A.A.; Peppelenbosch, M.P.; van der Woude, C.J.; Fuhler, G.M. Genetic polymorphism in ATG16L1 gene is associated with adalimumab use in inflammatory bowel disease. J. Transl. Med. 2017, 15, 248. [Google Scholar] [CrossRef] [Green Version]
- Salem, M.; Ammitzboell, M.; Nys, K.; Seidelin, J.B.; Nielsen, O.H. ATG16L1: A multifunctional susceptibility factor in Crohn disease. Autophagy 2015, 11, 585–594. [Google Scholar] [CrossRef] [PubMed]
- Todd, J.A.; Walker, N.M.; Cooper, J.D.; Smyth, D.J.; Downes, K.; Plagnol, V.; Bailey, R.; Nejentsev, S.; Field, S.F.; Payne, F.; et al. Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes. Nat. Genet. 2007, 39, 857–864. [Google Scholar] [CrossRef] [PubMed]
- Anderson, C.A.; Boucher, G.; Lees, C.W.; Franke, A.; D’Amato, M.; Taylor, K.D.; Lee, J.C.; Goyette, P.; Imielinski, M.; Latiano, A.; et al. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat. Genet. 2011, 43, 246–252. [Google Scholar] [CrossRef] [Green Version]
- Smyth, D.J.; Plagnol, V.; Walker, N.M.; Cooper, J.D.; Downes, K.; Yang, J.H.; Howson, J.M.; Stevens, H.; McManus, R.; Wijmenga, C.; et al. Shared and distinct genetic variants in type 1 diabetes and celiac disease. N. Engl. J. Med. 2008, 359, 2767–2777. [Google Scholar] [CrossRef] [Green Version]
- Wellcome Trust Case Control Consortium. Genome-wide association study of 14,000 cases of seven common diseases and 3000 shared controls. Nature 2007, 447, 661–678. [Google Scholar] [CrossRef] [Green Version]
- Glas, J.; Wagner, J.; Seiderer, J.; Olszak, T.; Wetzke, M.; Beigel, F.; Tillack, C.; Stallhofer, J.; Friedrich, M.; Steib, C.; et al. PTPN2 gene variants are associated with susceptibility to both Crohn’s disease and ulcerative colitis supporting a common genetic disease background. PLoS ONE 2012, 7, e33682. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Jiang, H.; Chen, Z.; Lu, B.; Li, J.; Shen, X. Genetic association between IL23R rs11209026 and rs10889677 polymorphisms and risk of Crohn’s disease and ulcerative colitis: Evidence from 41 studies. Inflamm. Res. 2020, 69, 87–103. [Google Scholar] [CrossRef] [PubMed]
- Maaser, C.; Sturm, A.; Vavricka, S.R.; Kucharzik, T.; Fiorino, G.; Annese, V.; Calabrese, E.; Baumgart, D.C.; Bettenworth, D.; Nunes, P.B.; et al. ECCO-ESGAR Guideline for Diagnostic Assessment in IBD Part 1: Initial diagnosis, monitoring of known IBD, detection of complications. J. Crohns Colitis 2019, 13, 144–164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Satsangi, J.; Silverberg, M.S.; Vermeire, S.; Colombel, J.F. The Montreal classification of inflammatory bowel disease: Controversies, consensus, and implications. Gut 2006, 55, 749–753. [Google Scholar] [CrossRef] [Green Version]
- Santos, M.P.C.; Gomes, C.; Torres, J. Familial and ethnic risk in inflammatory bowel disease. Ann. Gastroenterol. 2018, 31, 14–23. [Google Scholar] [CrossRef] [PubMed]
- Moller, F.T.; Andersen, V.; Wohlfahrt, J.; Jess, T. Familial risk of inflammatory bowel disease: A population-based cohort study 1977–2011. Am. J. Gastroenterol. 2015, 110, 564–571. [Google Scholar] [CrossRef] [PubMed]
- Núñez, C.; Dema, B.; Cénit, M.C.; Polanco, I.; Maluenda, C.; Arroyo, R.; de las Heras, V.; Bartolomé, M.; de la Concha, E.G.; Urcelay, E.; et al. IL23R: A susceptibility locus for celiac disease and multiple sclerosis? Genes Immun. 2008, 9, 289–293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prescott, N.J.; Fisher, S.A.; Franke, A.; Hampe, J.; Onnie, C.M.; Soars, D.; Bagnall, R.; Mirza, M.M.; Sanderson, J.; Forbes, A.; et al. A nonsynonymous SNP in ATG16L1 predisposes to ileal Crohn’s disease and is independent of CARD15 and IBD5. Gastroenterology 2007, 132, 1665–1671. [Google Scholar] [CrossRef]
- Schnitzler, F.; Friedrich, M.; Angelberger, M.; Diegelmann, J.; Stallhofer, J.; Wolf, C.; Dütschler, J.; Truniger, S.; Olszak, T.; Beigel, F.; et al. Development of a uniform, very aggressive disease phenotype in all homozygous carriers of the NOD2 mutation p.Leu1007fsX1008 with Crohn’s disease and active smoking status resulting in ileal stenosis requiring surgery. PLoS ONE 2020, 15, e0236421. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; He, C.; Xu, Q.; Xing, C.; Yuan, Y. NOD2 Polymorphisms Associated with Cancer Risk: A Meta-Analysis. PLoS ONE 2014, 9, e89340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Glas, J.; Seiderer, J.; Wetzke, M.; Konrad, A.; Török, H.P.; Schmechel, S.; Tonenchi, L.; Grassl, C.; Dambacher, J.; Pfennig, S.; et al. rs1004819 Is the Main Disease-Associated IL23R Variant in German Crohn’s Disease Patients: Combined Analysis of IL23R, CARD15, and OCTN1/2 Variants. PLoS ONE 2007, 2, e819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Wild Type Gene | Primers, 5’-3’ |
---|---|
NOD2 R702W | CCAGACATCTGAGAAGGCCCTGCTC |
rs2066844 | GGCGCCAGGCCTGTGCCCGCTGGTG |
NOD2 G908R | CTCTTTTGGCCTTTTCAGATTCTGG |
rs2066845 | GCAACAGAGTGGGTGACGAGGGGGC |
NOD2 3020insC | GGGGCAGAAGCCCTCCTGCAGGCCC |
rs2066847 | TTGAAAGGAATGACACCATCCTGGA |
IL23R R381Q | GATTGGGATATTTAACAGATCATTCC |
rs11209026 | AACTGGGTAGGTTTTTGCAGAATTT |
PTPN2 | ACTTCGCCAATGCCTTGGTTCGGGC |
rs2542151 | CTTCCTGAGACTCTCATTTTCCTAA |
PTPN2 | ACACTAGCAGATATTGTAACATCAG |
rs7234029 | TAAGTCACAACACTGTATTGGCCCA |
ATG16L1 T300A | ACTTCTTTACCAGAACCAGGATGAG |
rs2241880 | ATCCACATTGTCCTGGGGGACTGGG |
Variable | CD Patients |
---|---|
n | 379 |
Male, n (%) | 169 (44.6) |
Disease duration at baseline (years), mean ± SD | 17.4 ± 11.5 |
Age at diagnosis (years), mean ± SD | 27.6 ± 11.9 |
Montreal classification of CD: | |
Age, n (A1:A2:A3) | 36:285:58 |
Phenotype, n (L1:L2:L3), n = 373 | 116:43:214 |
Phenotype L4, n (%), n = 373 | 47 (12.6) |
Behavior, n (B1:B2:B3), n = 366 | 135:89:142 |
Perianal disease, n (%), n = 366 | 104 (28.4) |
First-degree relative(s) with IBD, n (%) | 60 (16.6), n = 361 |
First-degree relative(s) with colon cancer, n (%) | 22 (6.5), n = 337 |
Presence of at least one extraintestinal manifestation, n (%) | 205 (54.1) |
At least one prior IBD-related intestinal resection, n (%) | 201 (53.0) |
Prior IBD-related intestinal resections per disease year, median (IQR) | 0.029 (0.090) |
Active cigarette smoking at first presentation, n (%) | 110 (29.4), n = 374 |
History of any immunomodulator treatment, n (%) | 347 (91.6) |
Azathioprine, n (%) | 284 (74.9) |
Response, n (%) | 172 (60.6) |
Nonresponse, n (%) | 20 (7.0) |
Discontinuation of therapy for other reasons, n (%) | 92 (32.4) |
6-Mercaptopurine, n (%) | 29 (7.7) |
Response, n (%) | 9 (31.0) |
Nonresponse, n (%) | 1 (3.4) |
Discontinuation of therapy for other reasons, n (%) | 19 (65.5) |
Methotrexate, n (%) | 81 (21.4) |
Response, n (%) | 46 (56.8) |
Nonresponse, n (%) | 7 (8.6) |
Discontinuation of therapy for other reasons, n (%) | 28 (34.6) |
History of anti-TNFα treatment, n (%) | 306 (80.7) |
Infliximab, n (%) | 157 (41.4) |
Response, n (%) | 115 (73.2) |
Nonresponse, n (%) | 14 (8.9) |
Discontinuation of therapy for other reasons, n (%) | 28 (17.8) |
Adalimumab, n (%) | 255 (67.3) |
Response, n (%) | 213 (83.5) |
Nonresponse, n (%) | 21 (8.2) |
Discontinuation of therapy for other reasons, n (%) | 21 (8.2) |
Golimumab, n (%) | 8 (2.1) |
Response, n (%) | 5 (62.5) |
Nonresponse, n (%) | 2 (25.0) |
Discontinuation of therapy for other reasons, n (%) | 1 (12.5) |
History of anti-integrin treatment, n (%) | 92 (24.3) |
Response, n (%) | 62 (67.4) |
Nonresponse, n (%) | 20 (21.7) |
Discontinuation of therapy for other reasons, n (%) | 10 (10.9) |
History of anti-interleukin-12/23 treatment, n (%) | 130 (34.3) |
Response, n (%) | 95 (73.1) |
Nonresponse, n (%) | 19 (14.6) |
Discontinuation of therapy for other reasons, n (%) | 16 (12.3) |
Different prior IBD therapies from first diagnosis to baseline, n, median (IQR) | 2.0 (3.0) |
Number of different IBD therapies per disease year, median (IQR) | 0.160 (0.230) |
Prior exposure to therapies | |
0 therapy, n (%) | 32 (8.4) |
1 therapy, n (%) | 70 (18.5) |
2 therapies, n (%) | 98 (25.9) |
3 therapies, n (%) | 68 (17.9) |
4 therapies, n (%) | 47 (12.4) |
5 therapies, n (%) | 37 (9.8) |
6 therapies, n (%) | 21 (5.5) |
7 therapies, n (%) | 6 (1.6) |
Variable | CD | |
---|---|---|
Genotyping | RAF, % | |
NOD2 rs2066844, n (CC:CT:TT) | 269:61:8; n = 338 | 11.3 |
NOD2 rs2066845, n (GG:GC:CC) | 296:36:5; n = 338 | 6.8 |
NOD2 rs2066847, n (--:--C:CC) | 277:55:6; n = 338 | 9.9 |
IL23R rs11209026, n (GG:AG:AA) | 351:25:0; n = 376 | 3.3 |
PTPN2 rs2542151, n (TT:GT:GG) | 260:101:12; n = 373 | 16.8 |
PTPN2 rs7234029, n (AA:AG:GG) | 258:104:11; n = 373 | 16.9 |
ATG16L1 rs2241880, n (TT:CT:CC) | 64:161:137; n = 362 | 60.1 |
PTPN2 rs7234029 (n = 110) | |||
---|---|---|---|
Variable | Wild Type AA | Risk Type AG and GG | p-Value |
n (%) | 79 (71.8) | 31 (28.2) | |
Male, n (%) | 40 (50.6) | 16 (51.6) | 0.926 |
Disease duration at baseline (years), mean ± SD | 18.0 ± 11.4 | 18.2 ± 11.1 | 0.826 |
Age at diagnosis (years), mean ± SD | 28.8 ± 13.0 | 30.6 ± 14.7 | 0.519 |
Montreal classification of CD: | |||
Age, n (A1:A2:A3) | 8:55:16 | 5:19:7 | 0.617 |
Phenotype, n (L1:L2:L3) | 29:7:43 | 9:4:18 | 0.635 |
L4, n (%) | 8 (10.1) | 2 (6.5) | 0.722 |
Behavior, n (B1:B2:B3) | 22:25:28, n = 75 | 8:6:17 | 0.208 |
Perianal disease, n (%) | 23 (30.7), n = 75 | 15 (48.4) | 0.084 |
First-degree relative(s) with IBD, n (%) | 11 (14.5), n = 76 | 8 (25.8) | 0.164 |
First-degree relative(s) with colon cancer, n (%) | 7 (9.7), n = 72 | 3 (10.3), n = 29 | 1.000 |
Active smoking, n (%) | 24 (32.9), n = 73 | 10 (34.5), n = 29 | 0.887 |
Presence of at least one extraintestinal manifestation, n (%) | 46 (58.2) | 19 (61.3) | 0.769 |
At least one prior IBD-related intestinal resection, n (%) | 48 (60.8) | 20 (64.5) | 0.715 |
Prior IBD-related intestinal resections per disease year, median (IQR) | 0.043 ± 0.140 | 0.042 ± 0.090 | 0.637 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hoffmann, P.; Lamerz, D.; Hill, P.; Kirchner, M.; Gauss, A. Gene Polymorphisms of NOD2, IL23R, PTPN2 and ATG16L1 in Patients with Crohn’s Disease: On the Way to Personalized Medicine? Genes 2021, 12, 866. https://doi.org/10.3390/genes12060866
Hoffmann P, Lamerz D, Hill P, Kirchner M, Gauss A. Gene Polymorphisms of NOD2, IL23R, PTPN2 and ATG16L1 in Patients with Crohn’s Disease: On the Way to Personalized Medicine? Genes. 2021; 12(6):866. https://doi.org/10.3390/genes12060866
Chicago/Turabian StyleHoffmann, Peter, David Lamerz, Petra Hill, Marietta Kirchner, and Annika Gauss. 2021. "Gene Polymorphisms of NOD2, IL23R, PTPN2 and ATG16L1 in Patients with Crohn’s Disease: On the Way to Personalized Medicine?" Genes 12, no. 6: 866. https://doi.org/10.3390/genes12060866