LncRNA FENDRR Expression Correlates with Tumor Immunogenicity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. In Vivo B16F10 Melanoma and C26 Colon Carcinoma Mouse Models
2.3. Evaluation of Intratumoral Immune Cell Population by Flow Cytometry
2.4. LncRNA FENDRR Overexpression in B16F10 Cancer Cells
2.5. Smart Pool Small Interfering RNA (siRNA) LncRNA FENDRR Downregulation in C26 Cancer Cells
2.6. Western Blotting Analysis of Proliferating Cell Nuclear Antigen (PCNA), Canonical NF-κB, and WNT Signaling Pathway
2.7. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) for Evaluation of Cytokine Expression in Cancer Cells and Tumor Tissues
2.8. Evaluation of Pro-Inflammatory Cytokines by ELISA
2.9. Statistical Analysis
3. Results
3.1. FENDRR Expression Correlates with Cancer Cell Immunogenicity
3.2. Enhanced FENDRR Expression Is Associated with Immune Cell Infiltration and Pro-Inflammatory Cytokine Expression in Tumors
3.3. FENDRR Overexpression Reverses Proliferation Rates to Inhibit B16F10 Melanoma Growth Rates
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Genes | Mouse Primer Sequence | |
---|---|---|
Gapdh | Forward | CATCACTGCCACCCAGAAGACTG |
Reverse | ATGCCAGTGAGCTTCCCGTTCAG | |
Fendrr | Forward | CACGATCCCAGGTGGACTTG |
Reverse | TGCAGGAGTGAAGGGTGTCTCT | |
Tnfα | Forward | CACCACCATCAAGGACTCAA |
Reverse | AGGCAACCTGACCACTCTCC | |
Il1β | Forward | TGGACCTTCCAGGATGAGGACA |
Reverse | GTTCATCTCGGAGCCTGTAGTG | |
Ccl2 | Forward | GCTACAAGAGGATCACCAGCAG |
Reverse | GTCTGGACCCATTCCTTCTTGG | |
Cxcl10 | Forward | ATCATCCCTGCGAGCCTATCCT |
Reverse | GACCTTTTTTGGCTAAACGCTTTC | |
Ifnγ | Forward | CAGCAACAGCAAGGCGAAAAAGG |
Reverse | TTTCCGCTTCCTGAGGCTGGAT | |
Ki67 | Forward | CCTTTGCTGTCCCCGAAGA |
Reverse | GGCTTCTCATCTGTTGCTTCCT |
References
- Rinn, J.L.; Chang, H.Y. Genome Regulation by Long Noncoding RNAs. Annu. Rev. Biochem. 2012, 81, 145–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, G.; Tang, Q.; Sharma, S.; Yu, F.; Escobar, T.M.; A Muljo, S.; Zhu, J.; Zhao, K. Expression and regulation of intergenic long noncoding RNAs during T cell development and differentiation. Nat. Immunol. 2013, 14, 1190–1198. [Google Scholar] [CrossRef] [Green Version]
- Amaral, P.D.P.; Dinger, M.; Mattick, J.S. Non-coding RNAs in homeostasis, disease and stress responses: An evolutionary perspective. Brief. Funct. Genom. 2013, 12, 254–278. [Google Scholar] [CrossRef] [Green Version]
- Nagano, T.; Fraser, P. No-Nonsense Functions for Long Noncoding RNAs. Cell 2011, 145, 178–181. [Google Scholar] [CrossRef] [Green Version]
- Batista, P.J.; Chang, H.Y. Long Noncoding RNAs: Cellular Address Codes in Development and Disease. Cell 2013, 152, 1298–1307. [Google Scholar] [CrossRef] [Green Version]
- Zhang, G.; Han, G.; Zhang, X.; Yu, Q.; Li, Z.; Li, Z.; Li, J. Long non-coding RNA FENDRR reduces prostate cancer malignancy by competitively binding miR-18a-5p with RUNX1. Biomarkers 2018, 23, 435–445. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, W.; Liu, P.; Xu, Y.; Tang, L.; Chen, W.; Guan, X. Long non-coding RNA FENDRR inhibits cell proliferation and is associated with good prognosis in breast cancer. Onco Targets Ther. 2018, 11, 1403–1412. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kun-Peng, Z.; Xiao-Long, M.; Chun-Lin, Z. LncRNA FENDRR sensitizes doxorubicin-resistance of osteosarcoma cells through down-regulating ABCB1 and ABCC1. Oncotarget 2017, 8, 71881–71893. [Google Scholar] [CrossRef] [Green Version]
- Miao, L.; Huang, Z.; Zengli, Z.; Li, H.; Chen, Q.; Yao, C.; Cai, H.; Xiao, Y.; Xia, H.; Wang, Y. Loss of long noncoding RNA FOXF1-AS1 regulates epithelial-mesenchymal transition, stemness and metastasis of non-small cell lung cancer cells. Oncotarget 2016, 7, 68339–68349. [Google Scholar] [CrossRef]
- Xu, T.-P.; Huang, M.-D.; Xia, R.; Liu, X.-X.; Sun, M.; Yin, L.; Chen, W.-M.; Han, L.; Zhang, E.-B.; Kong, R.; et al. Decreased expression of the long non-coding RNA FENDRR is associated with poor prognosis in gastric cancer and FENDRR regulates gastric cancer cell metastasis by affecting fibronectin1 expression. J. Hematol. Oncol. 2014, 7, 63. [Google Scholar] [CrossRef] [PubMed]
- Khalil, A.M.; Guttman, M.; Huarte, M.; Garber, M.; Raj, A.; Morales, D.R.; Thomas, K.; Presser, A.; Bernstein, B.E.; van Oudenaarden, A.; et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc. Natl. Acad. Sci. USA 2009, 106, 11667–11672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grote, P.; Herrmann, B.G. The long non-coding RNA Fendrr links epigenetic control mechanisms to gene regulatory networks in mammalian embryogenesis. RNA Biol. 2013, 10, 1579–1585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagarsheth, N.; Peng, D.; Kryczek, I.; Wu, K.; Li, W.; Zhao, E.; Zhao, L.; Wei, S.; Frankel, T.; Vatan, L.; et al. PRC2 Epigenetically Silences Th1-Type Chemokines to Suppress Effector T-Cell Trafficking in Colon Cancer. Cancer Res. 2016, 76, 275–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klunker, S.; Chong, M.; Mantel, P.-Y.; Palomares, O.; Bassin, C.; Ziegler, M.; Rückert, B.; Meiler, F.; Akdis, M.; Littman, D.R.; et al. Transcription factors RUNX1 and RUNX3 in the induction and suppressive function of Foxp3+ inducible regulatory T cells. J. Exp. Med. 2009, 206, 2701–2715. [Google Scholar] [CrossRef] [Green Version]
- Uchino, R. Domain analyses of the Runx1 transcription factor responsible for modulating T-cell receptor-β/CD4 and interleukin-4/interferon-γ expression in CD4+peripheral T lymphocytes. Immunology 2009, 128, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Zhao, H.; Feng, X.; Li, H.; Qiu, C.; Yi, X.; Tang, H.; Zhang, J. Long Non-coding RNA FENDRR Acts as a miR-423-5p Sponge to Suppress the Treg-Mediated Immune Escape of Hepatocellular Carcinoma Cells. Mol. Ther. Nucleic Acids 2019, 17, 516–529. [Google Scholar] [CrossRef] [Green Version]
- Lechner, M.G.; Karimi, S.S.; Barry-Holson, K.; Angell, T.; Murphy, K.; Church, C.H.; Ohlfest, J.R.; Hu, P.; Epstein, A.L. Immunogenicity of Murine Solid Tumor Models as a Defining Feature of In Vivo Behavior and Response to Immunotherapy. J. Immunother. 2013, 36, 477–489. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellone, M.; Cantarella, D.; Castiglioni, P.; Crosti, M.C.; Ronchetti, A.; Moro, M.; Garancini, M.P.; Casorati, G.; Dellabona, P. Relevance of the Tumor Antigen in the Validation of Three Vaccination Strategies for Melanoma. J. Immunol. 2000, 165, 2651–2656. [Google Scholar] [CrossRef] [Green Version]
- Bloom, M.; Perry-Lalley, D.; Robbins, P.F.; Li, Y.; El-Gamil, M.; Rosenberg, S.A.; Yang, J.C. Identification of Tyrosinase-related Protein 2 as a Tumor Rejection Antigen for the B16 Melanoma. J. Exp. Med. 1997, 185, 453–460. [Google Scholar] [CrossRef] [Green Version]
- Kaplanov, I.; Carmi, Y.; Kornetsky, R.; Shemesh, A.; Shurin, G.V.; Shurin, M.R.; Dinarello, C.A.; Voronov, E.; Apte, R.N. Blocking IL-1β reverses the immunosuppression in mouse breast cancer and synergizes with anti–PD-1 for tumor abrogation. Proc. Natl. Acad. Sci. USA 2019, 116, 1361–1369. [Google Scholar] [CrossRef] [Green Version]
- Clark, J.; Vagenas, P.; Panesar, M.; Cope, A.P. What does tumour necrosis factor excess do to the immune system long term? Ann. Rheum. Dis. 2005, 64, iv70–iv76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shiokawa, D.; Sato, A.; Ohata, H.; Mutoh, M.; Sekine, S.; Kato, M.; Shibata, T.; Nakagama, H.; Okamoto, K. The Induction of Selected Wnt Target Genes by Tcf1 Mediates Generation of Tumorigenic Colon Stem Cells. Cell Rep. 2017, 19, 981–994. [Google Scholar] [CrossRef] [Green Version]
- Brown, K.; Yang, P.; Salvador, D.; Kulikauskas, R.; Ruohola-Baker, H.; Robitaille, A.M.; Chien, A.J.; Moon, R.T.; Sherwood, V. WNT/β-catenin signaling regulates mitochondrial activity to alter the oncogenic potential of melanoma in a PTEN-dependent manner. Oncogene 2017, 36, 3119–3136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ben-Izhak, O.; Bar-Chana, M.; Sussman, L.; Dobiner, V.; Sandbank, J.; Cagnano, M.; Cohen, H.; Sabo, E. Ki67 antigen and PCNA proliferation markers predict survival in anorectal malignant melanoma. Histopathology 2002, 41, 519–525. [Google Scholar] [CrossRef]
- Lin, X.; Sun, R.; Zhao, X.; Zhu, D.; Zhao, X.; Gu, Q.; Dong, X.; Zhang, D.; Zhang, Y.; Li, Y.; et al. C-myc overexpression drives melanoma metastasis by promoting vasculogenic mimicry via c-myc/snail/Bax signaling. J. Mol. Med. 2016, 95, 53–67. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Munteanu, M.C.; Sethuraman, S.N.; Singh, M.P.; Malayer, J.; Ranjan, A. LncRNA FENDRR Expression Correlates with Tumor Immunogenicity. Genes 2021, 12, 897. https://doi.org/10.3390/genes12060897
Munteanu MC, Sethuraman SN, Singh MP, Malayer J, Ranjan A. LncRNA FENDRR Expression Correlates with Tumor Immunogenicity. Genes. 2021; 12(6):897. https://doi.org/10.3390/genes12060897
Chicago/Turabian StyleMunteanu, Maria Cristina, Sri Nandhini Sethuraman, Mohit Pratap Singh, Jerry Malayer, and Ashish Ranjan. 2021. "LncRNA FENDRR Expression Correlates with Tumor Immunogenicity" Genes 12, no. 6: 897. https://doi.org/10.3390/genes12060897