Characterization of CRH-Binding Protein (CRHBP) in Chickens: Molecular Cloning, Tissue Distribution and Investigation of Its Role as a Negative Feedback Regulator within the Hypothalamus–Pituitary–Adrenal Axis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Chemicals, Primers, Peptides, Antibodies and Animals
2.3. Total RNA Extraction, Reverse Transcription and Quantitative Real-Time PCR Assay
2.4. Cloning, Sequence Alignment and Synteny Analysis of Chicken CRHBP
2.5. Tissue Expression Analysis of Chicken CRHBP Using RNA-seq Data
2.6. Generation of Chicken CRHBP Conditioned Medium
2.7. Effect of Chicken CRHBP on the Signaling of CRHRs Induced by cCRH in Chinese Hamster Ovary (CHO) Cells
2.8. Effect of Chicken CRHBP on the ACTH Secretion Induced by CRH in Cultured Chick Pituitary Cells
2.9. Effect of Dexamethasone (DEX) on CRHBP mRNA Expression in Chickens
2.10. Effect of Stress on CRHBP mRNA Expression in Chickens
2.11. Data Analysis
3. Results
3.1. Cloning, Sequence Alignment and Synteny Analysis of Chicken CRHBP
3.2. Tissue Expression of CRHBP in Adult Chickens
3.3. Functional Analyses of Chicken CRHBP
3.4. Effects of CRHBP on ACTH Secretion in Cultured Chick Pituitary Cells
3.5. The Expression Regulation of CRHBP mRNA by DEX and Stress in Chickens
4. Discussion
4.1. CRHBP Is Conserved between Chickens and Other Vertebrate Species
4.2. CRHBP Is Widely Expressed in Chicken Tissues
4.3. CRHBP Affects the Signaling of cCRHRs in CHO Cells
4.4. CRHBP Is a Negative Feedback Regulator in HPA Axis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gallo-Payet, N. 60 years of POMC: Adrenal and extra-adrenal functions of ACTH. J. Mol. Endocrinol. 2016, 56, T135–T156. [Google Scholar] [CrossRef]
- Ruggiero, C.; Lalli, E. Impact of ACTH signaling on transcriptional regulation of steroidogenic genes. Front. Endocrinol. 2016, 7, 24. [Google Scholar] [CrossRef] [PubMed]
- Novoselova, T.V.; King, P.J.; Guasti, L.; Metherell, L.A.; Clark, A.J.; Chan, L.F. ACTH signalling and adrenal development: Lessons from mouse models. Endocr. Connect. 2019, 8, R122–R130. [Google Scholar] [CrossRef]
- Aguilera, G. Regulation of pituitary ACTH secretion during chronic stress. Front. Neuroendocrinol. 1994, 15, 321–350. [Google Scholar] [CrossRef]
- Tsigos, C.; Chrousos, G.P. Hypothalamic–pituitary–adrenal axis, neuroendocrine factors and stress. J. Psychosom. Res. 2002, 53, 865–871. [Google Scholar] [CrossRef]
- Volpi, S.; Rabadan-Diehl, C.; Aguilera, G. Vasopressinergic regulation of the hypothalamic pituitary adrenal axis and stress adaptation. Stress 2004, 7, 75–83. [Google Scholar] [CrossRef]
- Vale, W.; Spiess, J.; Rivier, C.; Rivier, J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and β-endorphin. Science 1981, 213, 1394–1397. [Google Scholar] [CrossRef]
- Antoni, F.A. Hypothalamic control of adrenocorticotropin secretion: Advances since the discovery of 41-residue corticotropin-releasing factor. Endocr. Rev. 1986, 7, 351–378. [Google Scholar] [CrossRef]
- Timpl, P.; Spanagel, R.; Sillaber, I.; Kresse, A.; Reul, J.M.; Stalla, G.K.; Blanquet, V.; Steckler, T.; Holsboer, F.; Wurst, W. Impaired stress response and reduced anxiety in mice lacking a functional corticotropin-releasing hormone receptor 1. Nat. Genet. 1998, 19, 162–166. [Google Scholar] [CrossRef]
- Liu, M.; Bu, G.; Wan, Y.; Zhang, J.; Mo, C.; Li, J.; Wang, Y. Evidence for Neuropeptide W Acting as a Physiological Corticotropin-releasing Inhibitory Factor in Male Chickens. Endocrinology 2022, 163, bqac073. [Google Scholar] [CrossRef]
- Westphal, N.J.; Seasholtz, A.F. CRH-BP: The regulation and function of a phylogenetically conserved binding protein. Front. Biosci. 2006, 11, 1878–1891. [Google Scholar] [CrossRef]
- Ketchesin, K.D.; Stinnett, G.S.; Seasholtz, A.F. Corticotropin-releasing hormone-binding protein and stress: From invertebrates to humans. Stress 2017, 20, 449–464. [Google Scholar] [CrossRef]
- Eckart, K.; Jahn, O.; Radulovic, J.; Tezval, H.; Van Werven, L.; Spiess, J. A single amino acid serves as an affinity switch between the receptor and the binding protein of corticotropin-releasing factor: Implications for the design of agonists and antagonists. Proc. Natl. Acad. Sci. USA 2001, 98, 11142–11147. [Google Scholar] [CrossRef]
- Jahn, O.; Tezval, H.; van Werven, L.; Eckart, K.; Spiess, J. Three-amino acid motifs of urocortin II and III determine their CRF receptor subtype selectivity. Neuropharmacology 2004, 47, 233–242. [Google Scholar] [CrossRef]
- Huising, M.O.; Vaughan, J.M.; Shah, S.H.; Grillot, K.L.; Donaldson, C.J.; Rivier, J.; Flik, G.; Vale, W.W. Residues of corticotropin releasing factor-binding protein (CRF-BP) that selectively abrogate binding to CRF but not to urocortin 1. J. Biol. Chem. 2008, 283, 8902–8912. [Google Scholar] [CrossRef]
- Potter, E.; Behan, D.; Fischer, W.; Linton, E.; Lowry, P.; Vale, W. Cloning and characterization of the cDNAs for human and rat corticotropin releasing factor-binding proteins. Nature 1991, 349, 423–426. [Google Scholar] [CrossRef]
- Sutton, S.W.; Behan, D.P.; Lahrichi, S.L.; Kaiser, R.; Corrigan, A.; Lowry, P.; Potter, E.; Perrin, M.H.; Rivier, J.; Vale, W.W. Ligand requirements of the human corticotropin-releasing factor-binding protein. Endocrinology 1995, 136, 1097–1102. [Google Scholar] [CrossRef]
- Cortright, D.N.; Nicoletti, A.; Seasholtz, A.F. Molecular and biochemical characterization of the mouse brain corticotropin-releasing hormone-binding protein. Mol. Cell. Endocrinol. 1995, 111, 147–157. [Google Scholar] [CrossRef]
- Burrows, H.L.; Nakajima, M.; Lesh, J.S.; Goosens, K.A.; Samuelson, L.C.; Inui, A.; Camper, S.A.; Seasholtz, A.F. Excess corticotropin releasing hormone-binding protein in the hypothalamic-pituitary-adrenal axis in transgenic mice. J. Clin. Investig. 1998, 101, 1439–1447. [Google Scholar] [CrossRef]
- Seasholtz, A.F.; Burrows, H.L.; Karolyi, I.J.; Camper, S.A. Mouse models of altered CRH-binding protein expression. Peptides 2001, 22, 743–751. [Google Scholar] [CrossRef]
- Karolyi, I.J.; Burrows, H.L.; Ramesh, T.M.; Nakajima, M.; Lesh, J.S.; Seong, E.; Camper, S.A.; Seasholtz, A.F. Altered anxiety and weight gain in corticotropin-releasing hormone-binding protein-deficient mice. Proc. Natl. Acad. Sci. USA 1999, 96, 11595–11600. [Google Scholar] [CrossRef]
- Behan, D.P.; Cepoi, D.; Fischer, W.H.; Park, M.; Sutton, S.; Lowry, P.J.; Vale, W.W. Characterization of a sheep brain corticotropin releasing factor binding protein. Brain Res. 1996, 709, 265–274. [Google Scholar] [CrossRef]
- Valverde, R.A.; Seasholtz, A.F.; Cortright, D.N.; Denver, R.J. Biochemical characterization and expression analysis of the Xenopus laevis corticotropin-releasing hormone binding protein. Mol. Cell. Endocrinol. 2001, 173, 29–40. [Google Scholar] [CrossRef]
- Ketchesin, K.D.; Huang, N.S.; Seasholtz, A.F. Cell Type-Specific Expression of Corticotropin-Releasing Hormone-Binding Protein in GABAergic Interneurons in the Prefrontal Cortex. Front. Neuroanat. 2017, 11, 90. [Google Scholar] [CrossRef]
- Herringa, R.J.; Nanda, S.A.; Hsu, D.T.; Roseboom, P.H.; Kalin, N.H. The effects of acute stress on the regulation of central and basolateral amygdala CRF-binding protein gene expression. Mol. Brain. Res. 2004, 131, 17–25. [Google Scholar] [CrossRef]
- Potter, E.; Behan, D.P.; Linton, E.A.; Lowry, P.J.; Sawchenko, P.E.; Vale, W.W. The central distribution of a corticotropin-releasing factor (CRF)-binding protein predicts multiple sites and modes of interaction with CRF. Proc. Natl. Acad. Sci. USA 1992, 89, 4192–4196. [Google Scholar] [CrossRef]
- Wang, H.L.; Morales, M. Corticotropin-releasing factor binding protein within the ventral tegmental area is expressed in a subset of dopaminergic neurons. J. Comp. Neurol. 2008, 509, 302–318. [Google Scholar] [CrossRef]
- Henry, B.A.; Lightman, S.L.; Lowry, C.A. Distribution of Corticotropin-Releasing Factor Binding Protein-Immunoreactivity in the Rat Hypothalamus: Association with Corticotropin-Releasing Factor-, Urocortin 1-and Vimentin-Immunoreactive Fibres. J. Neuroendocrinol. 2005, 17, 135–144. [Google Scholar] [CrossRef]
- Peto, C.A.; Arias, C.; Vale, W.W.; Sawchenko, P.E. Ultrastructural localization of the corticotropin-releasing factor–binding protein in rat brain and pituitary. J. Comp. Neurol. 1999, 413, 241–254. [Google Scholar] [CrossRef]
- Speert, D.B.; McClennen, S.J.; Seasholtz, A.F. Sexually dimorphic expression of corticotropin-releasing hormone-binding protein in the mouse pituitary. Endocrinology 2002, 143, 4730–4741. [Google Scholar] [CrossRef] [Green Version]
- Fang, C.; Zhang, J.; Wan, Y.; Li, Z.; Qi, F.; Dang, Y.; Li, J.; Wang, Y. Neuropeptide S (NPS) and its receptor (NPSR1) in chickens: Cloning, tissue expression, and functional analysis. Poult. Sci. 2021, 100, 101445. [Google Scholar] [CrossRef]
- Bu, G.; Lin, D.; Cui, L.; Huang, L.; Lv, C.; Huang, S.; Wan, Y.; Fang, C.; Li, J.; Wang, Y. Characterization of neuropeptide B (NPB), neuropeptide W (NPW), and their receptors in chickens: Evidence for NPW being a novel inhibitor of pituitary GH and prolactin secretion. Endocrinology 2016, 157, 3562–3576. [Google Scholar] [CrossRef]
- Nguyen, N.T.T.; Vincens, P.; Dufayard, J.F.; Roest Crollius, H.; Louis, A. Genomicus in 2022: Comparative tools for thousands of genomes and reconstructed ancestors. Nucleic Acids Res. 2022, 50, D1025–D1031. [Google Scholar] [CrossRef]
- Merkin, J.; Russell, C.; Chen, P.; Burge, C.B. Evolutionary dynamics of gene and isoform regulation in Mammalian tissues. Science 2012, 338, 1593–1599. [Google Scholar] [CrossRef]
- Cardoso-Moreira, M.; Halbert, J.; Valloton, D.; Velten, B.; Chen, C.; Shao, Y.; Liechti, A.; Ascenção, K.; Rummel, C.; Ovchinnikova, S. Gene expression across mammalian organ development. Nature 2019, 571, 505–509. [Google Scholar] [CrossRef]
- Bu, G.; Fan, J.; Yang, M.; Lv, C.; Lin, Y.; Li, J.; Meng, F.; Du, X.; Zeng, X.; Zhang, J. Identification of a novel functional corticotropin-releasing hormone (CRH2) in chickens and its roles in stimulating pituitary TSHβ expression and ACTH Secretion. Front. Endocrinol. 2019, 10, 595. [Google Scholar] [CrossRef]
- Cui, L.; Lv, C.; Zhang, J.; Li, J.; Wang, Y. Characterization of four urotensin II receptors (UTS2Rs) in chickens. Peptides 2021, 138, 170482. [Google Scholar] [CrossRef]
- Mo, C.; Cai, G.; Huang, L.; Deng, Q.; Lin, D.; Cui, L.; Wang, Y.; Li, J. Corticotropin-releasing hormone (CRH) stimulates cocaine-and amphetamine-regulated transcript gene (CART1) expression through CRH type 1 receptor (CRHR1) in chicken anterior pituitary. Mol. Cell. Endocrinol. 2015, 417, 166–177. [Google Scholar] [CrossRef]
- Wu, C.; Lv, C.; Wan, Y.; Li, X.; Zhang, J.; Li, J.; Wang, Y. Arginine vasotocin (AVT)/mesotocin (MT) receptors in chickens: Evidence for the possible involvement of AVT-AVPR1 signaling in the regulation of oviposition and pituitary prolactin expression. Gen. Comp. Endocrinol. 2019, 281, 91–104. [Google Scholar] [CrossRef]
- Doyon, C.; Trudeau, V.; Moon, T. Stress elevates corticotropin-releasing factor (CRF) and CRF-binding protein mRNA levels in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 2005, 186, 123–130. [Google Scholar] [CrossRef] [Green Version]
- Huising, M.; Van Schooten, C.; Taverne-Thiele, A.; Hermsen, T.; Verburg-van Kemenade, B.; Flik, G. Structural characterisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins in the acute stress response. J. Mol. Endocrinol. 2004, 32, 627–648. [Google Scholar] [CrossRef]
- Behan, D.; Linton, E.; Lowry, P. Isolation of the human plasma corticotrophin-releasing factor-binding protein. J. Endocrinol. 1989, 122, 23–31. [Google Scholar] [CrossRef]
- Nicolaides, N.C.; Kyratzi, E.; Lamprokostopoulou, A.; Chrousos, G.P.; Charmandari, E. Stress, the stress system and the role of glucocorticoids. Neuroimmunomodulation 2015, 22, 6–19. [Google Scholar] [CrossRef]
- Suda, T.; Sumitomo, T.; Tozawa, F.; Ushiyama, T.; Demura, H. Corticotropin-releasing factor-binding protein is a glycoprotein. Biochem. Biophys. Res. Commun. 1989, 165, 703–707. [Google Scholar] [CrossRef]
- Jahn, O.; Eckart, K.; Brauns, O.; Tezval, H.; Spiess, J. The binding protein of corticotropin-releasing factor: Ligand-binding site and subunit structure. Proc. Natl. Acad. Sci. USA 2002, 99, 12055–12060. [Google Scholar] [CrossRef]
- Chan, R.; Vale, W.; Sawchenko, P. Paradoxical activational effects of a corticotropin-releasing factor-binding protein “ligand inhibitor” in rat brain. Neuroscience 2000, 101, 115–129. [Google Scholar] [CrossRef]
- Alderman, S.L.; Bernier, N.J. Localization of corticotropin-releasing factor, urotensin I, and CRF-binding protein gene expression in the brain of the zebrafish, Danio rerio. J. Comp. Neurol. 2007, 502, 783–793. [Google Scholar] [CrossRef]
- Ketchesin, K.D.; Stinnett, G.S.; Seasholtz, A.F. Binge drinking decreases corticotropin-releasing factor-binding protein expression in the medial prefrontal cortex of mice. Alcohol. Clin. Exp. Res. 2016, 40, 1641–1650. [Google Scholar] [CrossRef] [PubMed]
- Vandael, D.; Gounko, N.V. Corticotropin releasing factor-binding protein (CRF-BP) as a potential new therapeutic target in Alzheimer’s disease and stress disorders. Transl. Psychiatry 2019, 9, 272. [Google Scholar] [CrossRef]
- Stinnett, G.S.; Westphal, N.J.; Seasholtz, A.F. Pituitary CRH-binding protein and stress in female mice. Physiol. Behav. 2015, 150, 16–23. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Lv, C.; Mo, C.; Liu, M.; Wan, Y.; Li, J.; Wang, Y. Single-Cell RNA Sequencing Analysis of Chicken Anterior Pituitary: A Bird’s-Eye View on Vertebrate Pituitary. Front. Physiol. 2021, 12, 562817. [Google Scholar] [CrossRef]
- Asakura, H.; Zwain, I.; Yen, S. Expression of genes encoding corticotropin-releasing factor (CRF), type 1 CRF receptor, and CRF-binding protein and localization of the gene products in the human ovary. J. Clin. Endocrinol. Metab. 1997, 82, 2720–2725. [Google Scholar] [CrossRef]
- Xu, J.; Hennebold, J.D.; Stouffer, R.L. Dynamic expression and regulation of the corticotropin-releasing hormone/urocortin-receptor-binding protein system in the primate ovary during the menstrual cycle. J. Clin. Endocrinol. Metab. 2006, 91, 1544–1553. [Google Scholar] [CrossRef] [PubMed]
- Petraglia, F.; Potter, E.; Cameron, V.; Sutton, S.; Behan, D.; Woods, R.; Sawchenko, P.; Lowry, P.; Vale, W. Corticotropin-releasing factor-binding protein is produced by human placenta and intrauterine tissues. J. Clin. Endocrinol. Metab. 1993, 77, 919–924. [Google Scholar] [CrossRef]
- McLean, M.; Bisits, A.; Davies, J.; Woods, R.; Lowry, P.; Smith, R. A placental clock controlling the length of human pregnancy. Nat. Med. 1995, 1, 460–463. [Google Scholar] [CrossRef]
- Manuel, R.; Metz, J.R.; Flik, G.; Vale, W.W.; Huising, M.O. Corticotropin-releasing factor-binding protein (CRF-BP) inhibits CRF-and urotensin-I-mediated activation of CRF receptor-1 and-2 in common carp. Gen. Comp. Endocrinol. 2014, 202, 69–75. [Google Scholar] [CrossRef]
- De Groef, B.; Goris, N.; Arckens, L.; Kühn, E.R.; Darras, V.M. Corticotropin-releasing hormone (CRH)-induced thyrotropin release is directly mediated through CRH receptor type 2 on thyrotropes. Endocrinology 2003, 144, 5537–5544. [Google Scholar] [CrossRef]
- De Groef, B.; Van der Geyten, S.; Darras, V.M.; Kühn, E.R. Role of corticotropin-releasing hormone as a thyrotropin-releasing factor in non-mammalian vertebrates. Gen. Comp. Endocr. 2006, 146, 62–68. [Google Scholar] [CrossRef]
- Ungless, M.A.; Singh, V.; Crowder, T.L.; Yaka, R.; Ron, D.; Bonci, A. Corticotropin-releasing factor requires CRF binding protein to potentiate NMDA receptors via CRF receptor 2 in dopamine neurons. Neuron 2003, 39, 401–407. [Google Scholar] [CrossRef]
- Wang, B.; You, Z.-B.; Rice, K.C.; Wise, R.A. Stress-induced relapse to cocaine seeking: Roles for the CRF 2 receptor and CRF-binding protein in the ventral tegmental area of the rat. Psychopharmacology 2007, 193, 283–294. [Google Scholar] [CrossRef]
- Albrechet-Souza, L.; Hwa, L.S.; Han, X.; Zhang, E.Y.; DeBold, J.F.; Miczek, K.A. Corticotropin Releasing Factor Binding Protein and CRF2 Receptors in the Ventral Tegmental Area: Modulation of Ethanol Binge Drinking in C 57 BL/6J Mice. Alcohol. Clin. Exp. Res. 2015, 39, 1609–1618. [Google Scholar] [CrossRef]
- Slater, P.G.; Cerda, C.A.; Pereira, L.A.; Andres, M.E.; Gysling, K. CRF binding protein facilitates the presence of CRF type 2α receptor on the cell surface. Proc. Natl. Acad. Sci. USA 2016, 113, 4075–4080. [Google Scholar] [CrossRef] [PubMed]
- Slater, P.G.; Gutierrez-Maldonado, S.E.; Gysling, K.; Lagos, C.F. Molecular modeling of structures and interaction of human corticotropin-releasing factor (CRF) binding protein and CRF Type-2 receptor. Front. Endocrinol. 2018, 9, 43. [Google Scholar] [CrossRef]
- Simpson, E.R. Regulation of the synthesis of steroidogenic enzymes in adrenal cortical cells by ACTH. Annu. Rev. Physiol. 1988, 50, 427–440. [Google Scholar] [CrossRef]
- Drouin, J. 60 YEARS OF POMC: Transcriptional and epigenetic regulation of POMC gene expression. J. Mol. Endocrinol. 2016, 56, T99–T112. [Google Scholar] [CrossRef]
- Keller-Wood, M. Hypothalamic-pituitary-adrenal Axis—Feedback Control. Compr. Physiol. 2011, 5, 1161–1182. [Google Scholar] [CrossRef]
- McClennen, S.J.; Cortright, D.N.; Seasholtz, A.F. Regulation of pituitary corticotropin-releasing hormone-binding protein messenger ribonucleic acid levels by restraint stress and adrenalectomy. Endocrinology 1998, 139, 4435–4441. [Google Scholar] [CrossRef]
- Chrousos, G.P. Stress and disorders of the stress system. Nat. Rev. Endocrinol. 2009, 5, 374–381. [Google Scholar] [CrossRef]
- Kuenzel, W.; Jurkevich, A. Molecular neuroendocrine events during stress in poultry. Poult. Sci. 2010, 89, 832–840. [Google Scholar] [CrossRef]
- Saper, C.B.; Lowell, B.B. The hypothalamus. Curr. Biol. 2014, 24, R1111–R1116. [Google Scholar] [CrossRef] [Green Version]
- Rozenboim, I.; Tako, E.; Gal-Garber, O.; Proudman, J.; Uni, Z. The effect of heat stress on ovarian function of laying hens. Poult. Sci. 2007, 86, 1760–1765. [Google Scholar] [CrossRef]
- Abudabos, A.M.; Samara, E.M.; Hussein, E.O.; Al-Ghadi, M.a.Q.; Al-Atiyat, R.M. Impacts of stocking density on the performance and welfare of broiler chickens. Ital. J. Anim. Sci. 2013, 12, e11. [Google Scholar] [CrossRef]
- Barrett, N.W.; Rowland, K.; Schmidt, C.J.; Lamont, S.J.; Rothschild, M.F.; Ashwell, C.M.; Persia, M.E. Effects of acute and chronic heat stress on the performance, egg quality, body temperature, and blood gas parameters of laying hens. Poult. Sci. 2019, 98, 6684–6692. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Jiang, R.; Su, A.; Tian, H.; Zhang, Y.; Li, W.; Tian, Y.; Li, K.; Sun, G.; Han, R. Identification of genes related to effects of stress on immune function in the spleen in a chicken stress model using transcriptome analysis. Mol. Immunol. 2020, 124, 180–189. [Google Scholar] [CrossRef]
Gene/Construct Name | Sense/ Antisense | Primer Sequence (5′–3′) | Size (bp) | Accession Number |
---|---|---|---|---|
Primers used for cloning of CDS b | ||||
CRHBP | Sense | CCCAAGCTTCTCCCAACTGCTCTATA | 1071 | OP259501 |
Antisense | CGGGGTACCTCAGATACCAGGGAAGC | |||
Primers used for quantitative real-time RT-PCR assay | ||||
CRHBP | Sense | CGCCACATTCTTCATCGGTG | 216 | OP259501 |
Antisense | GATGACCTGATGCTCCTCTG | |||
β-actin | Sense | CCCAGACATCAGGGTGTGATG | 123 | L08165.1 |
Antisense | GTTGGTGACAATACCGTGTTCAAT | |||
Primers for construction of the expression plasmids b | ||||
CRHBP-His | Sense | AGTCCAGTGTGGTGGAATTCCTGAAGATGCCCCGGCGGCT | 1056 | |
Antisense | TCAATGATGATGATGATGATGGATACCAGGGAAGCAGAAT | |||
Antisense | CTGGATATCTGCAGAATTCTCAATGATGATGATGATGATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wan, Y.; Zhang, Z.; Lin, D.; Wang, X.; Huang, T.; Su, J.; Zhang, J.; Li, J.; Wang, Y. Characterization of CRH-Binding Protein (CRHBP) in Chickens: Molecular Cloning, Tissue Distribution and Investigation of Its Role as a Negative Feedback Regulator within the Hypothalamus–Pituitary–Adrenal Axis. Genes 2022, 13, 1680. https://doi.org/10.3390/genes13101680
Wan Y, Zhang Z, Lin D, Wang X, Huang T, Su J, Zhang J, Li J, Wang Y. Characterization of CRH-Binding Protein (CRHBP) in Chickens: Molecular Cloning, Tissue Distribution and Investigation of Its Role as a Negative Feedback Regulator within the Hypothalamus–Pituitary–Adrenal Axis. Genes. 2022; 13(10):1680. https://doi.org/10.3390/genes13101680
Chicago/Turabian StyleWan, Yiping, Zheng Zhang, Dongliang Lin, Xinglong Wang, Tianjiao Huang, Jiancheng Su, Jiannan Zhang, Juan Li, and Yajun Wang. 2022. "Characterization of CRH-Binding Protein (CRHBP) in Chickens: Molecular Cloning, Tissue Distribution and Investigation of Its Role as a Negative Feedback Regulator within the Hypothalamus–Pituitary–Adrenal Axis" Genes 13, no. 10: 1680. https://doi.org/10.3390/genes13101680