The TRIM25 Gene in Ducks: Cloning, Characterization and Antiviral Immune Response
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and RNA Extraction
2.2. DuTRIM25 cDNA Cloning and Sequence Analysis
2.3. Cell Culture and Virus Strain
2.4. Plasmid Construction
2.5. Luciferase Reporter Assay
2.6. Real-Time Quantitative PCR (RT-qPCR)
2.7. Western Blotting Analysis
2.8. Statistical Analysis
3. Results
3.1. Sequence Analysis of Duck TRIM25
3.2. The Response to Different Stimulations on Duck TRIM25 Transcription Levels
3.3. The Spatiotemporal Expression Profile of TRIM25 in Ducks
3.4. Functional Analysis of the Induction of IFN-β by duTRIM25 and Its Different Domains
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hatziioannou, T.; Perez-Caballero, D.; Yang, A.; Cowan, S.; Bieniasz, P.D. Retrovirus resistance factors Ref1 and Lv1 are species-specific variants of TRIM5alpha. Proc. Natl. Acad. Sci. USA 2004, 101, 10774–10779. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Keckesova, Z.; Ylinen, L.M.; Towers, G.J. The human and African green monkey TRIM5alpha genes encode Ref1 and Lv1 retroviral restriction factor activities. Proc. Natl. Acad. Sci. USA 2004, 101, 10780–10785. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stremlau, M.; Perron, M.; Welikala, S.; Sodroski, J. Species-specific variation in the B30.2(SPRY) domain of TRIM5alpha determines the potency of human immunodeficiency virus restriction. J. Virol. 2005, 79, 3139–3145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, J.R.; Liu, J.H.; Li, H.M.; Zhao, Y.; Cheng, Z.Q.; Hou, Y.M.; Guo, H.J. Regulatory effects of chicken TRIM25 on the replication of ALV-A and the MDA5-mediated type I interferon response. Vet. Res. 2020, 51, 145. [Google Scholar] [CrossRef]
- Rajsbaum, R.; Garcia-Sastre, A.; Versteeg, G.A. TRIMmunity: The roles of the TRIM E3-ubiquitin ligase family in innate antiviral immunity. J. Mol. Biol. 2014, 426, 1265–1284. [Google Scholar] [CrossRef] [Green Version]
- Meroni, G.; Diez-Roux, G. TRIM/RBCC, a novel class of ‘single protein RING finger’ E3 ubiquitin ligases. BioEssays News Rev. Mol. Cell. Dev. Biol. 2005, 27, 1147–1157. [Google Scholar] [CrossRef]
- Kallijarvi, J.; Lahtinen, U.; Hamalainen, R.; Lipsanen-Nyman, M.; Palvimo, J.J.; Lehesjoki, A.E. TRIM37 defective in mulibrey nanism is a novel RING finger ubiquitin E3 ligase. Exp. Cell Res. 2005, 308, 146–155. [Google Scholar] [CrossRef]
- Barr, S.D.; Smiley, J.R.; Bushman, F.D. The interferon response inhibits HIV particle production by induction of TRIM22. PLoS Pathog. 2008, 4, e1000007. [Google Scholar] [CrossRef] [Green Version]
- Peng, C.; Zhao, C.; Wang, P.F.; Yan, L.L.; Fan, S.G.; Qiu, L.H. Identification of a TRIM32 from Penaeus monodon is involved in autophagy and innate immunity during white spot syndrome virus infection. Dev. Comp. Immunol. 2021, 123, 104169. [Google Scholar] [CrossRef]
- Uchil, P.D.; Quinlan, B.D.; Chan, W.T.; Luna, J.M.; Mothes, W. TRIM E3 Ligases Interfere with Early and Late Stages of the Retroviral Life Cycle. PLOS Pathog. 2008, 4, e16. [Google Scholar] [CrossRef]
- Nisole, S.; Stoye, J.P.; Saib, A. TRIM family proteins: Retroviral restriction and antiviral defence. Nat. Rev. Microbiol. 2005, 3, 799–808. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Feng, W.; Cheng, Z.; Yang, J.; Bi, J.; Wang, X.; Wang, G. TRIM62-mediated restriction of avian leukosis virus subgroup J replication is dependent on the SPRY domain. Poult. Sci. 2019, 98, 6019–6025. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.H.; Feng, H.P.; Huang, L.R.; Yi, K.; Rong, E.G.; Chen, X.Y.; Li, J.W.; Wang, Z.; Zhu, P.Y.; Liu, X.J.; et al. Transcriptomic analyses reveal new genes and networks response to H5N1 influenza viruses in duck (Anas platyrhynchos). J. Integr. Agric. 2019, 18, 1460–1472. [Google Scholar] [CrossRef]
- Wei, Y.N.; Zhou, H.; Wang, A.; Sun, L.P.; Wang, M.S.; Jia, R.Y.; Zhu, D.K.; Liu, M.F.; Yang, Q.; Wu, Y.; et al. TRIM25 Identification in the Chinese Goose: Gene Structure, Tissue Expression Profiles, and Antiviral Immune Responses In Vivo and In Vitro. BioMed Res. Int. 2016, 2016, 1403984. [Google Scholar] [CrossRef] [Green Version]
- Han, K.K.; Zhao, D.; Liu, Y.; Liu, Q.; Huang, X.; Yang, J.; Zhang, L.; Li, Y. The E3 Ubiquitin Ligase TRIM25 Inhibits Tembusu Virus Replication in vitro. Front. Vet. Sci 2021, 8, 722113. [Google Scholar]
- Gu, T.; Li, G.; Wu, X.; Zeng, T.; Xu, Q.; Li, L.; Vladyslav, S.; Chen, G.; Lu, L. Molecular cloning, tissue distribution and function analysis of duck TLR7. Anim. Biotechnol. 2022, 33, 234–241. [Google Scholar] [CrossRef]
- Gu, T.; Lu, L.; An, C.; Zhang, Y.; Wu, X.; Xu, Q.; Chen, G. Negative regulation of the RLR-mediated IFN signaling pathway by duck ubiquitin-specific protease 18 (USP18). J. Cell. Physiol. 2019, 234, 3995–4004. [Google Scholar] [CrossRef]
- Lin, K.N.; Zhao, W.; Huang, S.Y.; Li, H. Grape seed proanthocyanidin extract induces apoptosis of HL-60/ADR cells via the Bax/Bcl-2 caspase-3/9 signaling pathway. Transl. Cancer Res. 2021, 10, 3939–3947. [Google Scholar] [CrossRef]
- Zhao, K.; Li, L.W.; Jiang, Y.F.; Gao, F.; Zhang, Y.J.; Zhao, W.Y.; Li, G.X.; Yu, L.X.; Zhou, Y.J.; Tong, G.Z. Nucleocapsid protein of porcine reproductive and respiratory syndrome virus antagonizes the antiviral activity of TRIM25 by interfering with TRIM25-mediated RIG-I ubiquitination. Vet. Microbiol. 2019, 233, 140–146. [Google Scholar] [CrossRef] [PubMed]
- Francesca, D.F.; Anna, C.; Ivan, G.; Pellegrino, C.; Valeria, U.; Florinela, C.A.; Sante, R. Bovine Delta Papillomavirus E5 Oncoprotein Interacts with TRIM25 and Hampers Antiviral Innate Immune Response Mediated by RIG-I-Like Receptors. Front. Immunol. 2021, 12, 658762. [Google Scholar]
- Micale, L.; Chaignat, E.; Fusco, C.; Reymond, A.; Merla, G. The tripartite motif: Structure and function. Adv. Exp. Med. Biol. 2012, 770, 11–25. [Google Scholar] [PubMed]
- Feng, Z.Q.; Cheng, Y.; Yang, H.L.; Zhu, Q.; Yu, D.D.; Liu, Y.P. Molecular characterization, tissue distribution and expression analysis of TRIM25 in Gallus gallus domesticus. Gene 2015, 561, 138–147. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Jiao, P.; Jia, B.; Xu, C.; Wei, L.; Shan, F.; Luo, K.; Xin, C.; Zhang, K.; Liao, M. Pathogenicity in quails and mice of H5N1 highly pathogenic avian influenza viruses isolated from ducks. Vet. Microbiol. 2011, 152, 258–265. [Google Scholar] [CrossRef]
- Ou, X.; Mao, S.; Jiang, Y.; Zhang, S.; Ke, C.; Ma, G.; Cheng, A.; Wang, M.; Zhu, D.; Chen, S.; et al. Viral-host interaction in kidney reveals strategies to escape host immunity and persistently shed virus to the urine. Oncotarget 2017, 8, 7336–7349. [Google Scholar] [CrossRef] [Green Version]
- An, Y.; Ni, Y.; Xu, Z.; Shi, S.; Xin, H.B. TRIM59 expression is regulated by Sp1 and Nrf1 in LPS-activated macrophages through JNK signaling pathway. Cell. Signal. 2019, 67, 109522. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.H.; Zhong, M.; Zang, H.L.; Tian, X.F. Mechanism of TRIM25 mediated ubiquitination of metastasis associated protein (MTA) 1 in normal liver cells. Exp. Cell Res. 2018, 371, 250–254. [Google Scholar] [CrossRef] [PubMed]
- Véronique, P.; Andrei, I.; Van Der Ven, P.F.; Raymond, K.; Cristina, F.; Fürst, D.O.; Eric, K.; Mathias, G. Transient association of titin and myosin with microtubules in nascent myofibrils directed by the MURF2 RING-finger protein. J. Cell Sci. 2002, 115, 4469–4482. [Google Scholar]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [Green Version]
- Thompson, M.R.; Kaminski, J.J.; Kurt-Jones, E.A.; Fitzgerald, K.A. Pattern recognition receptors and the innate immune response to viral infection. Viruses 2011, 3, 920–940. [Google Scholar] [CrossRef] [Green Version]
- Kawai, T.; Akira, S. Antiviral signaling through pattern recognition receptors. J. Biochem. 2007, 141, 137–145. [Google Scholar] [CrossRef]
- Uchikawa, E.; Lethier, M.; Malet, H.; Brunel, J.; Gerlier, D.; Cusack, S. Structural Analysis of dsRNA Binding to Anti-viral Pattern Recognition Receptors LGP2 and MDA5. Mol. Cell 2016, 62, 586–602. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowalinski, E.; Lunardi, T.; McCarthy, A.A.; Louber, J.; Brunel, J.; Grigorov, B.; Gerlier, D.; Cusack, S. Structural Basis for the Activation of Innate Immune Pattern-Recognition Receptor RIG-I by Viral RNA. Cell 2011, 147, 423–435. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.D.; Li, L.; Liu, X.P.; Jiang, M.J.; Zhao, J.; Li, X.S.; Zhao, C.; Yi, H.; Liu, S.D.; Li, N. Quantitative Proteomic Analysis of Duck Embryo Fibroblasts Infected with Novel Duck Reovirus. Front. Vet. Sci. 2020, 7, 577370. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.H.; Cheng, A.C.; Zhang, X.C.; Wang, M.S.; Chen, S.; Zhu, D.K.; Liu, M.F.; Zhao, X.X.; Yang, Q.; Wu, Y.; et al. Transcriptome analysis of duck embryo fibroblasts for the dynamic response to duck tembusu virus infection and dual regulation of apoptosis genes. Aging 2020, 12, 17503–17527. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′→3′) | Annealing Temperature (°C) | Note |
---|---|---|---|
duTRIM25-FLAG-F | gggagacccaagctggctagcATGGCGGCGCTGACCCGA | 68 | RT-PCR |
duTRIM25-FLAG-R | ctgctcggatcctttgaattcCTTTTTCATTTGGCAGAGGGAG | ||
5′ Router | AGGAGGCGCAGAAGTT | 60 | 5′ RACE-PCR |
5′ Inner | GTCACGGGGGTGTCGA | ||
3′ Router | TACCCAATGTGAGGGCTACCAAGAT | 60 | 3′ RACE-PCR |
3′ Inner | CTGCGAGGGAGGCTTTGTGATTTT | ||
duTRIM25(RING)-FLAG-F | gggagacccaagctggctagcATGGCGGCGCTGACCCGA | 55 | RT-PCR |
duTRIM25(RING)-FLAG-R | ctgctcggatcctttgaattcCCGGCACAGCACCGTGTT | ||
duTRIM25(B-Box)-FLAG-F | gggagacccaagctggctagcATGAACAAGGTCTTCGAG | 55 | RT-PCR |
duTRIM25(B-Box)-FLAG-R | ctgctcggatcctttgaattcAACAGTATAAATGTAATC | ||
duTRIM25(SPRY)-FLAG-F | gggagacccaagctggctagcATGTCAAAAGCTGCAACT | 55 | RT-PCR |
duTRIM25(SPRY)-FLAG-R | ctgctcggatcctttgaattcCTTTTTCATTTGGCAGAGGGAG | ||
duIFN-β-promoter-F | CCCAAGCTTAAGCGATGGGAAAGATGT | 58 | RT-PCR |
duIFN-β-promoter-R | GGAAGATCTTGTAGGGGCTATGTGGT | ||
qTRIM25-F | AAGCAGGAGGATGAGGAAGATGAGG | 60 | RT-qPCR |
qTRIM25-R | AGAAGGAGGCCATGCAGGTCAG | ||
β-actin-F | ATGTCGCCCTGGATTTCG | 60 | RT-qPCR |
β-actin-R | CACAGGACTCCATACCCAAGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Gu, T.; Chen, J.; Luo, S.; Dong, X.; Zheng, M.; Chen, G.; Xu, Q. The TRIM25 Gene in Ducks: Cloning, Characterization and Antiviral Immune Response. Genes 2022, 13, 2090. https://doi.org/10.3390/genes13112090
Liu J, Gu T, Chen J, Luo S, Dong X, Zheng M, Chen G, Xu Q. The TRIM25 Gene in Ducks: Cloning, Characterization and Antiviral Immune Response. Genes. 2022; 13(11):2090. https://doi.org/10.3390/genes13112090
Chicago/Turabian StyleLiu, Jinlu, Tiantian Gu, Jianzhou Chen, Shuwen Luo, Xiaoqian Dong, Ming Zheng, Guohong Chen, and Qi Xu. 2022. "The TRIM25 Gene in Ducks: Cloning, Characterization and Antiviral Immune Response" Genes 13, no. 11: 2090. https://doi.org/10.3390/genes13112090