Next Article in Journal
Proteomic and Transcriptomic Landscapes of Alström and Bardet–Biedl Syndromes
Previous Article in Journal
Spotlight on a Short-Time Treatment with the IL-4/IL-13 Receptor Blocker in Patients with CRSwNP: microRNAs Modulations and Preliminary Clinical Evidence
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 13
Issue 12
10.3390/genes13122369
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

TWIST1 Plays Role in Expression of Stemness State Markers in ESCC

by
Mohammad Hossein Izadpanah
1 and
Mohammad Mahdi Forghanifard
2,*
1
Division of Human Genetics, Immunology Research Center, Avicenna Research Institute, Mashhad University of Medical Sciences, Mashhad 9196773117, Iran
2
Department of Biology, Damghan Branch, Islamic Azad University, Damghan 3671637849, Iran
*
Author to whom correspondence should be addressed.
Genes 2022, 13(12), 2369; https://doi.org/10.3390/genes13122369
Submission received: 31 October 2022 / Revised: 7 December 2022 / Accepted: 13 December 2022 / Published: 15 December 2022
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Background: Stemness markers play critical roles in the maintenance of key properties of embryonic stem cells (ESCs), including the pluripotency, stemness state, and self-renewal capacities, as well as cell fate decision. Some of these features are present in cancer stem cells (CSCs). TWIST1, as a bHLH transcription factor oncogene, is involved in the epithelial–mesenchymal transition (EMT) process in both embryonic and cancer development. Our aim in this study was to investigate the functional correlation between TWIST1 and the involved genes in the process of CSCs self-renewal in human esophageal squamous cell carcinoma (ESCC) line KYSE-30. Methods: TWIST1 overexpression was enforced in the ESCC KYSE-30 cells using retroviral vector containing the specific pruf-IRES-GFP-hTWIST1 sequence. Following RNA extraction and cDNA synthesis, the mRNA expression profile of TWIST1 and the stem cell markers, including BMI1, CRIPTO1, DPPA2, KLF4, SOX2, NANOG, and MSI1, were assessed using relative comparative real-time PCR. Results: Ectopic expression of TWIST1 in KYSE-30 cells resulted in an increased expression of TWIST1 compared to control GFP cells by nearly 9-fold. Transduction of TWIST1-retroviral particles caused a significant enhancement in BMI1, CRIPTO1, DPPA2, KLF4, and SOX2 mRNA expression, approximately 4.5-, 3.2-, 5.5-, 3.5-, and 3.7-folds, respectively, whereas this increased TWIST1 expression caused no change in the mRNA expression of NANOG and MSI1 genes. Conclusions: TWIST1 gene ectopic expression in KYSE-30 cells enhanced the level of cancer stem cell markers’ mRNA expression. These results may emphasize the role of TWIST1 in the self-renewal process and may corroborate the involvement of TWIST1 in the stemness state capacity of ESCC cell line KYSE-30, as well as its potential as a therapeutic target.

1. Introduction

Tumor progression and metastasis is a complicated process, during which the primary tumor cell population is able to escape and survive in the circulation and invade and proliferate in another microenvironment [1]. Epithelial–mesenchymal transition (EMT) and cancer stem cells (CSCs) are considered two critical subjects in cancer metastasis. Identification of the molecular mechanisms behind EMT and CSC formation can provide impressive insights to prevent tumor metastasis and introduce therapeutic targets [2]. EMT, as a cellular–physiological process with reversible alteration, correlates with stemness properties and develops cancer-related changes in the cell, including invasiveness, decreased cellular adhesion and polarity, and increased motility and invasion, as well as resistance to apoptosis [3,4]. These adaptive alterations can exist between EMT and its reverse process (mesenchymal–epithelial transition; MET) in epithelial malignancies [5]. EMT and metastasis are induced through the activation of different growth factors (such as HGF, PDGF, IGF, EGF, and FGF); extracellular matrix (ECM); numerous zinc-finger transcription factors (TFs), including TWIST1, ZEB, SLUG, E47, SIP1, and SNAIL families; and a variety of cell signaling pathways, including Wnt, Notch, TFGβ, NF-κB, integrins, and tyrosine-kinase receptors [1,6]. The dysregulation of these factors plays a key role in the inhibition of cell polarity through the downregulation of epithelial cell markers, such as E-cadherin and cytokeratin 18, and the upregulation of mesenchymal cell markers, such as N-cadherin, fibronectin, and vimentin, as the EMT hallmarks [7]. The EMT process can generates CSC phenotypes in tumor cell populations that acquire self-renewal properties, proliferation and differentiation potential, expanding ability within tumor, and drug resistance [7,8]. There is a closely reciprocal biological link between EMT and the CSC state [9]. A better understanding of the relation between EMT and CSCs in malignancies can help to recognize the complicated signaling pathways controlling the CSCs/EMT axis during the formation of tumor bulk and residual cells responsible for relapse and metastasis, tumor progression, and targeted therapeutic responses [9]. The molecular mechanisms behind EMT program and CSC phenotype consists of alterations in both the intracellular signaling pathways and the extracellular secreted proteins of tumor cells [8]. The self-renewal and differentiation process in CSCs are mainly regulated through transcriptional regulators (such as OCT4, Nanog, YAP/TAZ, and Myc), as well as signaling pathways (such as Wnt, Notch, HH, TGF-β, PI3K/Akt, EGFR, and JAK/STAT), thereby being able to produce, expand, and maintain more CSCs populations, as well as all the non-CSC progeny in a tumor [10,11].
TWIST1, a basic helix-loop-helix transcription factor, is a key mediator of the mesenchymal/CSC state and can link EMT to self-renewal [4,12]. The upregulation of TWIST1 leads to the activation of the antiapoptotic process during EMT development, increased cell angiogenesis/invasion/migration/metastatic potential, disassembly of cell adhesion, CSC-like features maintenance, and restriction of cellular differentiation, as well as patients’ poor prognosis and survival rate in epithelial cancers [13].
Hence, the evaluation of the EMT mechanism in CSCs regulation is an essential need to identify new approaches for therapeutic strategies preventing cancer progression and improving the prognosis of the disease [6]. Our aim in this study was to evaluate the impact of TWIST1 ectopic expression on the expression pattern of stemness and self-renewal-associated genes, including BMI1, CRIPTO1, DPPA2, KLF4, SOX2, NANOG, and MSI1 in ESCC cell line KYSE-30, to elucidate possible crosstalk between TWIST1 and the self-renewal state of the cells.

2. Materials and methods

2.1. In Silico Sequence Analysis

BMI1, CRIPTO1, DPPA2, KLF4, and SOX2 mRNAs and gene sequences were obtained from Genebank (accession numbers NM_005180.9, NM_001174136, NM_138815, NM_004235.6, and NM_004235, respectively). The sequence analysis was performed by using CLC Main Workbench version 20 (CLC bio).

2.2. Cell Lines and Culture Condition

GP293T (a HEK293T-derived retroviral packaging cell line) and the human ESCC (KYSE-30) cell line were obtained from the Pasteur Institute Cell Bank of Iran (http://en.pasteur.ac.ir/). These cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Biosera, Shanghai, China) and RPMI 1640 medium (Biosera), respectively, supplemented with 100 U/mL penicillin–streptomycin (Gibco, FL, USA) and 10 % heat-inactivated fetal bovine serum (FBS; Gibco, FL, USA) in a humidified atmosphere at 37 °C with 5% CO2.

2.3. Retroviral Production and Enforced TWIST1 Overexpression

The Pruf-IRES-GFP-hTWIST1 and control Pruf-IRES-GFP plasmids were obtained for generating retroviral particles, as described before [12,14]. Briefly, plasmids of Pruf-IRES-GFP-hTWIST1, pGP, and pMD2 were co-transfected in GP293T cells according to the standard calcium phosphate precipitation method. Viral particles were harvested 24 and 48 h after transfection and resuspended in fresh medium. Eventually, KYSE-30 cells were transduced with recombinant retroviral particles of Pruf-IRES-GFP (control) and Pruf-IRES-GFP-hTWIST1 (1 × 105 cells/6-well plate). Retroviral transduction was performed twice and evaluated through inverted fluorescence microscopy.

2.4. RNA Extraction, cDNA Synthesis, Comparative Real-Time PCR, and Statistical Analysis

The RNA extraction from the Pruf-IRES-GFP- and Pruf-IRES-GFP-hTWIST1-transduced ESCC cell line, DNase I treatment, cDNA synthesis, and quantitative RT-PCR expression analysis have been described in detail previously [12,15,16]. The mRNA expression profiles of the involved genes in the process of cancer stem cell self-renewal, including BMI1, CRIPTO1, DPPA2, KLF4, SOX2, NANOG, and MSI1, were evaluated by specific primer sets demonstrated in Table 1.

3. Results

3.1. Sequence Analysis of Cancer Stem Cell Self-Renewal Genes Promoter

Transcription unit and its upstream region sequences of the BMI1, CRIPTO1, DPPA2, KLF4, and SOX2 genes were evaluated to check and find the probable E-boxes. Several different E-boxes were found in the −2 kb upstream region of these genes before the starting site. Interestingly, some of the E-boxes were located close to the transcription start site in position −70 for BMI1; −46, −97 and −203 for CRIPTO1; in −348 and −437 for DPPA2; in− 412 and −422 for KLF4; and finally in −1 and −6 for SOX2. Other E-boxes were highlighted in Figure 1. Furthermore, there were several E-boxes in the CSCs gene transcription units located in both exon and intron regions. (Table 2, Table 3, Table 4, Table 5 and Table 6).

3.2. Upregulation of TWIST1 in ESCC Cell Line KYSE-30

The expression of TWIST1 was investigated in Pruf-IRES-GFP-hTWIST1 in comparison with Pruf-IRES-GFP-control KYSE-30 cells to confirm the increased expression of TWIST1. The fluorescent microscopy confirmed the efficiency of transduction in Pruf-IRES-GFP-hTWIST1 and Pruf-IRES-GFP control KYSE-30 cells, as revealed before [16]. The significant overexpression by nearly 9-fold (log2 fold change) of TWIST1 was detected in retroviral Pruf-IRES-GFP-hTWIST1-transduced cells compared to control.

3.3. Ectopic Expression of TWIST1 Increased Expression of Cancer Stem Cell Self-Renewal Genes

The stable enforced high expression of TWIST1 in the ESCC cell line increased the mRNA expression of selected candidate CSC genes. After confirming the TWIST1 gene overexpression in KYSE-30 cells, we assessed the mRNA expression profile of specific cancer stem cell self-renewal genes consequently. The upregulation of TWIST1 led to a significant increase in the levels of BMI1, CRIPTO1, DPPA2, KLF4, and SOX2 mRNA expression (4.5-, 3.2-, 5.5-, 3.5-, and 3.7-log 2 fold change, respectively), while TWIST1 overexpression had no effect on the mRNA expression of NANOG and MSI1 genes. Data are represented in Figure 2.

4. Discussion

The EMT process and stemness state are tightly linked together. The common shared regulators and signaling pathways in these events can assist in a better understanding of the connection between EMT and stemness states, as well as the identification of novel and effective targets to develop new therapeutic strategies and preclude relapse for patients [17]. CSCs present mesenchymal status with pluripotency characteristics through the expression of EMT-associated regulators [1]. The molecular mechanisms’ interplay between EMT and stemness cellular–biological processes are poorly understood in malignancies, and its assessment can contribute to improve therapeutic modalities and patients’ quality of life.
TWIST1, as a known EMT marker in cancer, can trigger the generation of a CSC status through the overexpression of stemness markers in different types of cancers [18]. In current study, we evaluated the impact of TWIST1 ectopic expression on different involved genes in stemness state and self-renewal capacities and determined the increased levels of BMI1, CRIPTO1, DPPA2, KLF4, and SOX2 expression following TWIST1-enforced expression in KYSE-30 cells. These results may highlight the potential of TWIST1 to support self-renewal capacity through modulating stem cell genes’ expression pattern in ESCC line KYSE-30.
TWIST1, as a regulator of EMT in embryogenesis, is involved in the tumorigenesis of different cancers, including sarcomas, carcinomas, and hematological malignancies [18]. It has been shown that TWIST1 plays a role either in the EMT-induced CSC phenotype or tumor stemness-induced EMT [19]. The induced EMT by TWIST1 can expand CSCs with self-renewal potential for the growth of secondary tumors [19]. It has also been reported that the increased expression of TWIST1 induced the expression of stemness markers and enhanced self-renewal in human head and neck squamous cell carcinoma, ESCC, as well as cervical and breast cancers [20]. The expression of TWIST1, CRIPTO1, SOX2, and MSI1 were evaluated in ESCC patients, indicating their role in tumorigenesis and tumor cell aggressiveness [13,21,22,23,24]. Intriguingly, the enhanced TWIST1 gene expression in ESCC cell lines KYSE-30 and YM-1 resulted in the significant overexpression of OCT4 (stem cell-associate transcription factor), MAGEA4, and NY-ESO1 (testicular cancer antigens), N-cadherin, Occluding, ZEB2, Fibronectin, and Vimentin (EMT markers), suggesting a key relation between EMT and CSC formation in esophageal tumor cells [12,13,16]. Moreover, the reduced expression of SNAIL gene was observed following the enforced expression of TWIST1 in KYSE-30 cells, suggesting a negative regulatory effect of TWIST1 on SNAIL expression [14]. Based on our results and considering the possibility of a well-defined function of overexpressed stemness markers in ESCC line KYSE-30 following enforced TWIST1 expression, it may be extrapolated that the ectopic expression of TWIST1 induced cells to undergo the EMT process for the acquisition of a CSC population and the self-renewal ability of stem-like cells. TWIST1 has been demonstrated to be involved in self-renewal through the regulation of stemness markers [4]. These results suggest that EMT induction by TWIST1 overexpression can stimulate EMT-induced CSC state and metastasis in the tumor.
The induced expression of BMI1 by TWIST1 can enhance the expression of SOX2, KLF4, NANOG, NF-κB, MRP1, and TERT [4]. NANOG is also able to regulate the expression of BMI1, TWIST1, and SNAIL1 to promote EMT, invasion, migration, the induction of stemness markers, metastasis, and tumor-initiating ability in breast, colon, non-small cell lung cancer (NSCLS), and head and neck squamous cell carcinoma (HNSCC) via promoter occupancy [25,26]. The physical interplay between BMI1 and TWIST1 in the E-cadherin promoter can lead to EMT activation and develop the CSCs subpopulation [4]. Therefore, the upregulation of BMI1 via the enforced expression of TWIST1 can suppress the expression of E-cadherin and induce proliferation, self-renewal, and chemoresistance [27]. The corporation between BMI1 and TWIST1 in hypoxia can induce the expression of OCT4 and CD44 [28]. The activation of the WNT pathway and the inhibition of tumor suppressor genes (TSGs) through BMI1 can facilitate tumor invasion and progression [29,30]. Consequently, there is an interdependent relationship between the expression of BMI1 and TWIST1 in cancer initiation, differentiation, self-renewal, stemness, EMT, and CSC-mediated metastasis [4].
Our study indicated that the induction of TWIST1 increased the expression of stemness transcription factors, including KLF4 and SOX2 in KYSE-30 cells, while no change in NANOG expression was observed. The roles of these stemness genes in tumorigenicity state have been reported previously. Numerous studies demonstrated that KLF4, SOX2, and NANOG constitute CSC markers and have key roles in sphere formation, stem cell self-renewal, cell motility, the formation and maintenance of CSC phenotype, clonogenicity and tumor regenerative ability, long-term proliferative potential of CSCs, repression of differentiation, cell cycle, migration, invasion, EMT, metastasis, and cancer progression in various malignancies [31,32]. Moreover, the overexpression of KLF4, SOX2, and NANOG were found in several malignancies, and their expression levels were correlated with poor prognosis, advanced-stage cancer, and shorter patient survival [31]. Different reasons may be involved in the unchanged level of NANOG gene expression after TWIST1 overexpression in this study, consisting of involved transcription machinery and transcription factors, DNA-binding proteins that compete with TWIST1, and other regulatory proteins in the cell. Describing this situation needs further investigation.
KLF4, as an anti-proliferative factor in differentiated epithelia, play a dual function depending on tumor type, tissue, and cancer stage. While it performs as an oncogene in HNSCC, breast, skin, advanced-stage of ESCC and pancreatic cancers, it functions as a tumor suppressor gene (TSG) in lung, liver, colorectal, prostate, bladder, gastric malignancies, and high-grade dysplasia, as well as early-stage ESCCs [33,34]. Knockdown of KLF4 and BMI1 reduced the number and size of tumor sphere formation and tumor-initiating ability, suggesting that both KLF4 and BMI1 may contribute to inducing stem-like property and metastasis by TWIST1-JAGGED1-NOTCH-KLF4 signaling in HNC [35]. Evidence displayed the role of KLF4 in triggering EMT in non-small cell lung and endometrial cancers and human nasopharyngeal carcinoma [36]. Based on previous studies and our results, TWIST1 may induce and promote EMT through KLF4 upregulation and its interaction with SOX2/NANOG/BMI1 in KYSE-30 cells. Similar to KLF4, the biological impact of SOX2 in tumor cells is dependent on tumor type [37]. Due to the direct interaction between SOX2/NANOG/BMI1/KLF4 in the invasiveness of tumor cells, as well as its biological significance in the progression of ESCC [23], SOX2 expression can enhance malignancy by inducing stemness properties and EMT in ESCC. It has been indicated that the ectopic expression of SOX2 and TWIST1 in breast cell lines MCF7 and ZR751 resulted in SOX2-mediated invasion/EMT via the TWIST1-dependent mechanism [37]. There is a direct correlation between the expression of SOX2 and TWIST1 in glioblastoma cells, suggesting their interaction to maintain stemness and EMT ability [38]. Interestingly, the upregulation of SOX2 and OCT4 can suppress E-cadherin expression during the reprogramming of fibroblasts and activate SNAIL1 expression and the EMT process through the suppression of TGF-β signaling [39]. Since the transcription activity of TWIST1 and SOX2 in ESCs and breast cancer cells can be modulated through their binding to the promoter region [37], we hypothesized that a similar scenario may happen in ESCC. We showed that the increased expression of TWIST1 led to the increased expression of SOX2 in KYSE-30 cells, which may promote the invasiveness of the cells.
CRIPTO1, as a pluripotential ES marker, is a linker between EMT and tumor-initiating cells (or CSCs) and regulates self-renewal and tumorigenicity in cancers [40]. The upregulation of CRIPTO1 was significantly associated with poor prognosis of patients, self-renewal, aggressive phenotypes, and tumorigenesis in esophageal and renal malignancies [21,41,42,43]. Moreover, the knockdown of CRIPTO1 expression significantly reduced the expression of NANOG, SOX2, and OCT4 and consequently reduced the stemness properties of ESCC cells, while its high expression was correlated with EMT, invasion, and metastasis of ESCC [41]. TWIST1 and CRIPTO1 co-expression was correlated with larger tumor size, advanced stages of tumor progression, poorly differentiated state of tumors, presence of distant metastases, poor 3-year survival rates, and disease progression in non-small cell lung carcinoma [44]. Herein we presented the linkage between TWIST1 and CRIPTO1 in KYSE-30 cells. This report is in line with previous studies describing the regulatory role for CRIPTO1 in EMT, as an early step of invasion and metastasis, in epithelial cancer cells, including KYSE-30, EC109, and TE-1 ESCC cell lines.
Cancer cells can resemble the undifferentiated state with stem cell properties, including self-renewal ability, invasiveness, unrestricted proliferation through stem cell-associate transcription factors and germ cell or cancer/testis genes [45]. There is a transcriptional linkage between DPPA2, as a pluripotency-related oncogene, with the pluripotency genes of NANOG, SOX2, OCT4, and SALL4, leading to the rearrangement of the epigenome during reprogramming [46,47]. Moreover, cancer testis antigens, such as the MAGE family (especially MAGE-A4), LAGE, and NY-ESO1, are particularly expressed in DPPA2-positive NSCLC tumors [48]. There is a significant correlation between the mRNA expression of MAGEA4 and TWIST1 in ESCC [13]. Therefore, there may exist a correlation between the co-expression of DPPA2 and TWIST1 in ESCC. Herein, we elucidated that the enforced expression of TWIST1 led to the upregulation of DPPA2. Consistent with the reports [12,13,14,16,21,22,48,49,50,51,52], our data also confirmed the correlation between the expression of cancer testis antigens, EMT markers, and pluripotency genes in ESCC, although further investigations are needed to determine the exact governing molecular mechanism.
Since traditional cancer treatment modalities, including surgical resection, chemo- and radiotherapies, are not sufficient to inhibit tumor relapse, TWIST1 and other EMT transcription factors, as well as stemness state regulators, which are involved in tumor resistance against traditional therapeutic modalities, are key to the future study of cancer diagnosis and therapy. Therefore, novel therapeutic strategies focused on targeting CSCs and their molecular regulators can eradicate the CSCs and therapy resistance. Our results confirmed the potential of TWIST1 as a proper therapeutic target for cancer treatment to inhibit EMT progress and the cancer stem-cell-like phenotype through its regulatory role of CSC markers’ gene expression, expanding insight into the TWIST1 biology in ESCC and paving the road to an efficient targeted therapy. A combination of traditional therapeutic modalities with TWIST1-targeted therapy may target the whole tumor mass, including its cancer cells, as well as its CSCs subpopulations, and offer a promising strategy for cancer cure.

5. Conclusions

In summary, we showed that the enforced expression of TWIST1 can upregulate stem cell markers BMI1, CRIPTO1, DPPA2, KLF4, and SOX2, in ESCC line KYSE-30. These results may suggest a role for TWIST1 in the stemness and self-renewal maintenance of ESCC cells and provide clues to the molecular pathway controlling the EMT-induced stemness state in cancer cells.

Author Contributions

M.H.I. performed experiments, analyzed data, and wrote the manuscript; M.M.F. conceptualized, designed, developed and supervised the study, and had a critical scientific revision on the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on reasonably request from the corresponding author.

Acknowledgments

We gratefully acknowledge our colleagues at the Human Division of Human Genetics, Immunology Research Institute, Avicenna Research Institute (Mashhad University of Medical Sciences), for their technical support.

Conflicts of Interest

The authors declare no conflict of interests.

References

  1. Tang, Y.-L.; Wang, S.-S.; Jiang, J.; Liang, X.-H. Links between cancer stem cells and epithelial– mesenchymal transition. OncoTargets Ther. 2015, 8, 2973–2980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Valastyan, S.; Weinberg, R.A. Tumor Metastasis: Molecular Insights and Evolving Paradigms. Cell 2011, 147, 275–292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Savagner, P. The epithelial–mesenchymal transition (EMT) phenomenon. Ann. Oncol. 2010, 21, vii89–vii92. [Google Scholar] [CrossRef]
  4. Martín, A.; Cano, A. Tumorigenesis: Twist1 links EMT to self-renewal. Nat. Cell Biol. 2010, 12, 924–925. [Google Scholar] [CrossRef] [PubMed]
  5. Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741–4751. [Google Scholar] [CrossRef] [Green Version]
  6. Zhou, J.-M.; Hu, S.-Q.; Jiang, H.; Chen, Y.-L.; Feng, J.-H.; Chen, Z.-Q.; Wen, K.-M. OCT4B1 Promoted EMT and Regulated the Self-Renewal of CSCs in CRC: Effects Associated with the Balance of miR-8064/PLK1. Mol. Ther.-Oncolytics 2019, 15, 7–20. [Google Scholar] [CrossRef] [Green Version]
  7. Weidenfeld, K.; Barkan, D. EMT and Stemness in Tumor Dormancy and Outgrowth: Are They Intertwined Processes? Front. Oncol. 2018, 8, 381. [Google Scholar] [CrossRef]
  8. Shibue, T.; Weinberg, R.A. EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat. Rev. Clin. Oncol. 2017, 14, 611. [Google Scholar] [CrossRef] [Green Version]
  9. Zhou, P.; Li, B.; Liu, F.; Zhang, M.; Wang, Q.; Liu, Y.; Yao, Y.; Li, D. The epithelial to mesenchymal transition (EMT) and cancer stem cells: Implication for treatment resistance in pancreatic cancer. Mol. Cancer 2017, 16, 52. [Google Scholar] [CrossRef] [Green Version]
  10. Abell, A.N.; Johnson, G.L. Implications of Mesenchymal Cells in Cancer Stem Cell Populations: Relevance to EMT. Curr. Pathobiol. Rep. 2014, 2, 21–26. [Google Scholar] [CrossRef]
  11. Phi, L.T.H.; Sari, I.N.; Yang, Y.-G.; Lee, S.-H.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem Cells Int. 2018, 2018, 5416923. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Khales, S.A.; Abbaszadegan, M.R.; Majd, A.; Forghanifard, M.M. Linkage between EMT and stemness state through molecular association between TWIST1 and NY-ESO1 in esophageal squamous cell carcinoma. Biochimie 2019, 163, 84–93. [Google Scholar] [CrossRef] [PubMed]
  13. Forghanifard, M.M.; Rad, A.; Farshchian, M.; Khaleghizadeh, M.; Gholamin, M.; Moghbeli, M.; Abbaszadegan, M.R. TWIST1 upregulates the MAGEA4 oncogene. Mol. Carcinog. 2016, 56, 877–885. [Google Scholar] [CrossRef] [PubMed]
  14. Forghanifard, M.M.; Khales, S.A.; Farshchian, M.; Rad, A.; Homayouni-Tabrizi, M.; Abbaszadegan, M.R. Negative Regulatory Role of TWIST1 on SNAIL Gene Expression. Pathol. Oncol. Res. 2016, 23, 85–90. [Google Scholar] [CrossRef] [PubMed]
  15. Mahmoudian, R.A.; Bahadori, B.; Rad, A.; Abbaszadegan, M.R.; Forghanifard, M.M. MEIS1 knockdown may promote differentiation of esophageal squamous carcinoma cell line KYSE-30. Mol. Genet. Genom. Med. 2019, 7, e00746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Izadpanah, M.H.; Abbaszadegan, M.R.; Fahim, Y.; Forghanifard, M.M. Ectopic expression of TWIST1 upregulates the stemness marker OCT4 in the esophageal squamous cell carcinoma cell line KYSE30. Cell. Mol. Biol. Lett. 2017, 22, 33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Jayachandran, A.; Dhungel, B.; Steel, J.C. Epithelial-to-mesenchymal plasticity of cancer stem cells: Therapeutic targets in hepatocellular carcinoma. J. Hematol. Oncol. 2016, 9, 74. [Google Scholar] [CrossRef] [Green Version]
  18. Zhao, Z.; Rahman, M.A.; Chen, Z.G.; Shin, D.M. Multiple biological functions of Twist1 in various cancers. Oncotarget 2017, 8, 20380–20393. [Google Scholar] [CrossRef] [Green Version]
  19. Ren, H.; Du, P.; Ge, Z.; Jin, Y.; Ding, D.; Liu, X.; Zou, Q. TWIST1 and BMI1 in Cancer Metastasis and Chemoresistance. J. Cancer 2016, 7, 1074–1080. [Google Scholar] [CrossRef] [Green Version]
  20. Dong, C.-Y.; Liu, X.-Y.; Wang, N.; Wang, L.-N.; Yang, B.-X.; Ren, Q.; Liang, H.-Y.; Ma, X.-T. Twist-1, A Novel Regulator of Hematopoietic Stem Cell Self-Renewal and Myeloid Lineage Development. Stem Cells 2014, 32, 3173–3182. [Google Scholar] [CrossRef]
  21. Mahmoudian, R.A.; Abbaszadegan, M.R.; Forghanifard, M.M.; Moghbeli, M.; Moghbeli, F.; Chamani, J.; Gholamin, M. Biological and Clinicopathological Significance of Cripto-1 Expression in the Progression of Human ESCC. Rep. Biochem. Mol. Biol. 2017, 5, 83–90. [Google Scholar] [CrossRef] [PubMed]
  22. Moghbeli, M.; Forghanifard, M.M.; Aarabi, A.; Mansourian, A.; Abbaszadegan, M.R. Clinicopathological Sex- Related Relevance of Musashi1 mRNA Expression in Esophageal Squamous Cell Carcinoma Patients. Pathol. Oncol. Res. 2013, 20, 427–433. [Google Scholar] [CrossRef] [PubMed]
  23. Forghanifard, M.M.; Khales, S.A.; Javdani-Mallak, A.; Rad, A.; Farshchian, M.; Abbaszadegan, M.R. Stemness state regulators SALL4 and SOX2 are involved in progression and invasiveness of esophageal squamous cell carcinoma. Med. Oncol. 2014, 31, 922. [Google Scholar] [CrossRef] [PubMed]
  24. Forghanifard, M.M.; Moaven, O.; Farshchian, M.; Montazer, M.; Raeisossadati, R.; Abdollahi, A.; Moghbeli, M.; Nejadsattari, T.; Parivar, K.; Abbaszadegan, M.R. Expression Analysis Elucidates the Roles of MAML1 and Twist1 in Esophageal Squamous Cell Carcinoma Aggressiveness and Metastasis. Ann. Surg. Oncol. 2011, 19, 743–749. [Google Scholar] [CrossRef] [PubMed]
  25. Lee, H.-J.; Noh, K.H.; Lee, Y.-H.; Song, K.-H.; Oh, S.J.; Kim, S.Y.; Kim, T.W. NANOG signaling promotes metastatic capability of immunoedited tumor cells. Clin. Exp. Metastasis 2015, 32, 429–439. [Google Scholar] [CrossRef]
  26. Paranjape, A.N.; Balaji, S.A.; Mandal, T.; Krushik, E.V.; Nagaraj, P.; Mukherjee, G.; Rangarajan, A. Bmi1 regulates self-renewal and epithelial to mesenchymal transition in breast cancer cells through Nanog. BMC Cancer 2014, 14, 785. [Google Scholar] [CrossRef] [Green Version]
  27. Gawlik-Rzemieniewska, N.; Bednarek, I.A. The role of NANOG transcriptional factor in the development of malignant phenotype of cancer cells. Cancer Biol. Ther. 2015, 17, 1–10. [Google Scholar] [CrossRef] [Green Version]
  28. Yang, M.-H.; Hsu, D.S.-S.; Wang, H.-W.; Wang, H.-J.; Lan, H.-Y.; Yang, W.-H.; Huang, C.-H.; Kao, S.-Y.; Tzeng, C.-H.; Tai, S.-K.; et al. Bmi1 is essential in Twist1-induced epithelial–mesenchymal transition. Nature 2010, 12, 982–992. [Google Scholar] [CrossRef]
  29. Cho, J.-H.; Dimri, M.; Dimri, G.P. A Positive Feedback Loop Regulates the Expression of Polycomb Group Protein BMI1 via WNT Signaling Pathway. J. Biol. Chem. 2013, 288, 3406–3418. [Google Scholar] [CrossRef] [Green Version]
  30. Kamijo, T. Role of stemness-related molecules in neuroblastoma. Pediatr. Res. 2012, 71, 511–515. [Google Scholar] [CrossRef]
  31. Hadjimichael, C.; Chanoumidou, K.; Papadopoulou, N.; Arampatzi, P.; Papamatheakis, J.; Kretsovali, A. Common stemness regulators of embryonic and cancer stem cells. World J. Stem Cells 2015, 7, 1150–1184. [Google Scholar] [CrossRef] [PubMed]
  32. Siu, M.K.Y.; Wong, E.S.Y.; Kong, D.S.H.; Chan, H.Y.; Jiang, L.; Wong, O.G.W.; Lam, E.W.-F.; Chan, K.K.L.; Ngan, H.Y.S.; Le, X.-F.; et al. Stem cell transcription factor NANOG controls cell migration and invasion via dysregulation of E-cadherin and FoxJ1 and contributes to adverse clinical outcome in ovarian cancers. Oncogene 2012, 32, 3500–3509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Chen, H.-F.; Wu, K.-J. Endothelial Transdifferentiation of Tumor Cells Triggered by the Twist1-Jagged1-KLF4 Axis: Relationship between Cancer Stemness and Angiogenesis. Stem Cells Int. 2015, 2016, 6439864. [Google Scholar] [CrossRef] [Green Version]
  34. Yang, Y.; Katz, J.P. KLF4 is downregulated but not mutated during human esophageal squamous cell carcinogenesis and has tumor stage-specific functions. Cancer Biol. Ther. 2016, 17, 422–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Chen, H.-F.; Huang, C.-H.; Liu, C.-J.; Hung, J.-J.; Hsu, C.-C.; Teng, S.-C.; Wu, K.-J. Twist1 induces endothelial differentiation of tumour cells through the Jagged1-KLF4 axis. Nat. Commun. 2014, 5, 4697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Ghaleb, A.M.; Yang, V.W. Krüppel-like factor 4 (KLF4): What we currently know. Gene 2017, 611, 27–37. [Google Scholar] [CrossRef] [PubMed]
  37. Wu, F.; Ye, X.; Wang, P.; Jung, K.; Wu, C.; Douglas, D.; Kneteman, N.; Bigras, G.; Ma, Y.; Lai, R. Sox2 suppresses the invasiveness of breast cancer cells via a mechanism that is dependent on Twist1 and the status of Sox2 transcription activity. BMC Cancer 2013, 13, 317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Velpula, K.K.; Dasari, V.R.; Tsung, A.J.; Dinh, D.H.; Rao, J.S. Cord blood stem cells revert glioma stem cell EMT by down regulating transcriptional activation of Sox2 and Twist1. Oncotarget 2011, 2, 1028–1042. [Google Scholar] [CrossRef] [Green Version]
  39. Li, R.; Liang, J.; Ni, S.; Zhou, T.; Qing, X.; Li, H.; He, W.; Chen, J.; Li, F.; Zhuang, Q.; et al. A Mesenchymal-to-Epithelial Transition Initiates and Is Required for the Nuclear Reprogramming of Mouse Fibroblasts. Cell Stem Cell 2010, 7, 51–63. [Google Scholar] [CrossRef] [Green Version]
  40. Rangel, M.C.; Karasawa, H.; Castro, N.P.; Nagaoka, T.; Salomon, D.S.; Bianco, C. Role of Cripto-1 during Epithelial-to-Mesenchymal Transition in Development and Cancer. Am. J. Pathol. 2012, 180, 2188–2200. [Google Scholar] [CrossRef]
  41. Liu, Q.; Cui, X.; Yu, X.; Bian, B.-S.; Qian, F.; Hu, X.-G.; Ji, C.-D.; Yang, L.; Ren, Y.; Cui, W.; et al. Cripto-1 acts as a functional marker of cancer stem-like cells and predicts prognosis of the patients in esophageal squamous cell carcinoma. Mol. Cancer 2017, 16, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Huang, T.; Guo, Y.-Z.; Yue, X.; Zhang, G.-P.; Zhang, Y.; Kuang, M.; Peng, B.-G.; Li, S.-Q. Cripto-1 promotes tumor invasion and predicts poor outcomes in hepatocellular carcinoma. Carcinogenesis 2019, 41, 571–581. [Google Scholar] [CrossRef] [PubMed]
  43. Xue, Y.-J.; Chen, S.-N.; Chen, W.-G.; Wu, G.-Q.; Liao, Y.-F.; Xu, J.-B.; Tang, H.; Yang, S.-H.; He, S.-Y.; Luo, Y.-F.; et al. Cripto-1 expression in patients with clear cell renal cell carcinoma is associated with poor disease outcome. J. Exp. Clin. Cancer Res. 2019, 38, 378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Mohamed, M.S.; Salem, A.M.; Ahmed, R.Z.; Amer, S.A.; Abozaid, M.M. Prognostic and predictive values of Twist-1 and Cripto-1 expressions in non-small cell carcinoma of lung: An immunohistochemical study. Egypt. J. Pathol. 2018, 38, 190–198. [Google Scholar]
  45. Khaleghizadeh, M.; Forghanifard, M.M.; Rad, A.; Farshchian, M.; Hejazi, Z.; Gholamin, M.; Memar, B.; Abbaszadegan, M.R. Ectopic Expression of Human DPPA2 Gene in ESCC Cell Line Using Retroviral System. Avicenna J. Med. Biotechnol. 2018, 10, 75–82. [Google Scholar]
  46. Shabestarian, H.; Ghodsi, M.; Mallak, A.J.; Jafarian, A.H.; Montazer, M.; Forghanifard, M.M. DPPA2 Protein Expression is Associated with Gastric Cancer Metastasis. Asian Pac. J. Cancer Prev. 2016, 16, 8461–8465. [Google Scholar] [CrossRef] [Green Version]
  47. Hernandez, C.; Wang, Z.; Ramazanov, B.; Tang, Y.; Mehta, S.; Dambrot, C.; Lee, Y.-W.; Tessema, K.; Kumar, I.; Astudillo, M. Dppa2/4 facilitate epigenetic remodeling during reprogramming to pluripotency. Cell Stem Cell 2018, 23, 396–411.e8. [Google Scholar] [CrossRef] [Green Version]
  48. John, T.; Caballero, O.L.; Svobodová, S.J.; Kong, A.; Chua, R.; Browning, J.; Fortunato, S.; Deb, S.; Hsu, M.; Gedye, C.A.; et al. ECSA/DPPA2 is an Embryo-Cancer Antigen that Is Coexpressed with Cancer-Testis Antigens in Non–Small Cell Lung Cancer. Clin. Cancer Res. 2008, 14, 3291–3298. [Google Scholar] [CrossRef] [Green Version]
  49. Tchabo, N.E.; Mhawech-Fauceglia, P.; Caballero, O.L.; Villella, J.; Beck, A.F.; Miliotto, A.J.; Liao, J.; Andrews, C.; Lele, S.; Old, L.J.; et al. Expression and serum immunoreactivity of developmentally restricted differentiation antigens in epithelial ovarian cancer. Cancer Immun. 2009, 9, 6. [Google Scholar]
  50. Luo, W.; Li, S.; Peng, B.; Ye, Y.; Deng, X.; Yao, K. Embryonic stem cells markers SOX2, OCT4 and Nanog expression and their correlations with epithelial-mesenchymal transition in nasopharyngeal carcinoma. PLoS ONE 2013, 8, e56324. [Google Scholar]
  51. Moghbeli, M.; Sadrizadeh, A.; Forghanifard, M.M.; Mozaffari, H.M.; Golmakani, E.; Abbaszadegan, M.R. Role of Msi1 and PYGO2 in esophageal squamous cell carcinoma depth of invasion. J. Cell Commun. Signal. 2015, 10, 49–53. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Moghbeli, M.; Forghanifard, M.M.; Sadrizadeh, A.; Mozaffari, H.M.; Golmakani, E.; Abbaszadegan, M.R. Role of Msi1 and MAML1 in Regulation of Notch Signaling Pathway in Patients with Esophageal Squamous Cell Carcinoma. J. Gastrointest. Cancer 2015, 46, 365–369. [Google Scholar] [CrossRef] [PubMed]
Genes 13 02369 g001 550
Figure 1. Schematic view of the positions and sequences of seven E-box hexanucleotide consensus sequence CANNTG within 2 Kb upstream of the genes transcription start site. (A) BMI1 promoter, (B) Cripto1 promoter. (C) DPPA2 promoter. (D) KLF4 promoter. (E) SOX2 promoter.
Figure 1. Schematic view of the positions and sequences of seven E-box hexanucleotide consensus sequence CANNTG within 2 Kb upstream of the genes transcription start site. (A) BMI1 promoter, (B) Cripto1 promoter. (C) DPPA2 promoter. (D) KLF4 promoter. (E) SOX2 promoter.
Genes 13 02369 g001
Genes 13 02369 g002 550
Figure 2. Ectopic expression of TWIST1 gene has a significant impact on cancer stem cell self-renewal genes’ expression in KYSE-30 cells. Retroviral transduction enforced significant TWIST1 overexpression in pruf-IRES-GFP-hTWIST1 by nearly 9-fold compared to GFP control cells, causing a 4.5-, 3.2-, 5.5-, 3.5-, and 3.7-fold increase in the mRNA level of BMI1, CRIPTO1, DPPA2, KLF4, and SOX2. Forced expression of TWIST1 had no effect on the mRNA expression of NANOG and MSI1 genes.
Figure 2. Ectopic expression of TWIST1 gene has a significant impact on cancer stem cell self-renewal genes’ expression in KYSE-30 cells. Retroviral transduction enforced significant TWIST1 overexpression in pruf-IRES-GFP-hTWIST1 by nearly 9-fold compared to GFP control cells, causing a 4.5-, 3.2-, 5.5-, 3.5-, and 3.7-fold increase in the mRNA level of BMI1, CRIPTO1, DPPA2, KLF4, and SOX2. Forced expression of TWIST1 had no effect on the mRNA expression of NANOG and MSI1 genes.
Genes 13 02369 g002
Table
Table 1. Primer sequences used in real-time PCR.
Table 1. Primer sequences used in real-time PCR.
GenePrimer SequenceAnnealing T, °CAmplicon Size (bp)
BMI1F: CGTGTATTGTTCGTTACCTGGAGAC
R: CATTGGCAGCATCAGCAGAAGG		63204
CRIPTO1F: GGGATACAGCACAGTAAGGAG
R: ACGGTGGTAGTTGTCGAGTC		61295
DPPA2F: AGAAATACAATCCAGGTCATCTACTTC
R: GCATATCTTGCCGTTGTTCAGG		62237
KLF4F: TCTTCTCTTCGTTGACTTTG
R: GCCAGCGGTTATTCGG		55210
NANOGF: GGCAATGGTGTGACGCAGAAGGC
R:GCTCCAGGTTGAATTGTTCCAGGTC		65137
MSI1F: TGAGCAGTTTGGGAAGGTG
R: TCACACACTTTCTCCACGATG		62117
SOX2F: AACAGCCCGGACCGCGTCAA
R: TCGCAGCCGCTTAGCCTCGT		62189
TWIST1F: GGAGTCCGCAGTCTTACGAG
R: TCTGGAGGACCTGGTAGAGG		58201
GAPDHF: GGAAGGTGAAGGTCGGAGTCA
R: GTCATTGATGGCAACAATATCCACT		60101
Table
Table 2. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in BMI1 transcription unit. The asterisks indicate exonic E-boxes.
Table 2. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in BMI1 transcription unit. The asterisks indicate exonic E-boxes.
SequenceNumberPositions
CACTTG41294-99, 1731-36, 1825-30, 4914-19
CAGGTG
CAAGTG61125-30, 1942-47, 6084-89, 8852-57
CATCTG26458-63, 6811-16
CAGCTG15220-25
CACCTG15394-99 *
CATTTG81356-61, 1668-73, 2111-16, 2495-2500, 3853-58, 7739-44, 7809-14, 10114-19
CATATG11715-20
CAGATG36641-46, 6888-93 *, 9107-12
CAGTTG51334-39, 2046-51, 3434-39-4183-88, 4620-25
CAAATG51936-41, 5040-45, 6279-75, 6614-19, 8194-99
CACATG3998-03-3923-28, 5774-79
CAACTG32476-81-2611-16, 9243-48,
CATGTG42971-76, 7219-24, 8530-35, 8597-8602
CAATTG19351-56
Table
Table 3. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in Cripto1 transcription unit. The asterisks indicate exonic E-boxes.
Table 3. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in Cripto1 transcription unit. The asterisks indicate exonic E-boxes.
SequenceNumberPositions
CAGGTG24940-45, 6478-83
CAAGTG26447-52, 7838-43 *
CATCTG42312-17, 5186-91, 6687-92 *, 7493-98 *
CAGCTG12565-70
CACCTG11636-41, 1493-98, 2009-14, 2604-09, 3144-49, 3542-47, 3961-66, 4048-53, 4920-25, 5442-47 *, 6103-08
CATTTG62143-48, 3549-54, 4760-65 *, 6312-17, 6531-36, 6815-20 *
CATATG
CAGATG22062-2067, 6596-6601
CAAATG2324-329, 1339-1344
CACATG22246-51, 3626-31
CAACTG 730-735, 1546-1551, 7263-7268 *
CATGTG51646-1651, 1977-1982, 4274-4279, 4874-4879, 7121-71268 *
CACGTG17255-60 *
Table
Table 4. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in DPPA2 transcription unit. The asterisks indicate exonic E-boxes.
Table 4. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in DPPA2 transcription unit. The asterisks indicate exonic E-boxes.
SequenceNumberPositions
CACTTG81070-75, 1454-59, 4400-05, 5478-83, 5613-18, 10561-66, 16659-64, 20675-80
CAGGTG204994-99, 6239-44, 6505-10, 8682-87, 9174-79-9768-73, 15373-78, 10959-64, 11852-57 *, 12504-09, 15912-17, 16955-60, 17376-81, 17665-70, 18194-99, 18530-35, 19210-15, 19551-56, 20059-64, 21256-61
CAAGTG7705-10, 1385-90, 7490-95, 15082-87, 19075-80, 19646-51, 22042-47
CATCTG111855-60, 4637-42, 10316-21, 12695-700, 13351-56, 19349-54, 20068-73, 20688-93, 20992-97, 22177-82, 22367-72
CAGCTG47701-06, 12359-64, 19869-74, 19954-59
CACCTG14980-85, 6429-34, 9608-13, 9777-82, 11186-91, 12911-16, 13324-29, 13786-91, 15389-94, 16617-22, 16704-09, 17385-90, 21127-32, 21272-77
CATTTG101883-85, 2193-98, 2914-19, 7956-61, 8216-21, 8575-80, 12762-67, 20541-46, 21034-39, 21448-53
CATATG16471-76
CAGATG31980-85 *, 1440-45, 15296-301
CAGTTG65328-33, 7712-17, 8349-54 *, 13242-47, 13293-98, 22140-45
CAAATG62501-06, 3792-97, 3907-12 *, 7203-08 *, 15645-50, 16308-13, 18294-99
CACATG54534-39, 8006-11, 8611-16, 12999-13004, 22124-29
CAACTG115259-64
CATGTG102171-76, 3457-62, 6417-22, 11499-504, 11708-13, 13915-20, 14636-41, 17135-40, 18799-804, 19970-74
CAATTG62446-51, 10305-10, 11738-43, 16200-05, 16583-88, 22717-22 *
CACGTG19599-604
Table
Table 5. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in KLF4 transcription unit. The asterisks indicate exonic E-boxes.
Table 5. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in KLF4 transcription unit. The asterisks indicate exonic E-boxes.
SequenceNumberPositions
CACTTG22948-53 *, 3379-84 *
CAGGTG41259-64 *, 1537-42 *, 2751-56 *, 4554-59
CAGCTG3489-94, 1268-73 *, 1715-20 *
CACCTG5950-55 *, 1438-43 *, 2527-32 *, 3437-42 *, 4146-51
CAGATG43152-57 *, 4611-16 *, 4923-28 *, 5401-06 *
CAAATG31988-93, 4255-60, 5455-60 *
CAACTG14856-61 *
CACGTG2557-62, 2905-10 *
Table
Table 6. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in SOX2 transcription unit. The asterisks indicate exonic E-boxes.
Table 6. The number and positions of E-box hexanucleotide consensus sequence (CANNTG) in SOX2 transcription unit. The asterisks indicate exonic E-boxes.
SequenceNumberPositions
CAGCTG 965-70 *, 1548-53 *, 1972-77 *
CAGATG 1013-18 *
CAGTTG 1988-93 *
CAAATG 1541-46 *
CACATG 737-42 *, 920-25 *, 1313-18 *, 1382-87 *
CATGTG 1384-89 *
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Izadpanah, M.H.; Forghanifard, M.M. TWIST1 Plays Role in Expression of Stemness State Markers in ESCC. Genes 2022, 13, 2369. https://doi.org/10.3390/genes13122369

AMA Style

Izadpanah MH, Forghanifard MM. TWIST1 Plays Role in Expression of Stemness State Markers in ESCC. Genes. 2022; 13(12):2369. https://doi.org/10.3390/genes13122369

Chicago/Turabian Style

Izadpanah, Mohammad Hossein, and Mohammad Mahdi Forghanifard. 2022. "TWIST1 Plays Role in Expression of Stemness State Markers in ESCC" Genes 13, no. 12: 2369. https://doi.org/10.3390/genes13122369

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop