The Chloroplast Genome of Wild Saposhnikovia divaricata: Genomic Features, Comparative Analysis, and Phylogenetic Relationships
Abstract
:1. Introduction
2. Results and Discussion
2.1. Genomic Features of the Wild S. divaricata CpDNA
2.2. Comparative CpDNA Analysis of Seven Species under Subfamily Apioideae
2.3. Identification of Repeat Sequences and SSRs in Wild S. divaricata CpDNA
2.4. Phylogenetic Analysis of 47 Taxa under Subfamily Apioideae Based on CpDNA Sequences
3. Materials and Methods
3.1. Sampling, CpDNA Extraction, and Sequencing
3.2. CpDNA Assembly and Annotation
3.3. CpDNA Comparison and Sequence Divergence Analysis
3.4. Phylogenetic Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kreiner, J.; Pang, E.; Lenon, G.B.; Yang, A.W.H. Saposhnikoviae divaricata: A phytochemical, pharmacological, and pharmacokinetic review. Chin. J. Nat. Med. 2017, 15, 255–264. [Google Scholar] [CrossRef]
- Yang, J.L.; Dhodary, B.; Ha, T.K.Q.; Kim, J.; Kim, E.; Oh, W.K. Three new coumarins from Saposhnikovia divaricata and their porcine epidemic diarrhea virus (PEDV) inhibitory activity. Tetrahedron 2015, 71, 4651–4658. [Google Scholar] [CrossRef] [PubMed]
- Batsukh, Z.; Toume, K.; Javzan, B.; Kazuma, K.; Cai, S.; Hayashi, S.; Atsumi, T.; Yoshitomi, T.; Uchiyama, N.; Maruyama, T.; et al. Characterization of metabolites in Saposhnikovia divaricata root from Mongolia. J. Nat. med. 2020, 75, 11–27. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Wang, C.C.; Wang, W.L.; Xu, J.P.; Wang, J.; Zhang, C.H.; Li, M.H. Saposhnikovia divaricata—An ethnopharmacological, phytochemical and pharmacological review. Chin. J. Integr. Med. 2020, 26, 873–880. [Google Scholar] [CrossRef] [PubMed]
- Tai, J.; Cheung, S. Anti-proliferative and antioxidant activities of Saposhnikovia divaricata. Oncol. Rep. 2007, 18, 227–234. [Google Scholar] [CrossRef] [Green Version]
- Chun, J.M.; Kim, H.S.; Lee, A.Y.; Kim, S.H.; Kim, H.K. Anti-inflammatory and antiosteoarthritis effects of Saposhnikovia divaricata ethanol extract: In vitro and in vivo studies. Evid. Based Complementary Altern. Med. 2016, 2016, 1984238. [Google Scholar]
- Okuyama, E.; Hasegawa, T.; Matsushita, T.; Fujimoto, H.; Ishibashi, M.; Yamazaki, M. Analgesic components of saposhnikovia root (Saposhnikovia divaricata). Chem. Pharm. Bull. 2001, 49, 154–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, X.; Niu, Y.; Zheng, J.; Liu, H.; Jiang, G.; Chen, J.; Hong, M. Radix Saposhnikovia extract suppresses mouse allergic contact dermatitis by regulating dendritic-cell-activated Th1 cells. Phytomedicine 2015, 22, 1150–1158. [Google Scholar] [CrossRef] [PubMed]
- Neuhaus, H.; Emes, M. Nonphotosynthetic metabolism in plastids. Annu. Rev. Plant Biol. 2000, 51, 111–140. [Google Scholar] [CrossRef] [PubMed]
- Vesteg, M.; Vacula, R.; Krajcovic, J. On the origin of chloroplasts, import mechanisms of chloroplast-targeted proteins, and loss of photosynthetic ability–review. Folia Microbiol. 2009, 54, 303–321. [Google Scholar] [CrossRef]
- Henry, R.J. Plant Diversity and Evolution: Genotypic and Phenotypic Variation in Higher Plants; CABI Publishing: Cambridge, MA, USA, 2005. [Google Scholar]
- Raubeson, L.A.; Jansen, R.K. Chloroplast genomes of plants. In Plant Diversity and Evolution: Genotypic and Phenotypic Variation in Higher Plants; CABI Publishing: Cambridge, MA, USA, 2005; pp. 45–68. [Google Scholar]
- Whitfeld, P.R.; Bottomley, W. Organization and structure of chloroplast genes. Annu. Rev. Plant Physiol. 1983, 34, 279–310. [Google Scholar] [CrossRef]
- Jian, H.Y.; Zhang, Y.H.; Yan, H.J.; Qiu, X.Q.; Wang, Q.G.; Li, S.B.; Zhang, S.D. The complete chloroplast genome of a key ancestor of modern roses, Rosa chinensis var. spontanea, and a comparison with congeneric species. Molecules 2018, 23, 389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saina, J.K.; Li, Z.Z.; Gichira, A.W.; Liao, Y.Y. The complete chloroplast genome sequence of tree of heaven (Ailanthus altissima (Mill.) (Sapindales: Simaroubaceae), an important pantropical tree. Int. J. Mol. Sci. 2018, 19, 929. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, Z.; Zhu, Z.; Zhang, H.; Zhong, Y.; Wang, W.; Zhang, J.; Wu, J. The complete chloroplast genome of Saposhnikovia divaricata. Mitochondrial DNA B 2019, 5, 360–361. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Geng, M.; Li, Y.; Xu, Z.; Xu, M.; Li, M. Characterization of the complete plastome of Saposhnikovia divaricata (Turcz.) Schischk. Mitochondrial DNA B 2020, 5, 786–787. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.O.; Kim, K.; Lee, S.C.; Lee, J.; Lee, J.; Kim, S.; Yang, T.J. The complete chloroplast genome sequence of Ledebouriella seseloides (Hoffm.) H. Wolff. Mitochondrial DNA A DNA Mapp. Seq. Anal. 2016, 27, 3498–3499. [Google Scholar] [CrossRef]
- Komarov, V.L. Saposhnikovia divaricata (Turcz.) Schischk. 1951. Available online: https://www.ipni.org/n/847902-1 (accessed on 14 September 2020).
- Zhang, R.; Li, Q.; Gao, J.; Qu, M.; Ding, P. The complete chloroplast genome sequence of the medicinal plant Morinda officinalis (Rubiaceae), an endemic to China. Mitochondrial DNA A 2016, 27, 4324–4325. [Google Scholar] [CrossRef]
- Ding, P.; Shao, Y.; Li, Q.; Gao, J.; Zhang, R.; Lai, X.; Wang, D.; Zhang, H. The complete chloroplast genome sequence of the medicinal plant Andrographis paniculata. Mitochondrial DNA A 2016, 27, 2347–2348. [Google Scholar] [CrossRef]
- Callis, J.; Fromm, M.; Walbot, V. Introns increase gene expression in cultured maize cells. Genes Dev. 1987, 1, 1183–1200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bailey, C.D.; Doyle, J.J. The chloroplast rpl2 intron and ORF184 as phylogenetic markers in the legume tribe Desmodieae. Syst. Bot. 1997, 22, 133–138. [Google Scholar] [CrossRef]
- Downie, S.R.; Olmstead, R.G.; Zurawski, G.; Soltis, D.E.; Soltis, P.S.; Watson, J.C.; Palmer, J.D. Six independent losses of the chloroplast DNA rpl2 intron in dicotyledons: Molecular and phylogenetic implications. Evolution 1991, 45, 1245–1259. [Google Scholar] [CrossRef] [PubMed]
- Hägg, P.; Pohl, J.W.; Abdulkarim, F.; Isaksson, L.A. A host/plasmid system that is not dependent on antibiotics and antibiotic resistance genes for stable plasmid maintenance in Escherichia coli. J. Biotechnol. 2004, 111, 17–30. [Google Scholar] [CrossRef]
- Millen, R.S.; Olmstead, R.G.; Adams, K.L.; Palmer, J.D.; Lao, N.T.; Heggie, L.; Kavanagh, T.A.; Hibberd, J.M.; Gray, J.C.; Morden, C.W.; et al. Many parallel losses of infA from chloroplast DNA during angiosperm evolution with multiple independent transfers to the nucleus. Plant Cell 2001, 13, 645–658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolfe, K.H.; Morden, C.W.; Ems, S.C.; Palmer, J.D. Rapid evolution of the plastid translational apparatus in a nonphotosynthetic plant: Loss or accelerated sequence evolution of tRNA and ribosomal protein genes. J. Mol. Evol. 1992, 35, 304–317. [Google Scholar] [CrossRef] [PubMed]
- Presnyak, V.; Alhusaini, N.; Chen, Y.H.; Martin, S.; Morris, N.; Kline, N.; Olson, S.; Weinberg, D.; Baker, K.E.; Graveley, B.R.; et al. Codon optimality is a major determinant of mRNA stability. Cell 2015, 160, 1111–1124. [Google Scholar] [CrossRef] [Green Version]
- Hanson, G.; Coller, J. Codon optimality, bias and usage in translation and mRNA decay. Nat. Rev. Mol. Cell Biol. 2018, 19, 20. [Google Scholar] [CrossRef]
- Coghlan, A.; Wolfe, K.H. Relationship of codon bias to mRNA concentration and protein length in Saccharomyces cerevisiae. Yeast 2000, 16, 1131–1145. [Google Scholar] [CrossRef]
- Qian, J.; Song, J.; Gao, H.; Zhu, Y.; Xu, J.; Pang, X.; Yao, H.; Sun, C.; Li, X.; Li, C.; et al. The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza. PLoS ONE 2013, 8, e57607. [Google Scholar] [CrossRef]
- Wang, L.; Yu, X.; Xu, W.; Zhang, J.; Lin, H.; Zhao, Y. Complete chloroplast genome sequencing support Angelica decursiva is an independent species from Peucedanum praeruptorum. Physiol. Mol. Biol. Plants 2021, 27, 2503–2515. [Google Scholar] [CrossRef]
- Wang, R.J.; Cheng, C.L.; Chang, C.C.; Wu, C.L.; Su, T.M.; Chaw, S.M. Dynamics and evolution of the inverted repeat-large single copy junctions in the chloroplast genomes of monocots. BMC Evol. Biol. 2008, 8, 36. [Google Scholar] [CrossRef] [Green Version]
- Yao, H.; Song, J.Y.; Ma, X.Y.; Liu, C.; Li, Y.; Xu, H.X.; Han, J.P.; Duan, L.S.; Chen, S.L. Identification of Dendrobium species by a candidate DNA barcode sequence: The chloroplast psbA-trnH intergenic region. Planta Med. 2009, 75, 667–669. [Google Scholar] [CrossRef] [PubMed]
- Degtjareva, G.V.; Logacheva, M.D.; Samigullin, T.H.; Terentieva, E.I.; Valiejo-Roman, C.M. Organization of chloroplast psbA-trnH intergenic spacer in dicotyledonous angiosperms of the family Umbelliferae. Biochemistry 2012, 77, 1056–1064. [Google Scholar] [CrossRef] [PubMed]
- Aldrich, J.; Cherney, B.W.; Merlin, E. The role of insertions/deletions in the evolution of the intergenic region between psbA and trnH in the chloroplast genome. Curr. Genet. 1988, 14, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef] [Green Version]
- Cato, S.; Richardson, T. Inter-and intraspecific polymorphism at chloroplast SSR loci and the inheritance of plastids in Pinus radiata D. Don. Theor. Appl. Genet. 1996, 93, 587–592. [Google Scholar] [CrossRef]
- Liu, Y.; Huo, N.; Dong, L.; Wang, Y.; Zhang, S.; Young, H.A.; Feng, X.; Gu, Y.Q. Complete chloroplast genome sequences of Mongolia medicine Artemisia frigida and phylogenetic relationships with other plants. PLoS ONE 2013, 8, e57533. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-fast All-In-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods. 2012, 9, 357–359. [Google Scholar] [CrossRef] [Green Version]
- Dierckxsens, N.; Mardulyn, P.; Smits, G. NOVOPlasty: De Novo assembly of organelle genomes from whole genome data. Nucleic Acids Res. 2017, 45, e18. [Google Scholar]
- Wyman, S.K.; Jansen, R.K.; Boore, J.L. Automatic annotation of organellar genomes with DOGMA. Bioinformatics 2004, 20, 3252–3255. [Google Scholar] [CrossRef] [Green Version]
- Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq-Versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef] [PubMed]
- Chan, P.P.; Lowe, T.M. tRNAscan-SE: Searching for tRNA genes in genomic sequences. Methods Mol. Biol. 2019, 1962, 1–14. [Google Scholar] [PubMed]
- Laslett, D.; Canback, B. ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences. Nucleic Acids Res. 2004, 32, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) Version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef] [Green Version]
- Sharp, P.M.; Li, W.H. The codon Adaptation Indexa measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 1987, 15, 1281–1295. [Google Scholar] [CrossRef] [Green Version]
- Rice, P.; Longden, I.; Bleasby, A. EMBOSS: The european molecular biology open software suite. Trends Genet. 2000, 16, 276–277. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [Green Version]
- Petkau, A.; Stuart-Edwards, M.; Stothard, P.; Van Domselaar, G. Interactive microbial genome visualization with GView. Bioinformatics 2010, 26, 3125–3126. [Google Scholar] [CrossRef]
- Amiryousefi, A.; Hyvönen, J.; Poczai, P. IRscope: An Online Program to Visualize the junction Sites of Chloroplast Genomes. Bioinformatics 2018, 34, 3030–3031. [Google Scholar] [CrossRef]
- Brudno, M.; Do, C.B.; Cooper, G.M.; Kim, M.F.; Davydov, E.; NISC Comparative Sequencing Program; Green, E.D.; Sidow, A.; Batzoglou, S. LAGAN and Multi-LAGAN: Efficient Tools for Large-Scale Multiple Alignment of Genomic DNA. Genome Res. 2003, 13, 721–731. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frazer, K.A.; Pachter, L.; Poliakov, A.; Rubin, E.M.; Dubchak, I. VISTA: Computational Tools for Comparative Genomics. Nucleic Acids Res. 2004, 32, W273–W279. [Google Scholar] [CrossRef] [PubMed]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately maximum-likelihood trees for large alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective stochastic algorithm for estimating Maximum-Likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods. 2017, 14, 587–589. [Google Scholar] [CrossRef] [Green Version]
Group of Genes | Gene Name | Number | |
---|---|---|---|
Self-replication | rRNA genes | rrn4.5 (×2), rrn5 (×2), rrn16 (×2), rrn23 (×2) | 8 |
tRNA genes | * trnA-UGC (×2), trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, * trnG-UCC (×2), trnH-GUG, trnM-CAU, * trnI-GAU (×2), * trnK-UUU, trnL-CAA (×2), * trnL-UAA (×2), trnI-CAU, trnN-GUU (×2), trnP-UGG, trnQ-UUG, trnR-ACG (×2), trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU, trnT-UGU, trnV-GAC (×2), * trnV-UAC, trnW-CCA, trnY-GUA | 36 | |
Ribosomal small subunit | rps2, rps3, rps4, rps7 (×2), rps8, rps11, rps12 (×2), rps14, rps15, * rps16, rps18, rps19 | 14 | |
Ribosomal large subunit | * rpl2, rpl14, * rpl16, rpl20, rpl22, rpl23, rpl32, rpl33, rpl36 | 9 | |
DNA-dependent RNA polymerase | rpoA, rpoB, * rpoC1, rpoC2 | 4 | |
photosynthesis | Large subunit of rubisco | rbcL | 1 |
Photosystem I | psaA, psaB, psaC, psaI, psaJ | 5 | |
Photosystem II | psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ | 15 | |
NADH dehydrogenase | * ndhA, * ndhB (×2), ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK | 12 | |
Cytochrome b/f complex | petA, * petB, * petD, petG, petL, petN | 6 | |
ATP synthase | atpA, atpB, atpE, * atpF, atpH, atpI | 6 | |
other | Maturase | matK | 1 |
Subunit of acetyl-CoA carboxylase | accD | 1 | |
Envelope membrane protein | cemA | 1 | |
Protease | ** clpP | 1 | |
C-type cytochrome synthesis | ccsA | 1 | |
Translation initiation factor | infA | 1 | |
Functions unknown | Conserved open reading frames | ycf1 (×2), ycf2, ** ycf3, ycf4, ycf15 (×2) | 7 |
Total | 129 |
Gene | Location | Exon1 (bp) | Intron1 (bp) | Exon2 (bp) | Intron2 (bp) | Exon3 (bp) |
---|---|---|---|---|---|---|
trnK-UUU | LSC | 37 | 2532 | 35 | ||
trnI-GAU | IRb | 37 | 968 | 35 | ||
trnI-GAU | IRa | 37 | 968 | 35 | ||
trnA-UGC | IRb | 38 | 818 | 35 | ||
trnA-UGC | IRa | 38 | 818 | 35 | ||
trnG-UCC | LSC | 23 | 703 | 48 | ||
trnV-UAC | LSC | 39 | 569 | 35 | ||
trnL-UAA | LSC | 35 | 502 | 50 | ||
1 rps12 | LSC + IRa | 114 | 232 | 538 | 26 | |
1 rps12 | LSC + IRb | 114 | 232 | 538 | 26 | |
rps16 | LSC | 40 | 859 | 197 | ||
rpoC1 | LSC | 432 | 748 | 1605 | ||
rpl2 | LSC | 394 | 651 | 434 | ||
rpl16 | LSC | 9 | 950 | 399 | ||
ndhA | SSC | 553 | 1099 | 539 | ||
ndhB | LSC | 777 | 682 | 756 | ||
ndhB | IRa | 777 | 682 | 756 | ||
PetB | LSC | 6 | 758 | 642 | ||
PetD | LSC | 8 | 750 | 475 | ||
atpF | LSC | 145 | 711 | 401 | ||
clpP | LSC | 231 | 635 | 292 | 848 | 71 |
ycf3 | LSC | 153 | 776 | 228 | 717 | 126 |
ID | Size (bp) | Repeat 1 | Type 1 | Size (bp) | Repeat 2 | Mismatch (bp) | E-Value | Gene | Region |
---|---|---|---|---|---|---|---|---|---|
1 | 34 | 7110 | F | 32 | 7126 | 3 | 0.00011 | IGS | LSC |
2 | 32 | 8400 | F | 31 | 36,451 | 2 | 1.90 × 10−5 | IGS | LSC |
3 | 34 | 9846 | R | 32 | 115,685 | 3 | 0.00011 | IGS | LSC;SSC |
4 | 35 | 9851 | C | 34 | 115,668 | 3 | 3.00 × 10−5 | IGS | LSC;SSC |
5 | 35 | 9851 | C | 32 | 115,670 | 3 | 3.00 × 10−5 | IGS | LSC;SSC |
6 | 35 | 20,788 | F | 35 | 20,837 | 3 | 3.00 × 10−5 | IGS | LSC |
7 | 36 | 32,147 | R | 37 | 32,160 | 3 | 2.23 × 10−6 | IGS | LSC |
8 | 39 | 44,679 | F | 39 | 98,962 | 2 | 1.74 × 10−9 | ycf3 (intron); IGS | LSC;IRb |
9 | 39 | 44,679 | F | 39 | 122,483 | 3 | 1.64 × 10−7 | ycf3 (intron); ndhA (intron) | LSC;SSC |
10 | 35 | 44,682 | F | 35 | 95,893 | 3 | 3.00 × 10−5 | ycf3 (intron); ndhB | LSC;IRb |
11 | 33 | 44,685 | F | 33 | 98,968 | 1 | 3.27 × 10−8 | ycf3 (intron); IGS | LSC;IRb |
12 | 31 | 51,905 | R | 31 | 64,144 | 1 | 4.92 × 10−7 | IGS | LSC |
13 | 35 | 51,907 | R | 35 | 51,907 | 2 | 3.57 × 10−7 | IGS | LSC |
14 | 32 | 51,907 | F | 32 | 51,923 | 2 | 1.90 × 10−5 | IGS | LSC |
15 | 37 | 51,911 | F | 36 | 64,143 | 3 | 2.23 × 10−6 | IGS | LSC |
16 | 42 | 51,912 | R | 42 | 51,912 | 2 | 3.15 × 10−11 | IGS | LSC |
17 | 42 | 51,912 | R | 40 | 51,912 | 2 | 3.15 × 10−11 | IGS | LSC |
18 | 28 | 51,912 | F | 28 | 115,670 | 0 | 8.53 × 10−8 | IGS | LSC;SSC |
19 | 31 | 51,912 | R | 31 | 115,663 | 1 | 4.92 × 10−7 | IGS | LSC;SSC |
20 | 36 | 51,913 | R | 39 | 51,916 | 3 | 1.64 × 10−7 | IGS | LSC |
21 | 35 | 51,914 | R | 37 | 115,674 | 3 | 2.23 × 10−6 | IGS | LSC;SSC |
22 | 33 | 51,922 | F | 32 | 115,663 | 2 | 5.07 × 10−6 | IGS | LSC;SSC |
23 | 30 | 51,925 | R | 29 | 115,669 | 1 | 1.90 × 10−6 | IGS | LSC;SSC |
24 | 32 | 52,673 | R | 32 | 52,673 | 2 | 1.90 × 10−5 | IGS | LSC |
25 | 31 | 64,142 | R | 31 | 64,142 | 2 | 7.14 × 10−5 | IGS | LSC |
26 | 35 | 64,144 | C | 36 | 115,671 | 3 | 8.18 × 10−6 | IGS | LSC;SSC |
27 | 25 | 67,922 | F | 25 | 67,946 | 0 | 5.46 × 10−6 | IGS | LSC |
28 | 84 | 91,433 | F | 84 | 91,451 | 1 | 1.64 × 10−38 | ycf2 | LSC |
29 | 70 | 91,433 | F | 70 | 91,469 | 3 | 2.12 × 10−25 | ycf2 | LSC |
30 | 52 | 91,433 | F | 52 | 91,487 | 3 | 5.90 × 10−15 | ycf2 | LSC |
31 | 59 | 91,440 | F | 59 | 91,476 | 1 | 1.30 × 10−23 | ycf2 | LSC |
32 | 45 | 91,440 | F | 45 | 91,494 | 2 | 5.66 × 10−13 | ycf2 | LSC |
33 | 59 | 91,458 | F | 59 | 91,476 | 0 | 1.85 × 10−26 | ycf2 | LSC |
34 | 41 | 91,458 | F | 41 | 91,494 | 0 | 1.27 × 10−15 | ycf2 | LSC |
35 | 23 | 91,458 | F | 23 | 91,512 | 0 | 8.73 × 10−5 | ycf2 | LSC |
36 | 44 | 94,003 | F | 44 | 94,024 | 1 | 1.04 × 10−14 | IGS | IRb |
37 | 36 | 94,011 | F | 36 | 94032 | 0 | 1.30 × 10−12 | IGS | IRb |
38 | 41 | 98,960 | F | 41 | 122,481 | 3 | 1.19 × 10−8 | IGS;ndhA (intron) | IRb;SSC |
39 | 33 | 98,968 | F | 33 | 122,489 | 2 | 5.07 × 10−6 | IGS;ndhA (intron) | IRb;SSC |
40 | 42 | 99,905 | F | 42 | 99,926 | 0 | 3.18 × 10−16 | ycf15 | IRb |
41 | 34 | 107,943 | F | 34 | 107,975 | 1 | 8.43 × 10−9 | IGS | IRb |
42 | 31 | 108,296 | F | 31 | 132,709 | 2 | 7.14 × 10−5 | IGS | IRb;IRa |
43 | 23 | 114,349 | F | 23 | 114,381 | 0 | 0.0000873 | IGS | SSC |
44 | 28 | 115,668 | R | 28 | 115,668 | 0 | 8.53 × 10−8 | IGS | SSC |
45 | 31 | 122,640 | R | 31 | 122,640 | 0 | 1.33 × 10−9 | ndhA (intron) | SSC |
46 | 34 | 133,027 | F | 34 | 133,059 | 1 | 8.43 × 10−9 | IGS | IRa |
47 | 31 | 133,030 | F | 30 | 133,063 | 2 | 7.14 × 10−5 | IGS | IRa |
48 | 23 | 133,038 | F | 23 | 133,070 | 0 | 0.0000873 | IGS | IRa |
49 | 42 | 141,068 | F | 42 | 141,089 | 0 | 3.18 × 10−16 | ycf15 | IRa |
50 | 44 | 146,968 | F | 44 | 146,989 | 1 | 1.04 × 10−14 | IGS | IRa |
ID | Type | Repeat Motif | bp | Start | End | Region | Gene | ID | Type | Repeat Motif | bp | Start | End | Region | Gene |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | p1 | (A)10 | 10 | 1539 | 1548 | LSC | 26 | c | (A)11gacaggtttttgctccttttcgtataatattcttgtattcttgtaa Tagaaaaataatagaaaag (A)10 | 86 | 71,813 | 71,898 | LSC | clpP | |
2 | p1 | (A)10 | 10 | 1794 | 1803 | LSC | trnK-UUU | 27 | p1 | (T)10 | 10 | 72,637 | 72,646 | LSC | |
3 | p3 | (TTA)5 | 15 | 5419 | 5433 | LSC | rps16 | 28 | p1 | (T)12 | 12 | 83,124 | 83,135 | LSC | rpl16 |
4 | p1 | (A)10 | 10 | 9393 | 9402 | LSC | trnR-UCU | 29 | p1 | (T)16 | 16 | 84,843 | 84,858 | LSC | |
5 | p2 | (AT)7 | 14 | 9867 | 9880 | LSC | 30 | p1 | (G)13 | 13 | 94,287 | 94,299 | IRb | ||
6 | p2 | (AT)9 | 18 | 13,059 | 13,076 | LSC | 31 | p1 | (T)13 | 13 | 99,335 | 99,347 | IRb | ||
7 | p1 | (A)14 | 14 | 16,406 | 16,419 | LSC | 32 | p1 | (T)10 | 10 | 103,203 | 103,212 | IRb | trnI-GAU | |
8 | p1 | (T)11 | 11 | 18,651 | 18,661 | LSC | rpoC2 | 33 | p1 | (G)14 | 14 | 104,444 | 104,457 | IRb | trnA-UGC |
9 | p1 | (T)12 | 12 | 26,380 | 26,391 | LSC | 34 | p1 | (A)10 | 10 | 111,049 | 111,058 | IRb | ycf1 | |
10 | p1 | (A)10 | 10 | 27,392 | 27,401 | LSC | 35 | p1 | (A)11 | 11 | 111,833 | 111,843 | IRb | ycf1 | |
11 | p3 | (AAT)6 | 18 | 28,642 | 28,659 | LSC | 36 | p1 | (A)12 | 12 | 115,539 | 115,550 | SSC | ||
12 | p1 | (T)12 | 12 | 29,602 | 29,613 | LSC | 37 | c | (TA)6ttt(TA) 8aattatatatatga(AT)6 | 57 | 115,669 | 115,725 | SSC | ||
13 | p1 | (T)12 | 12 | 32,753 | 32,764 | LSC | 38 | p1 | (A)13 | 13 | 116,776 | 116,788 | SSC | ccsA | |
14 | p1 | (A)12 | 12 | 33,320 | 33,331 | LSC | 39 | p1 | (A)11 | 11 | 120,333 | 120,343 | SSC | ||
15 | p1 | (C)10 | 10 | 37,141 | 37,150 | LSC | 40 | p1 | (T)10 | 10 | 121,130 | 121,139 | SSC | ||
16 | p1 | (A)13 | 13 | 43,455 | 43,467 | LSC | 41 | p1 | (T)15 | 15 | 128,046 | 128,060 | SSC | ||
17 | p1 | (T)10 | 10 | 45,269 | 45,278 | LSC | ycf3 | 42 | p1 | (T)11 | 11 | 128,410 | 128,420 | SSC | ycf1 |
18 | p2 | (TA)7 | 14 | 47,465 | 47,478 | LSC | 43 | p1 | (T)10 | 10 | 128,671 | 128,680 | SSC | ycf1 | |
19 | p2 | (TA)7 | 14 | 51,926 | 51,939 | LSC | 44 | p1 | (T)11 | 11 | 129,194 | 129,204 | IRa | ||
20 | p1 | (T)10 | 10 | 52,688 | 52,697 | LSC | 45 | p1 | (T)10 | 10 | 129,979 | 129,988 | IRa | ||
21 | p1 | (T)10 | 10 | 55,648 | 55,657 | LSC | atpB | 46 | p1 | (C)14 | 14 | 136,580 | 136,593 | IRa | trnA-UGC |
22 | p1 | (A)18 | 18 | 56,234 | 56,251 | LSC | 47 | p1 | (A)10 | 10 | 137,825 | 137,834 | IRa | trnI-GAU | |
23 | p1 | (T)10 | 10 | 58,021 | 58,030 | LSC | 48 | p1 | (A)13 | 13 | 141,690 | 141,702 | IRa | ||
24 | p1 | (T)10 | 10 | 60,531 | 60,540 | LSC | 49 | p1 | (C)13 | 13 | 146,738 | 146,750 | IRa | ||
25 | c | (A)10tatcagaacttt (TA)6 | 34 | 64,123 | 64,156 | LSC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yi, S.; Lu, H.; Wang, W.; Wang, G.; Xu, T.; Li, M.; Gu, F.; Chen, C.; Han, B.; Liu, D. The Chloroplast Genome of Wild Saposhnikovia divaricata: Genomic Features, Comparative Analysis, and Phylogenetic Relationships. Genes 2022, 13, 931. https://doi.org/10.3390/genes13050931
Yi S, Lu H, Wang W, Wang G, Xu T, Li M, Gu F, Chen C, Han B, Liu D. The Chloroplast Genome of Wild Saposhnikovia divaricata: Genomic Features, Comparative Analysis, and Phylogenetic Relationships. Genes. 2022; 13(5):931. https://doi.org/10.3390/genes13050931
Chicago/Turabian StyleYi, Shanyong, Haibo Lu, Wei Wang, Guanglin Wang, Tao Xu, Mingzhi Li, Fangli Gu, Cunwu Chen, Bangxing Han, and Dong Liu. 2022. "The Chloroplast Genome of Wild Saposhnikovia divaricata: Genomic Features, Comparative Analysis, and Phylogenetic Relationships" Genes 13, no. 5: 931. https://doi.org/10.3390/genes13050931