Genomic Analysis of Non-B Nucleic Acids Structures in SARS-CoV-2: Potential Key Roles for These Structures in Mutability, Translation, and Replication?
Abstract
:1. Introduction
2. Materials and Methods
2.1. Selection of Sequences
2.2. Detection of Mutations within IRs, Prediction of Pseudoknot Formation, and G4-Analysis
2.3. Statistical Analysis
3. Results
3.1. There Is a Large Variation in the Number of Defining Mutations Falling within IRs between SARS-CoV-2 Variants
3.2. Pseudoknots Are Predicted to Occur near the Sites of Several Key Mutations
3.3. G4 Are Predicted to Form on the Negative Strand Genome in SARS-CoV-2
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Skourti-Stathaki, K.; Proudfoot, N.J. A Double-Edged Sword: R Loops as Threats to Genome Integrity and Powerful Regulators of Gene Expression. Genes Dev. 2014, 28, 1384–1396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Voineagu, I.; Narayanan, V.; Lobachev, K.S.; Mirkin, S.M. Replication Stalling at Unstable Inverted Repeats: Interplay between DNA Hairpins and Fork Stabilizing Proteins. Proc. Natl. Acad. Sci. USA 2008, 105, 9936–9941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saranathan, N.; Vivekanandan, P. G-Quadruplexes: More Than Just a Kink in Microbial Genomes. Trends Microbiol. 2019, 27, 148–163. [Google Scholar] [CrossRef] [Green Version]
- Griffin, B.D.; Bass, H.W. Review: Plant G-Quadruplex (G4) Motifs in DNA and RNA; Abundant, Intriguing Sequences of Unknown Function. Plant Sci. 2018, 269, 143–147. [Google Scholar] [CrossRef]
- Brierley, I.; Pennell, S.; Gilbert, R.J.C. Viral RNA Pseudoknots: Versatile Motifs in Gene Expression and Replication. Nat. Rev. Microbiol. 2007, 5, 598–610. [Google Scholar] [CrossRef]
- Pearson, C.E.; Zorbas, H.; Price, G.B.; Zannis-Hadjopoulos, M. Inverted Repeats, Stem-Loops, and Cruciforms: Significance for Initiation of DNA Replication. J. Cell. Biochem. 1996, 63, 1–22. [Google Scholar] [CrossRef]
- del Solar, G.; Giraldo, R.; Ruiz-Echevarría, M.J.; Espinosa, M.; Díaz-Orejas, R. Replication and Control of Circular Bacterial Plasmids. Microbiol. Mol. Biol. Rev. 1998, 62, 434–464. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, S.; Wang, G.; Bacolla, A.; Zhao, J.; Spitser, S.; Vasquez, K.M. Short Inverted Repeats Are Hotspots for Genetic Instability: Relevance to Cancer Genomes. Cell Rep. 2015, 10, 1674–1680. [Google Scholar] [CrossRef] [Green Version]
- Sadler, J.R.; Sasmor, H.; Betz, J.L. A Perfectly Symmetric Lac Operator Binds the Lac Repressor Very Tightly. Proc. Natl. Acad. Sci. USA 1983, 80, 6785–6789. [Google Scholar] [CrossRef] [Green Version]
- Butler, D.K.; Yasuda, L.E.; Yao, M.C. Induction of Large DNA Palindrome Formation in Yeast: Implications for Gene Amplification and Genome Stability in Eukaryotes. Cell 1996, 87, 1115–1122. [Google Scholar] [CrossRef]
- Okamura, K.; Chung, W.-J.; Lai, E.C. The Long and Short of Inverted Repeat Genes in Animals: MicroRNAs, Mirtrons and Hairpin RNAs. Cell Cycle 2008, 7, 2840–2845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wroblewski, T.; Matvienko, M.; Piskurewicz, U.; Xu, H.; Martineau, B.; Wong, J.; Govindarajulu, M.; Kozik, A.; Michelmore, R.W. Distinctive Profiles of Small RNA Couple Inverted Repeat-Induced Post-Transcriptional Gene Silencing with Endogenous RNA Silencing Pathways in Arabidopsis. RNA 2014, 20, 1987–1999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Staple, D.W.; Butcher, S.E. Pseudoknots: RNA Structures with Diverse Functions. PLoS Biol. 2005, 3, e213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neupane, K.; Munshi, S.; Zhao, M.; Ritchie, D.B.; Ileperuma, S.M.; Woodside, M.T. Anti-Frameshifting Ligand Active against SARS Coronavirus-2 Is Resistant to Natural Mutations of the Frameshift-Stimulatory Pseudoknot. J. Mol. Biol. 2020, 432, 5843–5847. [Google Scholar] [CrossRef] [PubMed]
- Varshney, D.; Spiegel, J.; Zyner, K.; Tannahill, D.; Balasubramanian, S. The Regulation and Functions of DNA and RNA G-Quadruplexes. Nat. Rev. Mol. Cell Biol. 2020, 21, 459–474. [Google Scholar] [CrossRef]
- Cebrián, R.; Belmonte-Reche, E.; Pirota, V.; de Jong, A.; Morales, J.C.; Freccero, M.; Doria, F.; Kuipers, O.P. G-Quadruplex DNA as a Target in Pathogenic Bacteria: Efficacy of an Extended Naphthalene Diimide Ligand and Its Mode of Action. J. Med. Chem. 2022, 65, 4752–4766. [Google Scholar] [CrossRef] [PubMed]
- Abiri, A.; Lavigne, M.; Rezaei, M.; Nikzad, S.; Zare, P.; Mergny, J.-L.; Rahimi, H.-R. Unlocking G-Quadruplexes as Antiviral Targets. Pharmacol. Rev. 2021, 73, 897–923. [Google Scholar] [CrossRef]
- Cantara, A.; Luo, Y.; Dobrovolná, M.; Bohalova, N.; Fojta, M.; Verga, D.; Guittat, L.; Cucchiarini, A.; Savrimoutou, S.; Häberli, C.; et al. G-Quadruplexes in Helminth Parasites. Nucleic Acids Res. 2022, 50, 2719–2735. [Google Scholar] [CrossRef]
- Warner, E.F.; Bohálová, N.; Brázda, V.; Waller, Z.A.E.; Bidula, S. Analysis of Putative Quadruplex-Forming Sequences in Fungal Genomes: Novel Antifungal Targets? Microb. Genom. 2021, 7, 000570. [Google Scholar] [CrossRef]
- Goswami, P.; Bartas, M.; Lexa, M.; Bohálová, N.; Volná, A.; Červeň, J.; Červeňová, V.; Pečinka, P.; Špunda, V.; Fojta, M.; et al. SARS-CoV-2 Hot-Spot Mutations Are Significantly Enriched within Inverted Repeats and CpG Island Loci. Brief. Bioinform. 2021, 22, 1338–1345. [Google Scholar] [CrossRef]
- Bartas, M.; Goswami, P.; Lexa, M.; Červeň, J.; Volná, A.; Fojta, M.; Brázda, V.; Pečinka, P. Letter to the Editor: Significant Mutation Enrichment in Inverted Repeat Sites of New SARS-CoV-2 Strains. Brief. Bioinform. 2021, 22, bbab129. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Qin, G.; Niu, J.; Wang, Z.; Wang, C.; Ren, J.; Qu, X. Targeting RNA G-Quadruplex in SARS-CoV-2: A Promising Therapeutic Target for COVID-19? Angew. Chem. Int. Ed. 2021, 60, 432–438. [Google Scholar] [CrossRef] [PubMed]
- Brázda, V.; Kolomazník, J.; Lýsek, J.; Hároníková, L.; Coufal, J.; Štastný, J. Palindrome Analyser—A New Web-Based Server for Predicting and Evaluating Inverted Repeats in Nucleotide Sequences. Biochem. Biophys. Res. Commun. 2016, 478, 1739–1745. [Google Scholar] [CrossRef] [PubMed]
- Hodcroft, E.B. CoVariants: SARS-CoV-2 Mutations and Variants of Interest. Available online: https://covariants.org/ (accessed on 19 December 2022).
- Shu, Y.; McCauley, J. GISAID: Global Initiative on Sharing All Influenza Data—From Vision to Reality. Euro Surveill. 2017, 22, 30494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smit, S.; Rother, K.; Heringa, J.; Knight, R. From Knotted to Nested RNA Structures: A Variety of Computational Methods for Pseudoknot Removal. RNA 2008, 14, 410–416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellaousov, S.; Mathews, D.H. ProbKnot: Fast Prediction of RNA Secondary Structure Including Pseudoknots. RNA 2010, 16, 1870–1880. [Google Scholar] [CrossRef] [Green Version]
- Kikin, O.; D’Antonio, L.; Bagga, P.S. QGRS Mapper: A Web-Based Server for Predicting G-Quadruplexes in Nucleotide Sequences. Nucleic Acids Res. 2006, 34, W676–W682. [Google Scholar] [CrossRef]
- Yang, T.-J.; Yu, P.-Y.; Chang, Y.-C.; Liang, K.-H.; Tso, H.-C.; Ho, M.-R.; Chen, W.-Y.; Lin, H.-T.; Wu, H.-C.; Hsu, S.-T.D. Effect of SARS-CoV-2 B.1.1.7 Mutations on Spike Protein Structure and Function. Nat. Struct. Mol. Biol. 2021, 28, 731–739. [Google Scholar] [CrossRef]
- Hirabara, S.M.; Serdan, T.D.A.; Gorjao, R.; Masi, L.N.; Pithon-Curi, T.C.; Covas, D.T.; Curi, R.; Durigon, E.L. SARS-CoV-2 Variants: Differences and Potential of Immune Evasion. Front. Cell. Infect. Microbiol. 2021, 11, 781429. [Google Scholar] [CrossRef]
- Harvey, W.T.; Carabelli, A.M.; Jackson, B.; Gupta, R.K.; Thomson, E.C.; Harrison, E.M.; Ludden, C.; Reeve, R.; Rambaut, A.; Peacock, S.J.; et al. SARS-CoV-2 Variants, Spike Mutations and Immune Escape. Nat. Rev. Microbiol. 2021, 19, 409–424. [Google Scholar] [CrossRef]
- McCallum, M.; Walls, A.C.; Sprouse, K.R.; Bowen, J.E.; Rosen, L.E.; Dang, H.V.; De Marco, A.; Franko, N.; Tilles, S.W.; Logue, J.; et al. Molecular Basis of Immune Evasion by the Delta and Kappa SARS-CoV-2 Variants. Science 2021, 374, 1621–1626. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.E.; Zhang, X.; Case, J.B.; Winkler, E.S.; Liu, Y.; VanBlargan, L.A.; Liu, J.; Errico, J.M.; Xie, X.; Suryadevara, N.; et al. Resistance of SARS-CoV-2 Variants to Neutralization by Monoclonal and Serum-Derived Polyclonal Antibodies. Nat. Med. 2021, 27, 717–726. [Google Scholar] [CrossRef] [PubMed]
- Barton, M.I.; MacGowan, S.A.; Kutuzov, M.A.; Dushek, O.; Barton, G.J.; van der Merwe, P.A. Effects of Common Mutations in the SARS-CoV-2 Spike RBD and Its Ligand, the Human ACE2 Receptor on Binding Affinity and Kinetics. Elife 2021, 10, e70658. [Google Scholar] [CrossRef] [PubMed]
- Imperatore, J.A.; Cunningham, C.L.; Pellegrene, K.A.; Brinson, R.G.; Marino, J.P.; Evanseck, J.D.; Mihailescu, M.R. Highly Conserved S2m Element of SARS-CoV-2 Dimerizes via a Kissing Complex and Interacts with Host MiRNA-1307-3p. Nucleic Acids Res. 2022, 50, 1017–1032. [Google Scholar] [CrossRef] [PubMed]
- Tandel, D.; Gupta, D.; Sah, V.; Harshan, K.H. N440K Variant of SARS-CoV-2 Has Higher Infectious Fitness. bioRxiv 2021. [Google Scholar] [CrossRef]
- Bate, N.; Savva, C.G.; Moody, P.C.E.; Brown, E.A.; Evans, S.E.; Ball, J.K.; Schwabe, J.W.R.; Sale, J.E.; Brindle, N.P.J. In Vitro Evolution Predicts Emerging SARS-CoV-2 Mutations with High Affinity for ACE2 and Cross-Species Binding. PLoS Pathog. 2022, 18, e1010733. [Google Scholar] [CrossRef]
- Korber, B.; Fischer, W.M.; Gnanakaran, S.; Yoon, H.; Theiler, J.; Abfalterer, W.; Hengartner, N.; Giorgi, E.E.; Bhattacharya, T.; Foley, B.; et al. Tracking Changes in SARS-CoV-2 Spike: Evidence That D614G Increases Infectivity of the COVID-19 Virus. Cell 2020, 182, 812–827.e19. [Google Scholar] [CrossRef]
- Tian, F.; Tong, B.; Sun, L.; Shi, S.; Zheng, B.; Wang, Z.; Dong, X.; Zheng, P. N501Y Mutation of Spike Protein in SARS-CoV-2 Strengthens Its Binding to Receptor ACE2. Elife 2021, 10, e69091. [Google Scholar] [CrossRef]
- Meng, B.; Kemp, S.A.; Papa, G.; Datir, R.; Ferreira, I.A.T.M.; Marelli, S.; Harvey, W.T.; Lytras, S.; Mohamed, A.; Gallo, G.; et al. Recurrent Emergence of SARS-CoV-2 Spike Deletion H69/V70 and Its Role in the Alpha Variant B.1.1.7. Cell Rep. 2021, 35, 109292. [Google Scholar] [CrossRef]
- Iketani, S.; Liu, L.; Guo, Y.; Liu, L.; Chan, J.F.-W.; Huang, Y.; Wang, M.; Luo, Y.; Yu, J.; Chu, H.; et al. Antibody Evasion Properties of SARS-CoV-2 Omicron Sublineages. Nature 2022, 604, 553–556. [Google Scholar] [CrossRef]
- Zhou, H.; Dcosta, B.M.; Landau, N.R.; Tada, T. Resistance of SARS-CoV-2 Omicron BA.1 and BA.2 Variants to Vaccine-Elicited Sera and Therapeutic Monoclonal Antibodies. Viruses 2022, 14, 1334. [Google Scholar] [CrossRef] [PubMed]
- Yamasoba, D.; Kosugi, Y.; Kimura, I.; Fujita, S.; Uriu, K.; Ito, J.; Sato, K. Neutralisation Sensitivity of SARS-CoV-2 Omicron Subvariants to Therapeutic Monoclonal Antibodies. Lancet Infect. Dis. 2022, 22, 942–943. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Yisimayi, A.; Jian, F.; Song, W.; Xiao, T.; Wang, L.; Du, S.; Wang, J.; Li, Q.; Chen, X.; et al. BA.2.12.1, BA.4 and BA.5 Escape Antibodies Elicited by Omicron Infection. Nature 2022, 608, 593–602. [Google Scholar] [CrossRef]
- Weisblum, Y.; Schmidt, F.; Zhang, F.; DaSilva, J.; Poston, D.; Lorenzi, J.C.; Muecksch, F.; Rutkowska, M.; Hoffmann, H.-H.; Michailidis, E.; et al. Escape from Neutralizing Antibodies by SARS-CoV-2 Spike Protein Variants. Elife 2020, 9, e61312. [Google Scholar] [CrossRef] [PubMed]
- Williams, G.D.; Chang, R.Y.; Brian, D.A. A Phylogenetically Conserved Hairpin-Type 3’ Untranslated Region Pseudoknot Functions in Coronavirus RNA Replication. J. Virol. 1999, 73, 8349–8355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Belmonte-Reche, E.; Serrano-Chacón, I.; Gonzalez, C.; Gallo, J.; Bañobre-López, M. Potential G-Quadruplexes and i-Motifs in the SARS-CoV-2. PLoS ONE 2021, 16, e0250654. [Google Scholar] [CrossRef]
- Cui, H.; Zhang, L. G-Quadruplexes Are Present in Human Coronaviruses Including SARS-CoV-2. Front. Microbiol. 2020, 11, 567317. [Google Scholar] [CrossRef] [PubMed]
- Dinan, A.M.; Lukhovitskaya, N.I.; Olendraite, I.; Firth, A.E. A Case for a Negative-Strand Coding Sequence in a Group of Positive-Sense RNA Viruses. Virus Evol. 2020, 6, veaa007. [Google Scholar] [CrossRef]
- Liu, G.; Du, W.; Sang, X.; Tong, Q.; Wang, Y.; Chen, G.; Yuan, Y.; Jiang, L.; Cheng, W.; Liu, D.; et al. RNA G-Quadruplex in TMPRSS2 Reduces SARS-CoV-2 Infection. Nat. Commun. 2022, 13, 1444. [Google Scholar] [CrossRef] [PubMed]
- Moraca, F.; Marzano, S.; D’Amico, F.; Lupia, A.; Di Fonzo, S.; Vertecchi, E.; Salvati, E.; Di Porzio, A.; Catalanotti, B.; Randazzo, A.; et al. Ligand-Based Drug Repurposing Strategy Identified SARS-CoV-2 RNA G-Quadruplex Binders. Chem. Commun. 2022, 58, 11913–11916. [Google Scholar] [CrossRef] [PubMed]
- Qin, G.; Zhao, C.; Liu, Y.; Zhang, C.; Yang, G.; Yang, J.; Wang, Z.; Wang, C.; Tu, C.; Guo, Z.; et al. RNA G-Quadruplex Formed in SARS-CoV-2 Used for COVID-19 Treatment in Animal Models. Cell Discov. 2022, 8, 86. [Google Scholar] [CrossRef] [PubMed]
- Vora, S.M.; Fontana, P.; Mao, T.; Leger, V.; Zhang, Y.; Fu, T.-M.; Lieberman, J.; Gehrke, L.; Shi, M.; Wang, L.; et al. Targeting Stem-Loop 1 of the SARS-CoV-2 5’ UTR to Suppress Viral Translation and Nsp1 Evasion. Proc. Natl. Acad. Sci. USA 2022, 119, e2117198119. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, S.; Wang, J.; Nuccio, S.P.; Mao, H.; Di Antonio, M. Short LNA-Modified Oligonucleotide Probes as Efficient Disruptors of DNA G-Quadruplexes. Nucleic Acids Res. 2022, 50, 7247–7259. [Google Scholar] [CrossRef] [PubMed]
- Yeh, T.-Y.; Contreras, G.P. Emerging Viral Mutants in Australia Suggest RNA Recombination Event in the SARS-CoV-2 Genome. Med. J. Aust. 2020, 213, 44–44.e1. [Google Scholar] [CrossRef]
- Xu, Z.; Choi, J.-H.; Dai, D.L.; Luo, J.; Ladak, R.J.; Li, Q.; Wang, Y.; Zhang, C.; Wiebe, S.; Liu, A.C.H.; et al. SARS-CoV-2 Impairs Interferon Production via NSP2-Induced Repression of MRNA Translation. Proc. Natl. Acad. Sci. USA 2022, 119, e2204539119. [Google Scholar] [CrossRef] [PubMed]
Variant | Pango Lineage | Defining Spike Protein Mutations | Defining Mutations within IRs |
---|---|---|---|
Epsilon | B.1.427 | S13I W152C L452R D614G | W152C D614G |
20A | B.1.620 | ΔP26, ΔH69/V70, V126A, ΔY144, ΔL241-A243, H245Y, S477N, E484K, D614G, P681H, T1027I, D1118H | ΔH69/V70, V126A, ΔY144, ΔL241-A243, D614G, D1118H |
Beta | B.1.351 | D80A, D215G, ΔL241-A243, K417N, E484K, N501Y, D614G, A701V | ΔL241-A243, K417N, N501Y, D614G, A701V |
Alpha | B.1.1.7 | ΔH69/V70, ΔY144, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H | ΔH69/V70, ΔY144, N501Y, D614G, D1118H |
Delta | B.1.617.2 | T19R, ΔE156/F157, R158G, L452R, T478K, D614G, P681R, D950N | D614G, D950N |
Kappa | B.1.617.1 | E154K, L452R, E484Q, D614G, P681R, Q1071H | E484Q, D614G, Q1071H |
Gamma | P.1 | L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, V1176F | L18F, T20N, R190S, K417T, N501Y, D614G, V1176F |
Iota | B.1.526 | L5F, T95I, D253G, E484K, D614G, A701V | D614G, A701V |
20B | B.1.1.519 | T478K, D614G, P681R, T732A | D614G |
Eta | B.1.525 | Q52R, A67V, ΔH69/V70, ΔY144, E484K, D614G, Q677H, F888L | Q52R, A67V, ΔH69/V70, ΔY144, D614G, F888L |
Lambda | C.37 | G75V, T76I, ΔR246-G252, D253N, L452Q, F490S, D614G, T859N | G75V, T76I, ΔR246-G252, L452Q, F490S, D614G |
Mu | B.1.621 | T95I, Y144S, Y145N, R346K, E484K, N501Y, D614G, P681R, D950N | Y144S, Y145N, D614G, D950N |
Theta | P.3 | E484K, N501Y, D614G, P681R, E1092K, H1101Y, V1176F | N501Y, D614G, E1092K, H1101Y, V1176F |
Omicron | BA.1 | A67V, ΔH69/V70, T95I, ΔG142-Y144, Y145D, ΔN211, L212I, G339D, S371L, S373P, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, Q496R, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F | A67V, ΔH69/V70, ΔG142-Y144, Y145D, ΔN211, L212I, N440K, S477N, T478K, Q498R, N501Y, Y505H, D614G, N679K, N764K, D796Y, Q954H, N969K, L981F |
Omicron | BA.2 | T19I, ΔL24-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K | G142D, V213G, N440K, S477N, T478K, Q498R, N501Y, N764K, D796Y, Q954H, N969K |
Omicron | BA.4/BA.5 | T19I, ΔL24-P26, A27S, ΔH69/V70, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452R, S477N, T478K, E484A, F486V, Q498R, N501Y, Y505H, D614G, H665Y, N679K, P681H, N764K, D796Y, Q954H, N969K | ΔH69/V70, G142D, V213G, N440K, L452R, S477N, T478K, F486V, Q498R, N501Y, H665Y, N764K, D796Y, Q954H, N969K |
Omicron | BA.2.12.1 | T19I, ΔL24-P26, A27S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, L452Q, S477N, T478K, E484A, Q493A, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, S704L, N764K, D796Y, Q954H, N969K | G142D, V213G, D405N, K417N, N440K, L452Q, S477N, T478K, Q498R, N501Y, D614G, N679K, N764K, D796Y, Q954H, N969K |
Omicron | BA.2.75 | T19I, ΔL24-P26, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, G339H, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, G446S, N460K, S477N, T478K, E484A, R493Q, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K | K147E, V213G, D405N, K417N, N440K, N460K, S477N, T478K, R493Q, Q498R, N501Y, D614G, N679K, N764K, D796Y, Q954H, N969K |
Gene Name/Region | Highest Scoring Sequence | + or − Strand |
---|---|---|
nsp1 | GGCTTTGGAGACTCCGTGGAGGAGG | + |
nsp2 | GGTGTTGTTGGAGAAGGTTCCGAAGG | + |
nsp3 | GGATATGGTTGGTTTGG | − |
nsp4 | GGTGATAGAGGTTTGTGGTGGTTGG | − |
nsp10 | GGTATGTGGAAAGGTTATGG | + |
nsp12 | GGAACCACTAAATTTTATGGTGGTTGG | + |
nsp14 | GGTTGGGTTGGTTTTGATGTTGAAGG | + |
nsp15 | GGAGCCCACAAGGTAATCCAGGTGG | + |
nsp16 | GGAGAAATAGTACAACATGGAATGGCGG | + |
S | GGCTTATAGGTTTAATGGTATTGG | + |
N | GGCTGGCAATGGCGG | + |
3′UTR | GGUGGUGTAAAAGUGGCUCCGG | − |
5′UTR | GGAAGGGUCCAUUGUUUGGUUGG | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bidula, S.; Brázda, V. Genomic Analysis of Non-B Nucleic Acids Structures in SARS-CoV-2: Potential Key Roles for These Structures in Mutability, Translation, and Replication? Genes 2023, 14, 157. https://doi.org/10.3390/genes14010157
Bidula S, Brázda V. Genomic Analysis of Non-B Nucleic Acids Structures in SARS-CoV-2: Potential Key Roles for These Structures in Mutability, Translation, and Replication? Genes. 2023; 14(1):157. https://doi.org/10.3390/genes14010157
Chicago/Turabian StyleBidula, Stefan, and Václav Brázda. 2023. "Genomic Analysis of Non-B Nucleic Acids Structures in SARS-CoV-2: Potential Key Roles for These Structures in Mutability, Translation, and Replication?" Genes 14, no. 1: 157. https://doi.org/10.3390/genes14010157