Genetic Deletion of DNAJB3 Using CRISPR-Cas9, Produced Discordant Phenotypes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Generation of HSP40/DNAJB3 Animal Models
2.2. Animal Studies and Dietary Interventions
2.3. Body Weight and Body Composition
2.4. Glucose and Insulin Tolerance Test
2.5. RNA Extraction, cDNA Preparation and Real Time PCR-Gene Expression
2.6. Western Blot to Confirm DNAJB3
2.7. Statistical Analyses
3. Results
3.1. Genotyping
3.1.1. Genotype Confirmation by Sequencing
3.1.2. Deletion Confirmation by Western Blot
3.2. Effects of DNJAB3 Inactivation on Body Weight and Adiposity
3.3. Effects of DNAJB3 Deficiency on Glucose Homeostasis
3.4. Effects of DNAJB3 Inactivation on Fat Metabolizing Genes
3.5. Effects of DNAJB3 Deficiency on WAT and Muscle Inflammatory Markers
3.6. Effects of DNAJB3 on ER Stress Markers
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hales, C.M.; Carroll, M.D.; Fryar, C.D.; Ogden, C.L. Prevalence of obesity among adults and youth: United States, 2015–2016. NCHS Data Briefs 2017, 288, 1–8. [Google Scholar]
- Upadhyay, J.; Farr, O.; Perakakis, N.; Ghaly, W.; Mantzoros, C. Obesity as a disease. Med. Clin. 2018, 102, 13–33. [Google Scholar] [CrossRef]
- Flegal, K.M.; Kit, B.K.; Orpana, H.; Graubard, B.I. Association of all-cause mortality with overweight and obesity using standard body mass index categories: A systematic review and meta-analysis. JAMA 2013, 309, 71–82. [Google Scholar] [CrossRef]
- Pirola, L.; Ferraz, J.C. Role of pro-and anti-inflammatory phenomena in the physiopathology of type 2 diabetes and obesity. World J. Biol. Chem. 2017, 8, 120. [Google Scholar] [CrossRef] [PubMed]
- de Ferranti, S.; Mozaffarian, D. The perfect storm: Obesity, adipocyte dysfunction, and metabolic consequences. Clin. Chem. 2008, 54, 945–955. [Google Scholar] [CrossRef]
- Engin, A. The definition and prevalence of obesity and metabolic syndrome. Obes. Lipotoxicity 2017, 960, 1–17. [Google Scholar]
- Eckel, R.H.; Grundy, S.M.; Zimmet, P.Z. The metabolic syndrome. Lancet 2005, 365, 1415–1428. [Google Scholar] [CrossRef]
- Mokdad, A.H.; Ford, E.S.; Bowman, B.A.; Dietz, W.H.; Vinicor, F.; Bales, V.S.; Marks, J.S. Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001. JAMA 2003, 289, 76–79. [Google Scholar] [CrossRef]
- Ataey, A.; Jafarvand, E.; Adham, D.; Moradi-Asl, E. The relationship between obesity, overweight, and the human development index in world health organization eastern mediterranean region countries. J. Prev. Med. Public Health 2020, 53, 98. [Google Scholar] [CrossRef] [PubMed]
- Hales, C.M.; Carroll, M.D.; Fryar, C.D.; Ogden, C.L. Prevalence of Obesity and Severe Obesity among Adults: United States, 2017–2018; NCHS Data Brief, No. 360; National Center for Health Statistics: Hyattsville, MD, USA, 2020. [Google Scholar]
- Hummasti, S.; Hotamisligil, G.S. Endoplasmic reticulum stress and inflammation in obesity and diabetes. Circ. Res. 2010, 107, 579–591. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S. Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell 2010, 140, 900–917. [Google Scholar] [CrossRef]
- Engin, F.; Hotamisligil, G.S. Restoring endoplasmic reticulum function by chemical chaperones: An emerging therapeutic approach for metabolic diseases. Diabetes Obes. Metab. 2010, 12, 108–115. [Google Scholar] [CrossRef]
- Menikdiwela, K.R.; Ramalingam, L.; Allen, L.; Scoggin, S.; Kalupahana, N.S.; Moustaid-Moussa, N. Angiotensin II Increases endoplasmic Reticulum stress in Adipose tissue and Adipocytes. Sci. Rep. 2019, 9, 8481. [Google Scholar] [CrossRef] [PubMed]
- Gregor, M.F.; Hotamisligil, G.S. Inflammatory mechanisms in obesity. Annu. Rev. Immunol. 2011, 29, 415–445. [Google Scholar] [CrossRef]
- Tripathi, Y.B.; Pandey, V. Obesity and endoplasmic reticulum (ER) stresses. Front. Immunol. 2012, 3, 240. [Google Scholar] [CrossRef] [PubMed]
- Arredouani, A.; Diane, A.; Khattab, N.; Bensmail, I.; Aoude, I.; Chikri, M.; Mohammad, R.; Abou-Samra, A.B.; Dehbi, M. DNAJB3 attenuates metabolic stress and promotes glucose uptake by eliciting Glut4 translocation. Sci. Rep. 2019, 9, 4772. [Google Scholar] [CrossRef] [PubMed]
- Saibil, H. Chaperone machines for protein folding, unfolding and disaggregation. Nat. Rev. Mol. Cell Biol. 2013, 14, 630–642. [Google Scholar] [CrossRef] [PubMed]
- Kampinga, H.H.; Hageman, J.; Vos, M.J.; Kubota, H.; Tanguay, R.M.; Bruford, E.A.; Cheetham, M.E.; Chen, B.; Hightower, L.E. Guidelines for the nomenclature of the human heat shock proteins. Cell Stress Chaperones 2009, 14, 105–111. [Google Scholar] [CrossRef]
- Morimoto, R.I. The heat shock response: Systems biology of proteotoxic stress in aging and disease. In Cold Spring Harbor symposia on Quantitative Biology; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2011. [Google Scholar]
- Noble, E.G.; Milne, K.J.; Melling, C.J. Heat shock proteins and exercise: A primer. Appl. Physiol. Nutr. Metab. 2008, 33, 1050–1075. [Google Scholar] [CrossRef]
- Abubaker, J.; Tiss, A.; Abu-Farha, M.; Al-Ghimlas, F.; Al-Khairi, I.; Baturcam, E.; Cherian, P.; Elkum, N.; Hammad, M.; John, J.; et al. DNAJB3/HSP-40 cochaperone is downregulated in obese humans and is restored by physical exercise. PLoS ONE 2013, 8, e69217. [Google Scholar] [CrossRef]
- Bruce, C.R.; Carey, A.L.; Hawley, J.A.; Febbraio, M.A. Intramuscular heat shock protein 72 and heme oxygenase-1 mRNA are reduced in patients with type 2 diabetes: Evidence that insulin resistance is associated with a disturbed antioxidant defense mechanism. Diabetes 2003, 52, 2338–2345. [Google Scholar] [CrossRef] [PubMed]
- Kurucz, I.; Morva, A.; Vaag, A.; Eriksson, K.-F.; Huang, X.; Groop, L.; Koranyi, L. Decreased expression of heat shock protein 72 in skeletal muscle of patients with type 2 diabetes correlates with insulin resistance. Diabetes 2002, 51, 1102–1109. [Google Scholar] [CrossRef] [PubMed]
- Rogers, R.S.; Morris, E.M.; Wheatley, J.L.; Archer, A.E.; McCoin, C.S.; White, K.S.; Wilson, D.R.; Meers, G.M.; Koch, L.G.; Britton, S.L.; et al. Deficiency in the heat stress response could underlie susceptibility to metabolic disease. Diabetes 2016, 65, 3341–3351. [Google Scholar] [CrossRef]
- Kampinga, H.H.; Craig, E.A. The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nat. Rev. Mol. Cell Biol. 2010, 11, 579–592. [Google Scholar] [CrossRef] [PubMed]
- Simar, D.; Jacques, A.; Caillaud, C. Heat shock proteins induction reduces stress kinases activation, potentially improving insulin signalling in monocytes from obese subjects. Cell Stress Chaperones 2012, 17, 615–621. [Google Scholar] [CrossRef]
- Hooper, P.L.; Hooper, P.L. Inflammation, heat shock proteins, and type 2 diabetes. Cell Stress Chaperones 2009, 14, 113–115. [Google Scholar] [CrossRef]
- Voellmy, R.; Boellmann, F. Chaperone regulation of the heat shock protein response. In Molecular Aspects of the Stress Response: Chaperones, Membranes and Networks; Springer: Berlin/Heidelberg, Germany, 2007; pp. 89–99. [Google Scholar]
- Voisine, C.; Brehme, M. HSP90 et al.: Chaperome and proteostasis deregulation in human disease. In Heat Shock Protein 90 in Human Diseases and Disorders; Springer: Berlin/Heidelberg, Germany, 2019; pp. 591–603. [Google Scholar]
- Westerheide, S.D.; Morimoto, R.I. Heat shock response modulators as therapeutic tools for diseases of protein conformation. J. Biol. Chem. 2005, 280, 33097–33100. [Google Scholar] [CrossRef]
- Menikdiwela, K.R.; Torres Guimaraes, J.P.; Ramalingam, L.; Kalupahana, N.S.; Dufour, J.M.; Washburn, R.L.; Moustaid-Moussa, N. Mechanisms linking endoplasmic reticulum (ER) stress and microRNAs to adipose tissue dysfunction in obesity. Crit. Rev. Biochem. Mol. Biol. 2021, 56, 455–481. [Google Scholar] [CrossRef]
- Hageman, J.; van Waarde, M.A.; Zylicz, A.; Walerych, D.; Kampinga, H.H. The diverse members of the mammalian HSP70 machine show distinct chaperone-like activities. Biochem. J. 2011, 435, 127–142. [Google Scholar] [CrossRef]
- Hartl, F.U.; Hayer-Hartl, M. Molecular chaperones in the cytosol: From nascent chain to folded protein. Science 2002, 295, 1852–1858. [Google Scholar] [CrossRef]
- Abu-Farha, M.; Cherian, P.; Al-Khairi, I.; Tiss, A.; Khadir, A.; Kavalakatt, S.; Warsame, S.; Dehbi, M.; Behbehani, K.; Abubaker, J. DNAJB3/HSP-40 cochaperone improves insulin signaling and enhances glucose uptake in vitro through JNK repression. Sci. Rep. 2015, 5, 14448. [Google Scholar] [CrossRef]
- Hageman, J.; Rujano, M.A.; van Waarde, M.A.; Kakkar, V.; Dirks, R.P.; Govorukhina, N.; Oosterveld-Hut, H.M.; Lubsen, N.H.; Kampinga, H.H. A DNAJB chaperone subfamily with HDAC-dependent activities suppresses toxic protein aggregation. Mol. Cell 2010, 37, 355–369. [Google Scholar] [CrossRef] [PubMed]
- Kondo, T.; Koga, S.; Matsuyama, R.; Miyagawa, K.; Goto, R.; Kai, H.; Araki, E. Heat shock response regulates insulin sensitivity and glucose homeostasis: Pathophysiological impact and therapeutic potential. Curr. Diabetes Rev. 2011, 7, 264–269. [Google Scholar] [CrossRef]
- Zilaee, M.; Shirali, S. Heat shock proteins and diabetes. Can. J. Diabetes 2016, 40, 594–602. [Google Scholar] [CrossRef]
- Urban, M.J.; Dobrowsky, R.T.; Blagg, B.S. Heat shock response and insulin-associated neurodegeneration. Trends Pharmacol. Sci. 2012, 33, 129–137. [Google Scholar] [CrossRef]
- Drew, B.G.; Ribas, V.; Le, J.A.; Henstridge, D.C.; Phun, J.; Zhou, Z.; Soleymani, T.; Daraei, P.; Sitz, D.; Vergnes, L.; et al. HSP72 is a mitochondrial stress sensor critical for Parkin action, oxidative metabolism, and insulin sensitivity in skeletal muscle. Diabetes 2014, 63, 1488–1505. [Google Scholar] [CrossRef] [PubMed]
- Diane, A.; Abunada, H.; Khattab, N.; Moin, A.S.M.; Butler, A.E.; Dehbi, M. Role of the DnaJ/Hsp40 family in the pathogenesis of insulin resistance and type 2 diabetes. Ageing Res. Rev. 2021, 67, 101313. [Google Scholar] [CrossRef]
- Gupte, A.A.; Bomhoff, G.L.; Geiger, P.C. Age-related differences in skeletal muscle insulin signaling: The role of stress kinases and heat shock proteins. J. Appl. Physiol. 2008, 105, 839–848. [Google Scholar] [CrossRef]
- Atalay, M.; Oksala, N.K.J.; Laaksonen, D.E.; Khanna, S.; Nakao, C.; Lappalainen, J.; Roy, S.; Hänninen, O.; Sen, C.K.; Henstridge, D.C.; et al. Exercise training modulates heat shock protein response in diabetic rats. J. Appl. Physiol. 2004, 97, 605–611. [Google Scholar] [CrossRef] [PubMed]
- Strissel, K.J.; Stancheva, Z.; Miyoshi, H.; Perfield, J.W.; DeFuria, J.; Jick, Z.; Greenberg, A.S.; Obin, M.S. Adipocyte death, adipose tissue remodeling, and obesity complications. Diabetes 2007, 56, 2910–2918. [Google Scholar] [CrossRef]
- Park, K.J.; Gaynor, R.B.; Kwak, Y.T. Heat shock protein 27 association with the IκB kinase complex regulates tumor necrosis factor α-induced NF-κB activation. J. Biol. Chem. 2003, 278, 35272–35278. [Google Scholar] [CrossRef] [PubMed]
- Park, H.; Lee, J.; Huh, S.; Seo, J.; Choi, E. Hsp72 functions as a natural inhibitory protein of c-Jun N-terminal kinase. EMBO J. 2001, 20, 446–456. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
Acaca | GCAGCAGTTACACCACATACA | CATTACCTCAATCTCAGCATAGCA |
Cpt1α | GAGACAGACACCATCCAACAC | GAGCCAGACCTTGAAGTAACG |
Fasn | TGCAGAAGATGTAGATTGTGTGATGA | GGGTCCGGGTGCAGTTTATT |
Pparα | ATCCACGAAGCCTACCTGAA | AATCGGACCTCTGCCTCTT |
Glut 4 | AGAGCGTCCAATGTCCTT | CGAAGATGCTGGTTGAATAGTAG |
Insr | ACCTTCCAGTATGTTCCTCAG | TGCCTTCAGTCATTACCTCTT |
Il6 | AACCGCTATGAAGTTCCTCTC | TCCTCTGTGAAGTCTCCTCTC |
Mcp1 | ACTTCTATGCCTCCTGCTCAT | GCTGCTTGTGATTCTCCTGTAG |
Tnfα | CGTGGAACTGGCAGAAGAG | TGAGAAGAGGCTGAGACATAGG |
Atf 6 | TTCCTCCAGTTGCTCCATCT | ACCAGTGACAGGCTTCTCTT |
Bip | TTCAGCCAATTATCAGCAAACTCT | TTTTCTGATGTATCCTCTTCACCAGT |
Chop | CCACCACACCTGAAAGCAGAA | AGGTGAAAGGCAGGGACTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nejat, S.; Menikdiwela, K.R.; Efotte, A.; Scoggin, S.; Vandanmagsar, B.; Thornalley, P.J.; Dehbi, M.; Moustaid-Moussa, N. Genetic Deletion of DNAJB3 Using CRISPR-Cas9, Produced Discordant Phenotypes. Genes 2023, 14, 1857. https://doi.org/10.3390/genes14101857
Nejat S, Menikdiwela KR, Efotte A, Scoggin S, Vandanmagsar B, Thornalley PJ, Dehbi M, Moustaid-Moussa N. Genetic Deletion of DNAJB3 Using CRISPR-Cas9, Produced Discordant Phenotypes. Genes. 2023; 14(10):1857. https://doi.org/10.3390/genes14101857
Chicago/Turabian StyleNejat, Shadi, Kalhara R. Menikdiwela, Aliyah Efotte, Shane Scoggin, Bolormaa Vandanmagsar, Paul J. Thornalley, Mohammed Dehbi, and Naima Moustaid-Moussa. 2023. "Genetic Deletion of DNAJB3 Using CRISPR-Cas9, Produced Discordant Phenotypes" Genes 14, no. 10: 1857. https://doi.org/10.3390/genes14101857