Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Greenhouse Tests
2.3. Isolation of Genomic DNA
2.4. Bulked Segregant Analysis
2.5. Sequence Tagged Site (STS) and Simple Sequence Repeat (SSR) Genotyping
2.6. SNP Genotyping
2.7. Deletion Bin Mapping of Linked Markers
2.8. Data Analysis
3. Results
3.1. Inheritance Studies
3.2. Molecular Mapping
3.3. Deletion Mapping of Flanking Markers
3.4. Saturation of Chromosome 2BL Using SNP Markers
3.5. Validation of YrAW4-Linked Markers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wellings, C.R. Global status of stripe rust: A review of historical and current threats. Euphytica 2011, 179, 129–141. [Google Scholar] [CrossRef]
- Stubbs, R.W. Stripe rust. In The Cereal Rusts Vol Il; Roelfs, A.P., Bushnell, W.R., Eds.; Academic Press: Orlando, FL, USA, 1985; pp. 61–101. [Google Scholar]
- O’Brien, L.; Brown, J.S.; Young, R.M.; Pascoe, I. Occurrence and Distribution of Wheat Stripe Rust in Victoria and Susceptibility of Commercial Wheat Cultivars. Australas. Plant Pathol. 1980, 9, 14. [Google Scholar] [CrossRef]
- Wellings, C.R.; Wright, D.G.; Keiper, F.; Loughman, R. First detection of wheat stripe rust in Western Australia: Evidence for a foreign incursion. Australas. Plant Pathol. 2003, 32, 321–322. [Google Scholar] [CrossRef]
- Murray, G.M.; Ellison, P.J.; Watson, A. Effects of stripe rust on the wheat plant. Australas. Plant Pathol. 1995, 24, 261–270. [Google Scholar] [CrossRef]
- Murray, G.M.; Brennan, J.P. Estimating disease losses to the Australian wheat industry. Australas. Plant Pathol. 2009, 38, 558–570. [Google Scholar] [CrossRef]
- Wellings, C.R.; McIntosh, R.A. Puccinia striiformis f.sp. tritici in Australasia: Pathogenic changes during the first 10 years. Plant Pathol. 1990, 39, 316–325. [Google Scholar] [CrossRef]
- Edae, E.A.; Olivera, P.D.; Jin, Y.; Poland, J.A.; Rouse, M.N. Genotype-by-sequencing facilitates genetic mapping of a stem rust resistance locus in Aegilops umbellulata, a wild relative of cultivated wheat. BMC Genom. 2016, 17, 1039. [Google Scholar] [CrossRef] [PubMed]
- Akbari, M.; Wenzl, P.; Caig, V.; Carling, J.; Xia, L.; Yang, S.; Uszynski, G.; Mohler, V.; Lehmensiek, A.; Kuchel, H.; et al. Diversity arrays technology (DArT) for high-throughput profiling of the hexaploid wheat genome. Theor. Appl. Genet. 2006, 113, 1409–1420. [Google Scholar] [CrossRef]
- Jaccoud, D.; Peng, K.; Feinstein, D.; Kilian, A. Diversity arrays: A solid state technology for sequence information independent genotyping. Nucleic Acids Res. 2001, 29, E25. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Wang, J.; Crouch, J.H.; Xu, Y. Efficiency of selective genotyping for genetic analysis of complex traits and potential applications in crop imporvement. Mol. Breed. 2010, 26, 493–511. [Google Scholar] [CrossRef]
- Sun, C.; Dong, Z.; Zhao, L.; Ren, Y.; Zhang, N.; Chen, F. The Wheat 660K SNP array demonstrates great potential for marker-assisted selection in polyploid wheat. Plant Biotechnol. J. 2020, 18, 1354–1360. [Google Scholar] [CrossRef] [PubMed]
- Eversole, K.; Feuillet, C.; Mayer, K.F.; Rogers, J. Slicing the wheat genome. Introduction. Science 2014, 345, 285–287. [Google Scholar] [CrossRef]
- Miller, T.; Reader, S.; Ambrose, M. The Watkins wheat collection. Annu. Wheat Newsl. 2000, 46, 172. [Google Scholar]
- Daetwyler, H.D.; Bansal, U.K.; Bariana, H.S.; Hayden, M.J.; Hayes, B.J. Genomic prediction for rust resistance in diverse wheat landraces. Theor. Appl. Genet. 2014, 127, 1795–1803. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Park, R.F.; Wellings, C.R. Wheat Rusts—An Atlas of Resistance Genes; CSIRO Publishing: Collingwood, Australia, 1995; pp. 9–12. [Google Scholar]
- Randhawa, M.; Bansal, U.; Valarik, M.; Klocova, B.; Dolezel, J.; Bariana, H. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat. Theor. Appl. Genet. 2014, 127, 317–324. [Google Scholar] [CrossRef] [PubMed]
- McNeale, F.H.; Konzak, C.F.; Smith, E.P.; Tate, W.S.; Russell, T.S. A Uniform for System for Recording and Processing Ceral Rust Research Data; Agricultural Research Service Bulletin, United States Department of Agriculture: Washington, DC, USA, 1971; pp. 34–121. [Google Scholar]
- Bansal, U.K.; Kazi, A.G.; Singh, B.; Hare, R.A.; Bariana, H.S. Mapping of durable stripe rust resistance in a durum wheat cultivar Wollaroi. Mol. Breed. 2014, 33, 51–59. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S., Eds.; Methods in Molecular Biology™; Humana Press: Totowa, NJ, USA, 1999; Volume 132, pp. 365–386. [Google Scholar]
- Somers, D.J.; Isaac, P.; Edwards, K. A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 2004, 109, 1105–1114. [Google Scholar] [CrossRef] [PubMed]
- Endo, T.R.; Gill, B.S. The deletion stocks of common wheat. J. Hered. 1996, 87, 295–307. [Google Scholar] [CrossRef]
- Manly, K.F.; Cudmore, R.H., Jr.; Meer, J.M. Map Manager QTX, cross-platform software for genetic mapping. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 2001, 12, 930–932. [Google Scholar] [CrossRef]
- Kosambi, D.D. The estimation of map distances from recombination values. Ann. Eugen. 1944, 12, 172–175. [Google Scholar] [CrossRef]
- Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
- Xu, L.S.; Wang, M.N.; Cheng, P.; Kang, Z.S.; Hulbert, S.H.; Chen, X.M. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat. Theor. Appl. Genet. 2013, 126, 523–533. [Google Scholar] [CrossRef]
- Zhang, P.; McIntosh, R.A.; Hoxha, S.; Dong, C. Wheat stripe rust resistance genes Yr5 and Yr7 are allelic. Theor. Appl. Genet. 2009, 120, 25–29. [Google Scholar] [CrossRef]
- Chen, X.M.; Soria, M.A.; Yan, G.P.; Sun, J.; Dubcovsky, J. Development of sequence tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust resistance gene Yr5. Crop Sci. 2003, 43, 2058–2064. [Google Scholar] [CrossRef]
- Cheng, P.; Chen, X.M. Molecular mapping of a gene for stripe rust resistance in spring wheat cultivar IDO377s. Theor. Appl. Genet. 2010, 121, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Baranwal, D.; Bariana, H.; Bansal, U. Dissection of stripe rust resistance in a Tunisian wheat landrace Aus26670. Mol. Breed. 2021, 41, 54. [Google Scholar] [CrossRef] [PubMed]
- Lagudah, E.S.; Krattinger, S.G.; Herrera-Foessel, S.; Singh, R.P.; Huerta-Espino, J.; Spielmeyer, W.; Brown-Guedira, G.; Selter, L.L.; Keller, B. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor. Appl. Genet. 2009, 119, 889–898. [Google Scholar] [CrossRef]
- Uauy, C.; Brevis, J.C.; Chen, X.; Khan, I.; Jackson, L.; Chicaiza, O.; Distelfeld, A.; Fahima, T.; Dubcovsky, J. High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein content locus Gpc-B1. Theor. Appl. Genet. 2005, 112, 97–105. [Google Scholar] [CrossRef]
- Herrera-Foessel, S.A.; Singh, R.P.; Lillemo, M.; Huerta-Espino, J.; Bhavani, S.; Singh, S.; Lan, C.; Calvo-Salazar, V.; Lagudah, E.S. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat. Theor. Appl. Genet. 2014, 127, 781–789. [Google Scholar] [CrossRef]
- Pakeerathan, K.; Chhetri, M.; Hayden, M.; Ayliffe, M.; Bariana, H.; Bansal, U. Mapping of adult plant leaf rust resistance in Aus27506 and validation of underlying loci by in-planta fungal biomass accummulation. Agronomy 2020, 10, 943. [Google Scholar] [CrossRef]


| Stripe Rust Response | Infection Type | Number of Lines | χ² (1:2:1) or (1:1) | |
|---|---|---|---|---|
| Observed | Expected | |||
| F3 AUS27506/AUS27229 | ||||
| Homozygous Resistant | 23C to 3C | 24 | 24.75 | 0.00 |
| Segregating | 23C-3C, 3+ | 58 | 49.50 | 1.50 |
| Homozygous Susceptible | 3+ | 17 | 24.75 | 2.40 |
| Total | 99 | 99.00 | 3.90 * | |
| F3 AUS27894/AUS27229 | ||||
| Homozygous Resistant | 23C to 3C | 19 | 19.25 | 0.00 |
| Segregating | 23C-3C, 3+ | 44 | 38.50 | 0.80 |
| Homozygous Susceptible | 3+ | 14 | 19.25 | 1.40 |
| Total | 77 | 77.00 | 2.20 * | |
| AUS27506/AUS27229 RIL population | ||||
| Homozygous Resistant | 53 | 51.0 | 0.08 | |
| Homozygous Susceptible | 49 | 51.0 | 0.08 | |
| Total | 102 | 102.0 | 0.16 * | |
| STS Markers | DArT- Markers | Forward a | Reverse |
|---|---|---|---|
| sun481 | wPt-665550 | GGCCAAGGTATGTTGATCGT | TCCAAATGAAACCAGGAAGG |
| sun482 | wPt-7161 | GCTCCTCTCGTTGATTGAG | GATGCAAAGGGAGAAAGCTG |
| sun483 | wPt-2397 | CAGTAGCATCCAACCCACT | GGGACGGATGATGAGACAGA |
| SNP | Allele 1 a | Allele 2 b | Common Primer |
|---|---|---|---|
| IWB49793 | CCATGTTCAAGGGTCTCAATTA | CCATGTTCAAGGGTCTCAATTC | TCGCCTGATATATTCACAACCTTT |
| IWB56941 | AGGAGGAATGGAAGTTTGATACT | AGGAGGAATGGAAGTTTGATACG | TGCAGAAAATGACAGCCTGA |
| IWB20875 | AGAGTAGCATGCGAGTCTT | AGAGTAGCATGCGAGTCTC | CAAGCACTTTACAGGTTTCCG |
| IWB12294 | TCCTCCGGCATTCCTCT | TCCTCCGGCATTCCTCG | AGCGTGCTGTACTTCGCC |
| IWB69000 | TGTTCTAGCTAACCAGGCAA | CTGTTCTAGCTAACCAGGCAG | CGAGCCAGAGTCTGAGACCA |
| IWB45530 | GAAACCAGCCGCAGAGTAT | TGAAACCAGCCGCAGAGTAC | GCAGTCAAGTTTTGGAACTGG |
| IWB56941 | AAGGAGGAATGGAAGTTTGATACT | AAGGAGGAATGGAAGTTTGATACG | TGCAGAAAATGACAGCCTGA |
| IWB10417 | TTTTCTTGTAGGAGGCAAAGATTTCAA | TTCTTGTAGGAGGCAAAGATTTCAC | TGATAATGTAAGCAGGAGTGTGCAATGTA |
| Cultivar and RIL | sun481 (bp) | IWB12294 (G:T) |
|---|---|---|
| AUS27506 and HR RIL | 240 | G |
| AUS27229 and HS RIL | 100 | T |
| Calingiri | 100 | T |
| Carnamah | 250 + 120 + 100 | T |
| Derrimut | 120 + 100 | T |
| DiamondBird | 250 + 100 | T |
| EGA Bellaroi (durum) | 120 + 100 | T |
| EGA BonnieRock | 130 + 120 + 100 | T |
| EGA Gregory | 250 + 130 + 100 | T |
| EmuRock | 250 + 120 + 100 | T |
| Espada | 250 + 120 | T |
| Forrest | 250 + 120 + 100 | T |
| Giles | 255 + 100 | T |
| Gladius | 250 + 120 + 100 | T |
| Hyperno (durum) | 250 + 100 | T |
| Magenta | 250 + 120 + 100 | T |
| Merlin | 250 + 120 + 100 | T |
| O’rion | 250 + 120 + 100 | T |
| Scout | 120 + 100 | T |
| Spitfire | 250 + 120 + 100 | T |
| Sunvale | 255 + 250 + 100 | T |
| Ventura | 100 | T |
| Wyalkatchem | 250 + 100 | T |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chhetri, M.; Miah, H.; Wong, D.; Hayden, M.; Bansal, U.; Bariana, H. Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection. Genes 2023, 14, 1993. https://doi.org/10.3390/genes14111993
Chhetri M, Miah H, Wong D, Hayden M, Bansal U, Bariana H. Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection. Genes. 2023; 14(11):1993. https://doi.org/10.3390/genes14111993
Chicago/Turabian StyleChhetri, Mumta, Hanif Miah, Debbie Wong, Matthew Hayden, Urmil Bansal, and Harbans Bariana. 2023. "Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection" Genes 14, no. 11: 1993. https://doi.org/10.3390/genes14111993
APA StyleChhetri, M., Miah, H., Wong, D., Hayden, M., Bansal, U., & Bariana, H. (2023). Mapping of a Stripe Rust Resistance Gene Yr72 in the Common Wheat Landraces AUS27506 and AUS27894 from the Watkins Collection. Genes, 14(11), 1993. https://doi.org/10.3390/genes14111993

