The Identification and Characteristics of miRNAs Related to Cashmere Fiber Traits in Skin Tissue of Cashmere Goats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Goats Investigated and Samples Collection
2.2. Small RNA Sequencing
2.3. Processing of Small RNA-Seq Data
2.4. Role Study of Differentially Expressed miRNAs
2.5. RT-qPCR
3. Results
3.1. Small RNA-Seq Data
3.2. Characteristics of miRNAs
3.3. Screening of Differentially Expressed miRNAs and Verification of Sequencing Results
3.4. Role Study of miRNAs Screened
3.5. The miRNA Binding Sites Analysis of mRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, H.; Ruan, J.; Durbin, R. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 2008, 18, 1851–1858. [Google Scholar] [CrossRef]
- Waldron, S.A.; Komarek, A.M.; Brown, C.G. An exploration of livestock-development policies in western China. Food Policy 2012, 37, 12–20. [Google Scholar]
- Wenguang, Z.; Jianghong, W.; Jinquan, L.; Yashizawa, M. A subset of skin-expressed microRNAs with possible roles in goat and sheep hair growth based on expression profiling of mammalian microRNAs. Omics 2007, 11, 385–396. [Google Scholar] [CrossRef] [PubMed]
- Huntzinger, E.; Izaurralde, E. Gene silencing by microRNAs: Contributions of translational repression and mRNA decay. Nat. Rev. Genet. 2011, 12, 99–110. [Google Scholar] [CrossRef] [PubMed]
- Ma, T.; Li, J.; Li, J.; Wu, S.; Xiangba; Jiang, H.; Zhang, Q. Expression of miRNA-203 and its target gene in hair follicle cycle development of Cashmere goat. Cell Cycle 2021, 20, 204–210. [Google Scholar] [CrossRef] [PubMed]
- Sheng, X.; Song, X.; Yu, Y.; Niu, L.; Li, S.; Li, H.; Wei, C.; Liu, T.; Zhang, L.; Du, L. Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses. Mol. Biol. Rep. 2011, 8, 3161–3171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Stokes, N.; Polak, L.; Fuchs, E. Specific microRNAs are preferentially expressed by skin stem cells to balance self-renewal and early lineage commitment. Cell Stem Cell 2011, 8, 294–308. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xiao, H.; Li, H.; Zhao, Y.; Lai, S.; Yu, X.; Cai, T.; Du, C.; Zhang, W.; Li, J. Identification of conserved and novel microRNAs in cashmere goat skin by deep sequencing. PLoS ONE 2012, 7, e50001. [Google Scholar] [CrossRef]
- Schmitt, M.J.; Philippidou, D.; Reinsbach, S.E.; Margue, C.; Wienecke-Baldacchino, A.; Nashan, D.; Behrmann, I.; Kreis, S. Interferon-γ-induced activation of Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells. Cell Commun. Signal. 2012, 10, 41. [Google Scholar] [CrossRef] [PubMed]
- Mardaryev, A.N.; Ahmed, M.I.; Vlahov, N.V.; Fessing, M.Y.; Gill, J.H.; Sharov, A.A.; Botchkareva, N.V. Micro-RNA-31 controls hair cycle-associated changes in gene expression programs of the skin and hair follicle. FASEB J. 2010, 24, 3869–3881. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Li, F.; Meng, Q.; Zhao, Y.; Chen, L.; Zhang, H.; Xue, L.; Zhang, X.; Lengner, C.; Yu, Z. Post-transcriptional regulation of keratinocyte progenitor cell expansion, differentiation and hair follicle regression by miR-22. PLoS Genet. 2015, 11, e1005253. [Google Scholar] [CrossRef]
- Ahmed, M.I.; Alam, M.; Emelianov, V.U.; Poterlowicz, K.; Patel, A.; Sharov, A.A.; Mardaryev, A.N.; Botchkareva, N.V. MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway. J. Cell Biol. 2014, 207, 549–567. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Zhang, Z.; O’Loughlin, E.; Wang, L.; Fan, X.; Lai, E.C.; Yi, R. MicroRNA-205 controls neonatal expansion of skin stem cells by modulating the PI(3)K pathway. Nat. Cell Biol. 2013, 15, 1153–1163. [Google Scholar] [CrossRef]
- Liu, Z.; Yang, F.; Zhao, M.; Ma, L.; Li, H.; Xie, Y.; Nai, R.; Che, T.; Su, R.; Zhang, Y.; et al. The intragenic mRNA-microRNA regulatory network during telogen-anagen hair follicle transition in the cashmere goat. Sci. Rep. 2018, 8, 14227. [Google Scholar] [CrossRef]
- Li, J.; Qu, H.; Jiang, H.; Zhao, Z.; Zhang, Q. Transcriptome-wide comparative analysis of microRNA profiles in the telogen skins of Liaoning cashmere goats (capra hircus) and fine-wool sheep (ovis aries) by solexa deep sequencing. DNA Cell Biol. 2017, 35, 696–705. [Google Scholar] [CrossRef] [PubMed]
- China National Commission of Animal Genetic Resources. Animal Genetic Resources in China Sheep and Goats; China Agriculture Press: Beijing, China, 2011. [Google Scholar]
- Liu, W.; Xu, L.; Wang, Y.; Shen, H.; Zhu, X.; Zhang, K.; Chen, Y.; Yu, R.; Limera, C.; Liu, L. Transcriptome-wide analysis of chromium-stress responsive microRNAs to explore miRNA-mediated regulatory networks in radish (Raphanus sativus L.). Sci. Rep. 2015, 5, 14024. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Turner, D.A. Miranda: A non-strict functional language with polymorphic types. In Conference on Functional Programming Languages and Computer Architecture; Springer: Berlin/Heidelberg, Germany, 1985; pp. 1–16. [Google Scholar] [CrossRef]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Zhao, W.; Zhan, S.; Li, L.; Zhong, T.; Wang, L.; Dong, Y.; Zhang, H. Identification and expression profiling of miRNAome in goat Longissimus dorsi muscle from prenatal stages to a neonatal stage. PLoS ONE 2016, 11, e0165764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta, C.(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Bai, W.L.; Dang, Y.L.; Yin, R.H.; Jiang, W.Q.; Wang, Z.Y.; Zhu, Y.B.; Wang, S.Q.; Zhao, Y.Y.; Deng, L.; Luo, G.B.; et al. Differential expression of microRNAs and their regulatory networks in skin tissue of Liaoning cashmere goat during hair follicle cycles. Anim. Biotechnol. 2016, 27, 104–112. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.; Wang, X.; Geng, R.; He, X.; Qu, L.; Chen, Y. Discovery of cashmere goat (Capra hircus) microRNAs in skin and hair follicles by Solexa sequencing. BMC Genom. 2013, 14, 511. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, L.; Li, X.; Han, W.; Yang, K.; Wang, H.; Zhang, Y.; Su, R.; Liu, Z.; Wang, R.; et al. High-throughput sequencing of hair follicle development-related micrornas in cashmere goat at various fetal periods. Saudi J. Biol. Sci. 2018, 25, 1494–1508. [Google Scholar] [CrossRef]
- Wang, J.; Hao, Z.; Hu, J.; Liu, X.; Li, S.; Wang, J.; Shen, J.; Song, Y.; Ke, N.; Luo, Y. Small RNA deep sequencing reveals the expressions of microRNAs in ovine mammary gland development at peak-lactation and during the non-lactating period. Genomics 2021, 113 Pt 2, 637–646. [Google Scholar] [CrossRef]
- Ding, Y.; Xue, X.; Liu, Z.; Ye, Y.; Xiao, P.; Pu, Y.; Guan, W.; Mwacharo, J.M.; Ma, Y.; Zhao, Q. Expression profiling and functional characterization of miR-26a and miR-130a in regulating Zhongwei goat hair development via the TGF-β/SMAD pathway. Int. J. Mol. Sci. 2020, 21, 5076. [Google Scholar] [CrossRef]
- Kandyba, E.; Hazen, V.M.; Kobielak, A.; Butler, S.J.; Kobielak, K. Smad1 and 5 but not Smad8 establish stem cell quiescence which is critical to transform the premature hair follicle during morphogenesis toward the postnatal state. Stem Cells 2014, 32, 534–547. [Google Scholar] [CrossRef]
- Ku, A.T.; Miao, Q.; Nguyen, H. Monitoring Wnt/β-Catenin signaling in skin. Methods Mol. Biol. 2016, 1481, 127–140. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.; Lei, M.; Zhou, L.; Bai, X.; Lai, X.; Yu, Y.; Yang, T.; Lian, X. Hair follicle stem cell proliferation, Akt and Wnt signaling activation in TPA-induced hair regeneration. Histochem. Cell Biol. 2017, 147, 749–758. [Google Scholar] [CrossRef] [PubMed]
- Park, P.J.; Moon, B.S.; Lee, S.H.; Kim, S.N.; Kim, A.R.; Kim, H.J.; Park, W.S.; Choi, K.Y.; Cho, E.G.; Lee, T.R. Hair growth-promoting effect of Aconiti Ciliare Tuber extract mediated by the activation of Wnt/β-catenin signaling. Life Sci. 2012, 91, 935–943. [Google Scholar] [CrossRef]
- Gao, W.; Sun, W.; Yin, J.; Lv, X.; Bao, J.; Yu, J.; Wang, L.; Jin, C.; Hu, L. Screening candidate microRNAs (miRNAs) in different lambskin hair follicles in Hu sheep. PLoS ONE 2017, 12, e0176532. [Google Scholar] [CrossRef]
- Yano, K.; Brown, L.F.; Detmar, M. Control of hair growth and follicle size by VEGF-mediated angiogenesis. J. Clin. Investig. 2001, 107, 409–417. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharya, S.; Wheeler, H.; Leid, M.; Ganguli-Indra, G.; Indra, A.K. Transcription factor CTIP2 maintains hair follicle stem cell pool and contributes to altered expression of LHX2 and NFATC1. J. Investig. Dermatol. 2015, 135, 2593–2602. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Liu, L.; Zhang, J.; Cheng, L.; Ren, L.; Zhao, Y. The expression of miR-129-5p and its target genes in the skin of goats. Anim. Biotechnol. 2021, 32, 573–579. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W. Tissue Expression Patterns of miR-129-5p in Goat and its Regulation on Skin Melanogenesis; Southwest University: Chongqing, China, 2021. [Google Scholar]
- Wu, Z.; Fu, Y.; Cao, J.; Yu, M.; Tang, X.; Zhao, S. Identification of differentially expressed miRNAs between white and black hair follicles by RNA-sequencing in the goat (Capra hircus). Int. J. Mol. Sci. 2014, 15, 9531–9545. [Google Scholar] [CrossRef]
- Wang, J.; Zhou, H.; Luo, Y.; Zhao, M.; Gong, H.; Hao, Z.; Hu, J.; Hickford, J.G.H. Variation in the caprine KAP24-1 gene affects cashmere fibre diameter. Animals 2019, 9, 15. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Tian, Y.; Song, Y.; Shi, J.; Xu, J.; Xiong, K.; Li, J.; Xu, W.; Zhao, Y.; Shuai, J.; et al. Msi2 maintains quiescent state of hair follicle stem cells by directly repressing the Hh signaling pathway. J. Investig. Dermatol. 2017, 137, 1015–1024. [Google Scholar] [CrossRef]
- Levy, C.; Khaled, M.; Fisher, D.E. MITF: Master regulator of melanocyte development and melanoma oncogene. Trends Mol. Med. 2006, 12, 406–414. [Google Scholar] [CrossRef]
- Potterf, S.B.; Mollaaghababa, R.; Hou, L.; Southard-Smith, E.M.; Hornyak, T.J.; Arnheiter, H.; Pavan, W.J. Analysis of SOX10 function in neural crest-derived melanocyte development: SOX10-dependent transcriptional control of dopachrome tautomerase. Dev. Biol. 2001, 237, 245–257. [Google Scholar] [CrossRef]
- Huelsken, J.; Vogel, R.; Erdmann, B.; Cotsarelis, G.; Birchmeier, W. β-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 2001, 105, 533–545. [Google Scholar] [CrossRef] [Green Version]
- Huang, H.C.; Lin, H.; Huang, M.C. Lactoferrin promotes hair growth in mice and increases dermal papilla cell proliferation through Erk/Akt and Wnt signaling pathways. Arch. Dermatol. Res. 2019, 311, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Samarajeewa, A.; Jacques, B.E.; Dabdoub, A. Therapeutic potential of Wnt and Notch signaling and epigenetic regulation in mammalian sensory hair cell regeneration. Mol. Ther. 2019, 27, 904–911. [Google Scholar] [CrossRef] [PubMed]
- Pillaiyar, T.; Manickam, M.; Jung, S.H. Downregulation of melanogenesis: Drug discovery and therapeutic options. Drug Discov. Today 2017, 22, 282–298. [Google Scholar] [CrossRef] [PubMed]
- Aubin-Houzelstein, G. Notch signaling and the developing hair follicle. Adv. Exp. Med. Biol. 2012, 727, 142–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Sequence | TPM-Liaoning Cashmere Goats | TPM-Ziwuling Balck Goats | Type |
---|---|---|---|---|
miR-26a-5p | TTCAAGTAATCCAGGATAGGCT | 112,864 | 136,978 | Known caprine miRNA |
miR-27b-3p | TTCACAGTGGCTAAGTTCTGC | 100,446 | 106,071 | Known caprine miRNA |
miR-199a-5p | CCCAGTGTTCAGACTACCTGTTC | 62,866 | 52,205 | Known caprine miRNA |
miR-143-3p | TGAGATGAAGCACTGTAGCTCG | 49,715 | 61,548 | Known caprine miRNA |
miR-99a-5p | AACCCGTAGATCCGATCTTGT | 46,392 | 52,219 | Known caprine miRNA |
miR-10b-5p | TACCCTGTAGAACCGAATTTGT | 21,680 | 38,877 | Known caprine miRNA |
let-7a-5p | TGAGGTAGTAGGTTGTATAGTT | 26,241 | 27,468 | Known caprine miRNA |
miR-125b-5p | TCCCTGAGACCCTAACTTGT | 32,068 | 20,536 | Known caprine miRNA |
miR-24-3p | TGGCTCAGTTCAGCAGGAAC | 17,643 | 23,069 | Known caprine miRNA |
miR-23a | ATCACATTGCCAGGGATTTCC | 17,566 | 18,377 | Known caprine miRNA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiao, L.; Gu, Y.; Guo, S.; Li, S.; Wang, J.; Hao, Z.; Luo, Y.; Liu, X.; Li, S.; Zhao, F.; et al. The Identification and Characteristics of miRNAs Related to Cashmere Fiber Traits in Skin Tissue of Cashmere Goats. Genes 2023, 14, 473. https://doi.org/10.3390/genes14020473
Qiao L, Gu Y, Guo S, Li S, Wang J, Hao Z, Luo Y, Liu X, Li S, Zhao F, et al. The Identification and Characteristics of miRNAs Related to Cashmere Fiber Traits in Skin Tissue of Cashmere Goats. Genes. 2023; 14(2):473. https://doi.org/10.3390/genes14020473
Chicago/Turabian StyleQiao, Lirong, Yuanhua Gu, Shiwei Guo, Shiqiang Li, Jiqing Wang, Zhiyun Hao, Yuzhu Luo, Xiu Liu, Shaobin Li, Fangfang Zhao, and et al. 2023. "The Identification and Characteristics of miRNAs Related to Cashmere Fiber Traits in Skin Tissue of Cashmere Goats" Genes 14, no. 2: 473. https://doi.org/10.3390/genes14020473