Figure 1.
Biplot display of physiological and yield contributing traits viz. days to heading (DTH), lodging (LOD, plant height (PH), peduncle length (PL), peduncle internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomata conductance (SC) of parents and crosses under normal (N) in the field. Arrows depict the correlation among these traits, and the positive and negative shows the positive/negative correlation.
Figure 1.
Biplot display of physiological and yield contributing traits viz. days to heading (DTH), lodging (LOD, plant height (PH), peduncle length (PL), peduncle internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomata conductance (SC) of parents and crosses under normal (N) in the field. Arrows depict the correlation among these traits, and the positive and negative shows the positive/negative correlation.
Figure 2.
Biplot analysis for yield traits viz. days to heading (DTH), lodging (LOD, plant height (PH), peduncle length (PL), peduncle internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomata conductance (SC) of parents and crosses under drought (D) stress in the field. Arrows depict the correlation among these traits, and the positive and negative shows the positive/negative correlation.
Figure 2.
Biplot analysis for yield traits viz. days to heading (DTH), lodging (LOD, plant height (PH), peduncle length (PL), peduncle internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomata conductance (SC) of parents and crosses under drought (D) stress in the field. Arrows depict the correlation among these traits, and the positive and negative shows the positive/negative correlation.
Figure 3.
Correlation estimates of yield traits viz. days to heading (DTH), lodging (LOD, plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomatal conductance (SC) of parents and crosses under normal conditions in the field. Blue shade shows positive association, and the light pink shade depicts the negative correlation. The stars (*) on these shades shows the significance (p ≤ 0.05) of correlation. The circle size showed the degree of association among the traits. The greater the size, the stronger the association will be.
Figure 3.
Correlation estimates of yield traits viz. days to heading (DTH), lodging (LOD, plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomatal conductance (SC) of parents and crosses under normal conditions in the field. Blue shade shows positive association, and the light pink shade depicts the negative correlation. The stars (*) on these shades shows the significance (p ≤ 0.05) of correlation. The circle size showed the degree of association among the traits. The greater the size, the stronger the association will be.
Figure 4.
Correlation estimates of yield traits viz. days to heading (DTH), lodging (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomatal conductance (SC) of parents and crosses under drought stress conditions in the field. Blue shade shows positive association, and the light pink shade depicts a negative correlation. The stars (*) on these shades show the significance (p ≤ 0.05) of correlation. The circle size showed the degree of association among the traits. The greater the size, the stronger the association will be.
Figure 4.
Correlation estimates of yield traits viz. days to heading (DTH), lodging (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (GW), grain yield/plant (GY), chlorophyll contents (CC) and stomatal conductance (SC) of parents and crosses under drought stress conditions in the field. Blue shade shows positive association, and the light pink shade depicts a negative correlation. The stars (*) on these shades show the significance (p ≤ 0.05) of correlation. The circle size showed the degree of association among the traits. The greater the size, the stronger the association will be.
Figure 5.
Comparative Expression Analysis of Rht13 gene in cDNA from of crosses (C) under normal (N) and drought (D) stress. The color in the heat map shows the lowest expression level (orange) and highest expression level (green), the ubiquitin is the internal control. The side 1 Kb ladder showed that the Rht13 gene has the band size of 1089 bp.
Figure 5.
Comparative Expression Analysis of Rht13 gene in cDNA from of crosses (C) under normal (N) and drought (D) stress. The color in the heat map shows the lowest expression level (orange) and highest expression level (green), the ubiquitin is the internal control. The side 1 Kb ladder showed that the Rht13 gene has the band size of 1089 bp.
Figure 6.
Relative expression level of Rht13 gene among 40 crosses (C) at the middle part of peduncle node under both normal and drought stress. Ubiquitin (UBQ5) is used as an internal control.
Figure 6.
Relative expression level of Rht13 gene among 40 crosses (C) at the middle part of peduncle node under both normal and drought stress. Ubiquitin (UBQ5) is used as an internal control.
Figure 7.
Biplot analysis for yield-contributing traits viz. plant height (PH), peduncle length (PL), peduncle internodal length (INTL), spike length (SL), number of spikelets per spike (NSS), number of grains per spike (NGS), number of tillers per plant (NTP) and grain yield per plant (GYP) parents and selected plants of F2 population of five crosses shown as Cross 1 to Cross 5. Circle explains the theoretical maximum extent of the arrows, added by the default confidence interval of 68%, and arrows depict the correlation among these traits.
Figure 7.
Biplot analysis for yield-contributing traits viz. plant height (PH), peduncle length (PL), peduncle internodal length (INTL), spike length (SL), number of spikelets per spike (NSS), number of grains per spike (NGS), number of tillers per plant (NTP) and grain yield per plant (GYP) parents and selected plants of F2 population of five crosses shown as Cross 1 to Cross 5. Circle explains the theoretical maximum extent of the arrows, added by the default confidence interval of 68%, and arrows depict the correlation among these traits.
Figure 8.
Percentage reduction in mean plant height of the segregating plants compared to their parents. This image shows percentage reduction of the plant height of plants compared to their parental genotypes.
Figure 8.
Percentage reduction in mean plant height of the segregating plants compared to their parents. This image shows percentage reduction of the plant height of plants compared to their parental genotypes.
Figure 9.
Effect of reduced plant height gene on plant height, length of internode and internode proportion in parental wheat genotypes and their F
2 population of each Cross 1 to Cross 3 (detail of crosses is given in
Table 4). (
a) internodal length and plant height (
b) internode proportion among parents and F
2 plant progenies of Cross 1, 2 and 3, respectively. Each color shows different internodes from the first basal internode to the first top internode.
Figure 9.
Effect of reduced plant height gene on plant height, length of internode and internode proportion in parental wheat genotypes and their F
2 population of each Cross 1 to Cross 3 (detail of crosses is given in
Table 4). (
a) internodal length and plant height (
b) internode proportion among parents and F
2 plant progenies of Cross 1, 2 and 3, respectively. Each color shows different internodes from the first basal internode to the first top internode.
Figure 10.
Effect of reduced height gene on plant height, length of internode and internode proportion in parental wheat genotypes and their F
2 population Cross 4 and 5 (detail of crosses is given in
Table 4). (
a) internodal length and plant height (
b) internode proportion among parents and F
2 plant progenies of Cross 4 and 5, respectively. Each color shows different internodes from the first basal internode to the first top internode.
Figure 10.
Effect of reduced height gene on plant height, length of internode and internode proportion in parental wheat genotypes and their F
2 population Cross 4 and 5 (detail of crosses is given in
Table 4). (
a) internodal length and plant height (
b) internode proportion among parents and F
2 plant progenies of Cross 4 and 5, respectively. Each color shows different internodes from the first basal internode to the first top internode.
Table 1.
List of parental lines having GA-sensitive and GA-insensitive Rht genes for hybridization in Line × Tester mating design.
Table 1.
List of parental lines having GA-sensitive and GA-insensitive Rht genes for hybridization in Line × Tester mating design.
Sr. No. | Lines (L) | Genes | Testers (T) | Genes |
---|
1. | Chinese Spring | Rht13 | EBW01 TALL#1/JANZ-Rth5//NAVJ07 | Rht1 + Rht5 + Rht13 |
2. | A-131 (27HTN/1-54) | Rht1 | MARA | Rht13 |
3. | PBW65/2*PASTOR | Rht1 | KINGBIRD | |
4. | MILAN/S87230//BAV92*2/3/AKURI #1 | Rht1 | MAGNIF 41 ERT1 | Rht13 |
5. | MILAN/S87230//BAV92/3/AKURI#1/4/MILAN | Rht1 | EBW01 TALL#1/SILVERSTAR-Rht13B//ROLF07 | Rht1 + Rht13b |
6. | AARI-11 (Shalimar 88/V 90A204//MH97) | Rht1 | | |
7. | ZINCOL-16 (OASIS/SKAUZ//4*BCN/3/2*PASTOR/4/T.SPELTA PI348449/5/BACEU#1/6/WBLL1*2/CHAPIO) | Rht1 | | |
8. | UJALA-16 (KIRITATATI/4/2*WEAVER/TSC/WEAVER/3/WEAVER) | Rht1 + Rht22 | | |
Table 2.
List of crosses developed by hybridizing parental genotypes in Line × Tester mating design.
Table 2.
List of crosses developed by hybridizing parental genotypes in Line × Tester mating design.
Cross No. | Cross Name | Cross No. | Cross Name |
---|
C1 | L1 × T1 | C21 | L5 × T1 |
C2 | L1 × T2 | C22 | L5 × T2 |
C3 | L1 × T3 | C23 | L5 × T3 |
C4 | L1 × T4 | C24 | L5 × T4 |
C5 | L1 × T5 | C25 | L5 × T5 |
C6 | L2 × T1 | C26 | L6 × T1 |
C7 | L2 × T2 | C27 | L6 × T2 |
C8 | L2 × T3 | C28 | L6 × T3 |
C9 | L2 × T4 | C29 | L6 × T4 |
C10 | L2 × T5 | C30 | L6 × T5 |
C11 | L3 × T1 | C31 | L7 × T1 |
C12 | L3 × T2 | C32 | L7 × T2 |
C13 | L3 × T3 | C33 | L7 × T3 |
C14 | L3 × T4 | C34 | L7 × T4 |
C15 | L3 × T5 | C35 | L7 × T5 |
C16 | L4 × T1 | C36 | L8 × T1 |
C17 | L4 × T2 | C37 | L8 × T2 |
C18 | L4 × T3 | C38 | L8 × T3 |
C19 | L4 × T4 | C39 | L8 × T4 |
C20 | L4 × T5 | C40 | L8 × T5 |
Table 3.
List of GA-insensitive (Rht1) and GA-sensitive (Rht13) genes with internal control UBQ5 Primers.
Table 3.
List of GA-insensitive (Rht1) and GA-sensitive (Rht13) genes with internal control UBQ5 Primers.
Locus | Gene | 5′F | 5′R | Fragment Length (bp) | Annealing Temperature (°C) |
---|
Traes_7BS_54E859139.1 (primary) | Rht1 | GAGAAGGTCCTGGGCACCGT | AACAGCTGCCCCCCGATGAGA | 228 | 65 |
Xwms577-7B | Rht13 | ATGGCATAATTTGGTGAAATTG | TGTTTCAAGCCCAACTTCTATT | 1089 | 55 |
XM_015783851.1NCBI | UBQ5 | ATGCAGATCTTCGTGAAGACC | CTAGGCCTTCTGGTTGTAGA | 250 | 57 |
Table 4.
List of parental genotypes F2 populations developed by crossing genotypes having GA-insensitive (Rht1) and GA-sensitive (Rht13) genes in Line × Tester mating design.
Table 4.
List of parental genotypes F2 populations developed by crossing genotypes having GA-insensitive (Rht1) and GA-sensitive (Rht13) genes in Line × Tester mating design.
Genotype | Name | Gene |
---|
Parent 1 | PBW65/2*PASTOR | Rht1 |
Parent 2 | EBW01 TALL#1/SILVERSTAR-Rht13B//ROLF07 | Rht1 + Rht13 |
Cross 1 (F2) | PBW65/2*PASTOR × EBW01 TALL#1/SILVERSTAR-Rht13B//ROLF07 | Rht1 + Rht13 |
Parent 1 | MILAN/S87230//BAV92/3/AKURI#1/4/MILAN | Rht1 |
Parent 2 | MARA | Rht13 |
Cross 2 (F2) | MILAN/S87230//BAV92/3/AKURI#1/4/MILAN × MARA | Rht1 + Rht13 |
Parent 1 | PBW65/2*PASTOR | Rht1 |
Parent 2 | EBW01 TALL#1/JANZ-Rth5//NAVJ07 | Rht1 + Rht5 + Rht13 |
Cross 3 (F2) | PBW65/2*PASTOR × EBW01 TALL#1/JANZ-Rth5//NAVJ07 | Rht1 + Rht5 + Rht13 |
Parent 1 | A-131(27-HTN/1-54) | Rht1 |
Parent 2 | MAGNIF 41 ERT1 | Rht13 |
Cross 4 (F2) | A-131(27-HTN/1-54) × MAGNIF 41 ERT1 | Rht1 + Rht13 |
Parent 1 | A-131(27-HTN/1-54 | Rht1 |
Parent 2 | EBW01 TALL#1/SILVERSTAR-Rht13B//ROLF07 | Rht1 + Rht13 |
Cross 5 (F2) | A-131(27-HTN/1-54)×EBW01 TALL#1/SILVERSTAR-Rht13B//ROLF07 | Rht1 + Rht13 |
Table 5.
Mean square for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of parents and F1 under normal conditions.
Table 5.
Mean square for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of parents and F1 under normal conditions.
Source | DF | DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
Rep. (R) | 2 | 2.68 NS | 8.17 NS | 0.39 NS | 2.11 NS | 0.58 NS | 0.08 NS | 5.11 NS | 1.89 * | 10.19 * | 6.49 ** | 3.51 NS | 0.19 NS | 7.53 NS |
Trt. (T) | 52 | 47.03 ** | 266.62 ** | 932.09 ** | 213.42 ** | 43.35 ** | 1.33 ** | 38.15 ** | 11.58 ** | 150.75 ** | 50.61 ** | 231.38 ** | 14.25 ** | 6095.28 ** |
Parents (P) | 12 | 62.30 ** | 710.26 ** | 1105.08 ** | 316.34 ** | 39.08 ** | 1.95 ** | 38.56 ** | 10.91 ** | 134.43 ** | 47.76 ** | 285.92 ** | 16.26 ** | 8372.44 ** |
P vs. C | 1 | 62.65 ** | 4528.57 ** | 3194.18 ** | 172.82 ** | 78.95 ** | 0.07 NS | 109.79 ** | 52.27 ** | 736.23 ** | 52.68 ** | 724.18 ** | 39.14 ** | 10,494.14 ** |
Crosses (C) | 39 | 41.93 ** | 20.83 ** | 820.86 ** | 182.78 ** | 43.76 ** | 1.17 ** | 36.19 ** | 10.74 ** | 140.76 ** | 51.43 ** | 201.97 ** | 12.99 ** | 5281.83 ** |
Lines (L) | 7 | 89.48 * | 20.83 NS | 186.71 NS | 163.90 NS | 10.90 NS | 1.94 NS | 48.96 NS | 12.83 NS | 111.50 NS | 112.17 * | 403.82 * | 7.25 NS | 9784.27 * |
Tester (T) | 4 | 43.40 NS | 20.83 NS | 868.158 NS | 284.43 NS | 37.35 NS | 0.56 NS | 10.65 NS | 29.92 ** | 374.57 * | 52.07 NS | 138.98 NS | 4.10 NS | 4569.84 NS |
L × T | 28 | 29.83 ** | 20.83 ** | 972.65 ** | 172.98 ** | 52.88 ** | 1.06 ** | 36.65 ** | 7.48 ** | 114.67 ** | 36.16 ** | 160.49 ** | 15.69 ** | 4257.94 ** |
Error | 104 | 2.51 | 3.05 | 2.87 | 2.29 | 1.33 | 0.05 | 2.73 | 0.59 | 2.93 | 1.01 | 1.49 | 0.37 | 30.84 |
Total | 158 | | | | | | | | | | | | | |
CV | | | | | | | | | | | | | | |
Table 6.
Mean square for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of parents and F1 crosses under drought stress.
Table 6.
Mean square for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of parents and F1 crosses under drought stress.
Source | DF | DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
Rep. (R) | 2 | 49.38 ** | 11.95 NS | 0.27 NS | 1.94 NS | 3.48 NS | 0.03 NS | 37.44 ** | 8.83 ** | 1.89 NS | 10.03 * | 0.29 NS | 0.41 NS | 385.31 NS |
Trt. (T) | 52 | 33.72 ** | 166.32 ** | 935.63 ** | 166.26 ** | 32.17 ** | 1.17 ** | 23.84 ** | 10.44 ** | 143.70 ** | 32.32 ** | 217.76 ** | 13.85 ** | 5212.75 NS |
Parents (P) | 12 | 23.55 ** | 435.89 ** | 1159.47 ** | 244.67 ** | 25.83 ** | 1.77 ** | 29.39 ** | 9.77 ** | 149.86 ** | 35.20 ** | 271.57 ** | 15.58 ** | 7506.50 ** |
P vs. C | 1 | 20.91 NS | 2898.29 ** | 2725.33 ** | 67.71 ** | 74.57 ** | 0.04 NS | 14.77 NS | 49.74 ** | 611.76 ** | 36.96 ** | 772.16 ** | 30.07 ** | 7836.31 ** |
Crosses (C) | 39 | 37.17 ** | 520.00 ** | 820.87 ** | 144.66 ** | 33.03 ** | 1.02 ** | 22.36 ** | 9.64 ** | 129.81 ** | 31.31 ** | 186.98 ** | 12.89 ** | 4439.71 ** |
Lines (L) | 7 | 89.23 ** | 13.33 NS | 186.71 NS | 150.93 NS | 12.10 NS | 1.62 NS | 20.49 NS | 12.08 NS | 123.31 NS | 50.15 NS | 388.81 * | 7.82 NS | 9281.98 ** |
Tester (T) | 4 | 66.94 * | 13.33 NS | 868.16 NS | 254.39 NS | 36.57 NS | 0.54 NS | 12.65 NS | 27.43 ** | 360.19 * | 34.90 NS | 137.75 NS | 5.16 NS | 4141.80 NS |
L × T | 28 | 19.91 ** | 13.33 ** | 972.65 ** | 127.42 ** | 37.76 ** | 0.93 ** | 24.22 ** | 6.30 ** | 98.52 ** | 26.09 ** | 143.56 ** | 15.27 ** | 3271.69 ** |
Error | 104 | 9.83 | 4.89 | 2.59 | 3.98 | 1.80 | 0.05 | 4.14 | 0.85 | 5.81 | 2.56 | 2.46 | 0.81 | 377.03 |
Total | 158 | | | | | | | | | | | | | |
Table 7.
GCA estimates and proportional contribution for lines (L) and testers (T) under normal condition.
Table 7.
GCA estimates and proportional contribution for lines (L) and testers (T) under normal condition.
GCA Effects | Morphological Traits | Physiological Traits |
---|
DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
Lines |
L1 | 5.23 | 2.92 | 1.92 | 1.70 | 1.26 | −0.10 | 2.13 | −1.64 | −0.52 | 2.91 | −2.86 | −0.88 | −23.00 |
L2 | −1.37 | −0.42 | −0.54 | 2.43 | −0.34 | 0.18 | 0.39 | 1.56 | −1.78 | 2.64 | 7.02 | 0.49 | −23.60 |
L3 | −0.63 | −0.42 | 3.13 | −0.70 | −0.28 | 0.14 | 2.53 | −0.11 | −1.78 | −1.43 | 1.04 | −0.89 | −17.47 |
L4 | −1.23 | −0.42 | −1.01 | −5.50 | 0.59 | 0.41 | −0.88 | −0.44 | 3.75 | −2.49 | −5.63 | −0.03 | 10.67 |
L5 | −0.30 | −0.42 | −1.74 | −1.83 | 0.06 | −0.72 | −0.81 | −0.04 | −2.65 | 2.91 | −4.88 | 0.74 | 36.60 |
L6 | −2.43 | −0.42 | 6.06 | 5.43 | 0.39 | −0.19 | −3.08 | 0.76 | 4.22 | −0.16 | −1.60 | −0.18 | −6.20 |
L7 | −1.10 | −0.42 | −4.74 | −1.97 | −1.68 | 0.34 | −0.81 | −0.24 | −2.32 | 0.11 | 8.36 | −0.24 | −15.13 |
L8 | 1.83 | −0.42 | −3.14 | 0.43 | −0.01 | −0.05 | 0.53 | 0.16 | 1.08 | −4.49 | −1.44 | 0.98 | −38.13 |
PC Lines | 38.3 | 17.95 | 4.08 | 16.09 | 4.47 | 29.76 | 24.28 | 21.45 | 14.22 | 39.14 | 35.89 | 10.02 | 33.25 |
S.E. | 0.41 | 0.45 | 0.44 | 0.39 | 0.29 | 0.06 | 0.43 | 0.19 | 0.44 | 0.26 | 0.32 | 0.16 | 1.43 |
Tester |
T1 | 0.89 | 1.67 | 3.23 | 2.67 | 1.42 | −0.17 | 0.83 | 1.61 | 5.45 | −0.58 | 3.59 | −0.13 | 5.10 |
T2 | 1.26 | −0.42 | 4.23 | 2.63 | 0.92 | 0.17 | 0.41 | −0.93 | −1.55 | 0.30 | −0.42 | 0.15 | 9.56 |
T3 | −0.11 | −0.42 | −10.07 | −4.83 | −1.79 | −0.11 | −0.63 | −0.73 | 1.49 | −0.12 | 0.90 | 0.61 | 13.60 |
T4 | 0.14 | −0.42 | −1.11 | −2.46 | −0.38 | −0.04 | 0.12 | −0.68 | −5.30 | 2.22 | −2.75 | −0.13 | −8.65 |
T5 | −2.19 | −0.42 | 3.73 | 2.00 | −0.17 | 0.15 | −0.72 | 0.73 | −0.09 | −1.83 | −1.31 | −0.50 | −19.61 |
PC Tester | 10.62 | 10.26 | 10.85 | 15.96 | 8.76 | 4.98 | 3.02 | 28.58 | 27.29 | 10.38 | 7.06 | 3.25 | 8.87 |
PC Line × Tester | 51.08 | 71.79 | 85.07 | 67.95 | 86.77 | 65.26 | 72.7 | 49.97 | 58.49 | 50.47 | 57.05 | 86.73 | 57.88 |
S.E. | 0.32 | 0.36 | 0.35 | 0.31 | 0.24 | 0.04 | 0.34 | 0.16 | 0.35 | 0.21 | 0.25 | 0.12 | 1.13 |
Table 8.
GCA estimates and proportional contribution for lines (L) and testers (T) under drought stress in the field.
Table 8.
GCA estimates and proportional contribution for lines (L) and testers (T) under drought stress in the field.
GCA Effects | Morphological Traits | Physiological Traits |
---|
DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
Lines |
L1 | 4.73 | 2.33 | 1.99 | 0.88 | 1.53 | −0.04 | 0.29 | −1.83 | 0.13 | 1.30 | −3.34 | −0.88 | −22.22 |
L2 | −2.88 | −0.33 | −0.54 | 2.95 | −0.41 | 0.19 | 0.23 | 1.37 | −1.17 | 2.10 | 6.73 | −0.44 | −19.02 |
L3 | −0.21 | −0.33 | 3.13 | −0.78 | −0.21 | 0.15 | 2.16 | −0.23 | −2.40 | −0.90 | 1.25 | −0.87 | −20.68 |
L4 | −1.14 | −0.33 | −1.01 | −4.92 | 0.13 | 0.38 | −0.44 | −0.17 | 2.87 | −1.77 | −5.17 | −0.04 | 9.98 |
L5 | 0.73 | −0.33 | −1.74 | −1.78 | 0.13 | −0.66 | −0.18 | 0.03 | −2.87 | 2.17 | −4.87 | 0.76 | 31.12 |
L6 | −1.74 | −0.33 | 6.06 | 5.28 | 0.53 | −0.18 | −2.04 | 0.77 | 3.87 | 0.37 | −1.43 | −0.19 | −4.62 |
L7 | −1.47 | −0.33 | −4.74 | −2.18 | −1.68 | 0.27 | −0.44 | −0.17 | −2.93 | −0.37 | 8.29 | −0.33 | −15.88 |
L8 | 1.99 | −0.33 | −3.14 | 0.55 | −0.01 | −0.11 | 0.43 | 0.23 | 3.00 | −2.90 | −1.48 | 1.09 | 41.32 |
P.C. Lines | 43.08 | 17.95 | 4.08 | 18.73 | 6.58 | 28.66 | 16.45 | 23.87 | 17.05 | 28.75 | 37.32 | 10.89 | 37.52 |
S.E. | 0.81 | 0.57 | 0.41 | 0.52 | 0.35 | 0.06 | 0.53 | 0.24 | 0.62 | 0.41 | 0.40 | 0.23 | 5.01 |
Tester |
T1 | 1.17 | 1.33 | 3.23 | 2.48 | 1.38 | −0.17 | 0.88 | 1.51 | 5.62 | −0.59 | 3.57 | −0.10 | 5.57 |
T2 | 1.17 | −0.33 | 4.23 | 2.36 | 0.72 | 0.13 | 0.50 | −0.83 | −1.84 | −0.13 | −0.71 | 0.16 | 7.61 |
T3 | 0.17 | −0.33 | −10.07 | −4.73 | −1.91 | −0.09 | −0.96 | −0.74 | 1.12 | −0.05 | 1.11 | 0.71 | 12.36 |
T4 | 0.38 | −0.33 | −1.11 | −2.10 | −0.16 | −0.04 | 0.00 | −0.70 | −4.88 | 1.99 | −2.54 | −0.26 | −4.93 |
T5 | −2.88 | −0.33 | 3.73 | 1.98 | −0.03 | 0.18 | −0.42 | 0.76 | −0.01 | −1.22 | −1.42 | −0.51 | −20.60 |
P.C. Tester | 18.47 | 10.26 | 10.85 | 18.04 | 11.35 | 5.42 | 5.8 | 19.19 | 28.46 | 11.43 | 7.56 | 4.09 | 9.57 |
P.C. Line × Tester | 38.45 | 71.79 | 85.07 | 63.24 | 82.07 | 65.92 | 77.75 | 46.94 | 54.49 | 59.82 | 55.12 | 85.01 | 52.91 |
S.E. | 0.64 | 0.45 | 0.33 | 0.41 | 0.27 | 0.05 | 0.42 | 0.19 | 0.49 | 0.33 | 0.32 | 0.18 | 3.96 |
Table 9.
SCA estimates and proportional contribution for lines × testers under normal conditions.
Table 9.
SCA estimates and proportional contribution for lines × testers under normal conditions.
Crosses | DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
L1 × T1 | 4.31 | 11.67 | 39.84 | 9.67 | 8.78 | −0.10 | −2.63 | −2.61 | −6.65 | 2.51 | −9.92 | −0.77 | −18.83 |
L1 × T2 | 3.27 | −2.92 | 10.18 | −1.49 | 1.28 | −0.25 | −1.21 | 1.26 | 0.02 | 1.30 | −5.80 | 2.57 | −2.96 |
L1 × T3 | −5.69 | −2.92 | −13.87 | −1.70 | −3.68 | −0.09 | 2.83 | 0.73 | 2.31 | −0.62 | −5.43 | 1.74 | 30.33 |
L1 × T4 | 3.06 | −2.92 | −10.83 | −4.08 | 0.58 | 0.78 | 4.08 | 0.02 | 4.77 | −6.95 | 9.44 | −1.31 | −4.75 |
L1 × T5 | −4.94 | −2.92 | −25.33 | −2.20 | −6.97 | −0.42 | −3.08 | 0.60 | −0.44 | 3.76 | 11.71 | 2.23 | −3.79 |
L2 × T1 | 0.58 | −1.67 | 8.38 | 0040 | 1.38 | −0.09 | −2.56 | 0.53 | 4.28 | −2.89 | −4.93 | −1.98 | 40.43 |
L2 × T2 | −0.47 | 0.42 | −24.29 | −11.23 | −3.12 | −0.22 | 0.86 | −2.60 | −2.72 | 4.23 | 5.18 | 1.03 | 12.98 |
L2 × T3 | −0.09 | 0.42 | 6.67 | 1.90 | 2.59 | 0.35 | 0.57 | −0.14 | −0.43 | 0.65 | 4.85 | 1.92 | −27.07 |
L2 × T4 | −1.34 | 0.42 | 12.38 | 12.19 | 0.51 | 0.16 | 0.48 | 0.15 | 0.37 | −2.35 | −3.79 | 1.13 | −14.15 |
L2 × T5 | 1.33 | 0.42 | −3.13 | −3.26 | −1.37 | −0.21 | 0.65 | 2.07 | −1.51 | 0.36 | −1.31 | −2.10 | −12.19 |
L3 × T1 | −3.16 | −1.67 | 1.38 | 2.20 | −0.68 | −0.21 | −2.03 | −1.14 | −3.72 | 0.51 | 8.42 | −2.00 | −19.03 |
L3 × T2 | −1.87 | 0.42 | −8.29 | 0.91 | 1.48 | −0.22 | -0.94 | 0.40 | 0.95 | 2.30 | 1.48 | −3.39 | −65.49 |
L3 × T3 | 7.84 | 0.42 | −1.33 | −5.97 | 1.19 | −0.11 | 2.43 | 0.19 | −5.76 | −3.62 | −0.53 | −1.08 | −18.53 |
L3 × T4 | −1.08 | 0.42 | −12.96 | −11.34 | −2.89 | 0.38 | 4.02 | −0.85 | 1.37 | 2.38 | −7.74 | 3.29 | 39.38 |
L3 × T5 | −1.74 | 0.42 | 21.21 | 14.20 | 0.90 | 0.30 | −3.48 | 1.40 | 7.16 | −1.58 | −1.64 | 3.17 | 63.68 |
L4 × T1 | −0.89 | −1.67 | −12.83 | −5.33 | −2.21 | −0.45 | 0.71 | 3.86 | 13.08 | −0.43 | −6.62 | −1.61 | −92.83 |
L4 × T2 | −1.27 | 0.42 | 35.18 | 15.04 | 10.28 | 1.69 | −1.54 | −0.27 | 3.75 | −0.96 | 8.19 | 1.83 | 30.38 |
L4 × T3 | 1.11 | 0.42 | 2.80 | −3.17 | −1.01 | −0.29 | 2.83 | −1.80 | −1.29 | 3.78 | 2.39 | −0.69 | 47.67 |
L4 × T4 | −0.14 | 0.42 | −19.49 | 2.79 | −4.43 | −0.18 | −0.58 | 0.48 | −4.50 | −2.22 | 1.22 | −0.34 | 18.92 |
L4 × T5 | 1.19 | 0.42 | −5.66 | −9.33 | −2.63 | −0.77 | −1.42 | −2.27 | −11.04 | −0.18 | −2.73 | 0.82 | −4.13 |
L5 × T1 | −1.16 | −1.67 | −5.76 | 1.67 | −0.68 | 0.49 | 1.64 | −0.88 | −4.85 | −0.49 | −2.17 | 2.11 | 17.90 |
L5 × T2 | 3.13 | 0.42 | −22.09 | −6.63 | −5.85 | 0.01 | 2.73 | −0.67 | −1.85 | 0.30 | −1.68 | −3.00 | 0.11 |
L5 × T3 | −0.83 | 0.42 | −7.47 | 1.83 | −1.42 | 0.11 | −3.90 | 0.46 | −1.23 | 2.72 | −0.64 | 0.43 | 22.73 |
L5 × T4 | −0.74 | 0.42 | 10.58 | −7.54 | 0.78 | −0.14 | −3.98 | −0.58 | 0.57 | 3.38 | −2.79 | −0.57 | −6.68 |
L5 × T5 | −0.41 | 0.42 | 24.74 | 10.67 | 6.90 | −0.47 | 3.52 | 1.67 | 7.36 | −5.91 | 7.28 | 1.04 | −34.06 |
L6 × T1 | −1.69 | −1.67 | −8.56 | −6.60 | −0.68 | 0.61 | −1.75 | 1.65 | 6.28 | −3.09 | 14.87 | 4.55 | 77.37 |
L6 × T2 | −2.73 | 0.42 | −1.89 | 3.11 | −3.18 | 0.09 | −1.01 | −0.13 | −3.38 | −1.97 | −7.14 | −1.95 | 7.91 |
L6 × T3 | 0.31 | 0.42 | 5.07 | 3.57 | −0.14 | 0.07 | −2.97 | −0.01 | −6.43 | 4.78 | −11.89 | −2.21 | −47.13 |
L6 × T4 | 2.06 | 0.42 | 5.11 | 3.19 | 0.78 | −0.71 | 2.62 | −1.05 | −1.63 | 3.12 | 5.78 | −1.79 | −15.22 |
L6 × T5 | 2.06 | 0.42 | 0.28 | −3.27 | 3.96 | −0.06 | 3.12 | −0.47 | 5.16 | −2.84 | −1.63 | 1.39 | −22.93 |
L7 × T1 | −0.69 | −1.67 | −21.43 | −1.87 | −4.95 | −0.73 | 0.98 | −0.01 | −10.85 | 2.98 | −3.67 | −0.97 | 5.97 |
L7 × T2 | −3.73 | 0.42 | 11.24 | −0.16 | −0.78 | −0.44 | 0.06 | 0.53 | −1.85 | −3.23 | 1.82 | 2.28 | 9.84 |
L7 × T3 | 0.31 | 0.42 | −4.13 | −1.37 | −0.08 | 0.56 | −2.57 | 0.99 | 11.11 | −4.48 | 8.77 | −1.62 | −23.20 |
L7 × T4 | 0.73 | 0.42 | 2.58 | −0.08 | 1.84 | −0.27 | −5.32 | 0.62 | 1.23 | 1.85 | −3.98 | −0.46 | −12.28 |
L7 × T5 | 3.39 | 0.42 | 11.74 | 3.47 | 3.97 | 0.89 | 6.85 | −2.13 | 0.36 | 2.89 | −2.94 | 0.76 | 19.68 |
L8 × T1 | 2.71 | −1.67 | −1.03 | 0.07 | −0.95 | 0.39 | 5.64 | −1.41 | 2.42 | 0.91 | 4.01 | 0.67 | −10.97 |
L8 × T2 | 3.67 | 0.42 | −0.03 | 0.44 | −0.12 | −0.68 | 1.06 | 1.46 | 5.08 | −1.97 | −2.05 | 0.63 | 7.24 |
L8 × T3 | −2.96 | 0.42 | 12.27 | 4.90 | 2.26 | −0.58 | 0.77 | −0.41 | 1.71 | −3.22 | 2.48 | 1.52 | 15.20 |
L8 × T4 | −2.54 | 0.42 | 12.65 | 4.85 | 2.84 | 0.13 | −1.32 | 1.22 | −2.17 | 0.78 | 4.31 | 0.03 | −5.22 |
L8 × T5 | −0.88 | 0.42 | −23.86 | −10.27 | −4.03 | 0.73 | −6.15 | −0.87 | −7.04 | 3.49 | −8.75 | −2.85 | −6.26 |
PC L × T | 51.08 | 71.79 | 85.07 | 67.95 | 86.77 | 65.26 | 72.7 | 49.97 | 58.49 | 50.47 | 57.05 | 86.73 | 57.88 |
S.E. | 0.92 | 1.01 | 0.98 | 0.87 | 0.67 | 0.13 | 0.95 | 0.44 | 0.99 | 0.58 | 0.71 | 0.5 | 3.21 |
Table 10.
SCA estimates and proportional contribution for lines × testers for lines × testers under drought stress in the field.
Table 10.
SCA estimates and proportional contribution for lines × testers for lines × testers under drought stress in the field.
Crosses | DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
L1 × T1 | 3.90 | 9.33 | 39.84 | 7.45 | 7.68 | −0.001 | −2.88 | −2.71 | −5.55 | 0.99 | −9.21 | −1.06 | −26.70 |
L1 × T2 | 1.90 | −2.33 | 10.18 | −2.09 | 1.35 | −0.26 | −0.83 | 0.96 | 0.91 | 0.53 | −5.26 | 2.65 | −0.41 |
L1 × T3 | −4.77 | −2.33 | −13.87 | −0.34 | −3.69 | −0.11 | 2.63 | 0.54 | 1.95 | −0.88 | −5.39 | 1.44 | 40.17 |
L1 × T4 | 0.69 | −2.33 | −10.83 | −3.30 | 0.56 | 0.77 | 3.67 | 0.17 | 3.62 | −4.59 | 9.29 | −0.75 | −10.20 |
L1 × T5 | −1.73 | −2.33 | −25.33 | −1.72 | −5.90 | −0.41 | −2.58 | 1.04 | −0.93 | 3.95 | 10.57 | −2.94 | −2.87 |
L2 × T1 | 0.83 | −1.33 | 8.38 | −0.28 | 0.62 | −0.01 | −3.48 | 1.09 | 4.25 | −2.14 | −5.03 | −1.63 | 44.42 |
L2 × T2 | 0.17 | 0.33 | −24.29 | −9.83 | −2.72 | −0.23 | 1.57 | −2.58 | −2.96 | 4.40 | 5.75 | 0.19 | 11.73 |
L2 × T3 | 2.83 | 0.33 | 6.67 | 1.59 | 2.58 | 0.37 | 0.03 | −0.33 | 0.42 | 0.32 | 4.70 | 2.37 | −26.69 |
L2 × T4 | 0.96 | 0.33 | 12.38 | 10.63 | 0.49 | 0.08 | −0.27 | 0.30 | 0.08 | −2.73 | −3.91 | 1.05 | −20.07 |
L2 × T5 | −4.79 | 0.33 | −3.13 | −2.12 | −0.97 | −0.21 | 2.15 | 1.51 | −1.79 | 0.15 | −1.51 | −1.97 | −9.40 |
L3 × T1 | −1.50 | −1.33 | 1.38 | 2.12 | −0.92 | −0.11 | 0.93 | −1.31 | −4.02 | 1.19 | 8.19 | −1.79 | −17.56 |
L3 × T2 | −1.83 | 0.33 | −8.29 | 0.91 | 1.42 | −0.30 | −1.70 | 0.69 | 2.44 | 2.07 | 1.33 | −3.22 | −51.28 |
L3 × T3 | 4.83 | 0.33 | −1.33 | −5.01 | 1.04 | −0.14 | 0.43 | −0.06 | −4.52 | −3.68 | −0.55 | −1.06 | −16.36 |
L3 × T4 | −1.38 | 0.33 | −12.96 | −9.63 | −2.38 | 0.25 | 2.47 | −0.43 | −0.52 | 1.94 | −7.19 | 3.08 | 44.93 |
L3 × T5 | −0.13 | 0.33 | 21.21 | 11.62 | 0.83 | 0.31 | −2.12 | 1.11 | 6.61 | −1.52 | −1.79 | 2.99 | 40.27 |
L4 × T1 | −0.23 | −1.33 | −12.83 | −4.75 | −1.558 | −0.44 | 1.86 | 3.63 | 12.72 | −1.28 | −5.69 | −1.79 | −55.90 |
L4 × T2 | −1.23 | 0.33 | 35.18 | 13.38 | 8.42 | 1.63 | 0.23 | −0.04 | 2.51 | −0.73 | 7.38 | 2.25 | −4.61 |
L4 × T3 | −0.23 | 0.33 | 2.80 | −2.21 | −0.96 | −0.28 | 1.69 | −1.46 | −0.78 | 3.52 | 1.79 | −0.56 | 39.64 |
L4 × T4 | −0.78 | 0.33 | −19.49 | 2.17 | −4.04 | −0.17 | −1.93 | −0.17 | −4.78 | −0.86 | −0.88 | −0.32 | 24.27 |
L4 × T5 | 2.48 | 0.33 | −5.66 | −8.58 | −1.83 | −0.74 | −1.85 | −1.96 | −9.66 | −0.65 | −2.61 | 0.42 | −3.40 |
L5 × T1 | −1.77 | −1.33 | −5.76 | 1.45 | −0.92 | 0.50 | 0.59 | −0.91 | −4.55 | 0.46 | −2.85 | 1.96 | −13.03 |
L5 × T2 | 2.23 | 0.33 | −22.09 | −5.09 | −4.92 | −0.01 | 2.30 | −0.58 | −2.43 | −1.67 | −2.05 | −2.86 | 7.93 |
L5 × T3 | 0.23 | 0.33 | −7.47 | 1.33 | −0.29 | 0.01 | −2.91 | 0.68 | −0.38 | 2.25 | −0.59 | 0.58 | 22.18 |
L5 × T4 | −1.64 | 0.33 | 10.58 | −7.30 | 0.29 | −0.11 | −3.53 | −0.37 | 1.28 | 3.88 | −2.03 | −0.93 | 6.48 |
L5 × T5 | 0.94 | 0.33 | 24.74 | 9.62 | 5.83 | −0.39 | 3.55 | 1.18 | 6.08 | −4.92 | 7.53 | 1.26 | −23.53 |
L6 × T1 | −0.63 | −1.33 | −8.56 | −4.95 | 0.02 | 0.51 | −1.88 | 1.69 | 6.05 | −2.74 | 14.16 | 4.45 | 75.37 |
L6 × T2 | −1.97 | 0.33 | −1.89 | 1.51 | −2.65 | 0.04 | −1.17 | −0.31 | −2.15 | −1.87 | −6.87 | −1.98 | 19.65 |
L6 × T3 | 0.03 | 0.33 | 5.07 | 2.59 | −0.35 | 0.16 | −2.04 | −0.06 | −7.12 | 4.38 | −11.03 | −1.96 | −48.43 |
L6 × T4 | 1.16 | 0.33 | 5.11 | 4.30 | 0.89 | −0.55 | 3.67 | −0.77 | −1.12 | 2.34 | 4.95 | −1.48 | −22.13 |
L6 × T5 | 1.41 | 0.33 | 0.28 | −3.45 | 2.10 | −0.15 | 1.42 | −0.56 | 4.34 | −2.12 | −1.21 | 0.97 | −24.47 |
L7 × T1 | −1.90 | −1.33 | −21.43 | −1.15 | −3.78 | −0.75 | 0.53 | −0.04 | −11.15 | 1.99 | −2.72 | −1.24 | 3.30 |
L7 × T2 | −2.90 | 0.33 | 11.24 | −0.69 | −0.78 | −0.27 | −0.77 | 0.63 | −1.03 | −1.13 | 1.39 | 2.75 | 14.26 |
L7 × T3 | −0.23 | 0.33 | −4.13 | −0.94 | 0.18 | 0.46 | −1.31 | 0.54 | 11.35 | −4.22 | 8.92 | −2.25 | −19.49 |
L7 × T4 | 2.23 | 0.33 | 2.78 | −0.57 | 1.09 | −0.26 | −2.93 | 0.83 | 0.68 | 0.74 | −4.32 | −0.44 | −21.53 |
L7 × T5 | 2.81 | 0.33 | 11.74 | 3.35 | 3.30 | 0.82 | 4.48 | −1.96 | 0.14 | 2.62 | −3.27 | 1.18 | 23.47 |
L8 × T1 | 1.30 | −1.33 | −1.03 | 0.12 | −1.12 | 0.30 | 4.33 | −1.44 | 2.25 | 1.53 | 3.14 | 1.11 | −9.90 |
L8 × T2 | 3.63 | 0.33 | −0.03 | 1.91 | −0.12 | −0.59 | 0.37 | 1.23 | 2.71 | −1.60 | −1.66 | 0.23 | 2.73 |
L8 × T3 | −2.70 | 0.33 | 12.27 | 2.99 | 1.51 | −0.47 | 1.49 | 0.14 | −0.92 | −1.68 | 2.14 | 1.43 | 8.98 |
L8 × T4 | −1.24 | 0.33 | 12.64 | 3.70 | 3.09 | −0.001 | −1.13 | 0.43 | 0.75 | −0.73 | 4.11 | −0.21 | −1.73 |
L8 × T5 | −0.99 | 0.33 | −23.86 | −8.72 | −3.37 | 0.77 | −5.05 | −0.36 | −4.79 | 2.48 | −7.72 | −2.55 | −0.07 |
PC L × T | 38.45 | 71.79 | 85.07 | 63.24 | 82.07 | 65.92 | 77.75 | 46.94 | 54.49 | 59.82 | 55.12 | 85.01 | 52.91 |
S.E. | 1.81 | 1.28 | 0.93 | 1.15 | 0.78 | 0.13 | 1.18 | 0.53 | 1.39 | 0.92 | 0.91 | 0.52 | 11.21 |
Table 11.
Genetic components for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of wheat genotypes under normal conditions in the field.
Table 11.
Genetic components for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of wheat genotypes under normal conditions in the field.
Genetic Components | Morphological Traits | Physiological Traits |
---|
DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
Cov H.S. (lines) | 3.97 | 2.37 × 10−15 | −52.39 | −0.61 | −2.79 | 0.06 | 0.82 | 0.36 | −0.21 | 5.07 | 16.22 | −0.56 | 368.42 |
Cov H.S. (tester) | 0.56 | 1.63 × 10−15 | −4.35 | 4.64 | −0.65 | −0.02 | −1.08 | 0.94 | 10.83 | 0.66 | −0.89 | −0.48 | 12.99 |
Cov H.S. (average) | 0.21 | 1.94 × 10−16 | −2.68 | 0.17 | −0.16 | 0.001 | −0.01 | 0.06 | 0.46 | 0.27 | 0.73 | −0.05 | 18.06 |
Cov F.S. (average) | 17.24 | 5.93 | 224.33 | 68.27 | 10.79 | 0.38 | 9.79 | 5.39 | 65.77 | 21.93 | 77.64 | 2.88 | 2057.73 |
σ 2 gca | 0.43 | 3.89 × 10−16 | −5.35 | 0.35 | −0.32 | 0.003 | −0.02 | 0.12 | 0.92 | 0.54 | 1.46 | −0.09 | 36.12 |
σ 2 sca | 9.11 | 5.93 | 323.26 | 56.89 | 17.18 | 0.34 | 11.31 | 2.29 | 37.25 | 11.72 | 53.00 | 5.11 | 1409.03 |
σ 2 gca/σ 2 sca | 0.05 | 6.5 × 10−17 | −0.02 | 0.01 | 0.02 | 0.001 | −0.002 | 0.05 | 0.02 | 0.05 | 0.03 | −0.02 | 0.03 |
F = 0 Additive genetic variance | 0.85 | 7.78 × 10−16 | −10.71 | 0.69 | −0.64 | 0.01 | −0.03 | 0.23 | 1.84 | 1.08 | 2.93 | −0.19 | 72.24 |
F = 1 Additive genetic variance | 0.43 | 3.89 × 10−16 | −5.35 | 0.35 | −0.32 | 0.003 | −0.02 | 0.12 | 0.92 | 0.54 | 1.46 | −0.09 | 36.12 |
F = 0 Variance due to dominance | 18.21 | 11.86 | 646.52 | 113.79 | 34.37 | 0.68 | 22.62 | 4.59 | 74.49 | 23.43 | 106.00 | 10.22 | 2818.06 |
F = 1 Variance due to dominance | 9.11 | 5.93 | 323.26 | 56.89 | 17.18 | 0.34 | 11.31 | 2.29 | 37.25 | 11.72 | 53.00 | 5.11 | 1409.03 |
Table 12.
Genetic components for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of wheat genotypes under drought stress conditions in the field.
Table 12.
Genetic components for days to heading (DTH), lodging % (LOD), plant height (PH), peduncle length (PL), internodal length (INTL), stem diameter (SD), days to maturity (DTM), spike length (SL), number of grains/spike (NGS), 1000-grain weight (TGW), grain yield per plant (GYP), chlorophyll contents (CC) and stomatal conductance (SC) of wheat genotypes under drought stress conditions in the field.
Genetic Components | Morphological Traits | Physiological Traits |
---|
DTH | LOD | PH | PL | INTL | SD | DTM | SL | NGS | TGW | GYP | CC | SC |
---|
Cov H.S. (lines) | 4.62 | 3.55 × 10−16 | −52.39 | 1.57 | −1.71 | 0.05 | −0.25 | 0.43 | 1.65 | 1.60 | 17.35 | −0.49 | 400.69 |
Cov H.S. (tester) | 1.96 | 4.44 × 10−16 | −4.35 | 5.29 | −0.05 | −0.02 | −0.48 | 0.88 | 10.90 | 0.37 | −0.24 | −0.42 | 36.25 |
Cov H.S. (average) | 0.30 | 3.54 × 10−17 | −2.68 | 0.30 | −0.08 | 0.001 | −0.03 | 0.05 | 0.55 | 0.09 | 0.77 | −0.04 | 20.60 |
Cov F.S. (average) | 16.29 | 2.81 | 224.42 | 57.86 | 9.00 | 0.326 | 4.99 | 4.88 | 62.73 | 11.49 | 73.64 | 2.87 | 1729.38 |
σ 2 gca | 0.61 | 7.07 × 10−17 | −5.35 | 0.61 | −0.17 | 0.003 | −0.06 | 0.12 | 1.10 | 0.18 | 1.53 | −0.08 | 41.21 |
σ 2 sca | 3.36 | 2.811 | 323.35 | 57.86 | 11.98 | 0.294 | 6.69 | 1.82 | 30.90 | 7.84 | 47.03 | 4.82 | 964.89 |
σ 2 gca/σ 2 sca | 0.18 | 2.51 × 10−17 | −0.02 | 0.01 | −0.01 | 0.010 | −0.01 | 0.07 | 0.04 | 0.02 | 0.03 | −0.02 | 0.04 |
F = 0 Additive genetic variance | 1.22 | 1.41 × 10−16 | −10.71 | 1.22 | −0.33 | 0.006 | −0.13 | 0.24 | 2.21 | 0.37 | 3.06 | −0.17 | 82.41 |
F = 1 Additive genetic variance | 0.61 | 7.07 × 10−17 | −5.35 | 0.61 | −0.17 | 0.003 | −0.06 | 0.12 | 1.10 | 0.18 | 1.53 | −0.08 | 41.21 |
F = 0 Variance due to dominance | 6.72 | 5.62 | 646.71 | 82.29 | 23.91 | 0.588 | 13.38 | 3.63 | 61.81 | 15.69 | 94.07 | 9.64 | 1929.78 |
F = 1 Variance due to dominance | 3.36 | 2.81 | 323.35 | 41.15 | 11.98 | 0.294 | 6.69 | 1.82 | 30.90 | 7.84 | 47.04 | 4.82 | 964.89 |
Table 13.
Mean value of yield contributing traits measured among parents and F2 populations of the selected plants for Rht1, Rht13, Rht5 + Rht13, Rht1 + Rht5 + Rht13 dwarfing alleles.
Table 13.
Mean value of yield contributing traits measured among parents and F2 populations of the selected plants for Rht1, Rht13, Rht5 + Rht13, Rht1 + Rht5 + Rht13 dwarfing alleles.
Traits | Mean Value of Alleles | Contrast among Alleles |
---|
Rht1 | Rht13 | Rht5 + Rht13 | Rht1 + Rht5 + Rht13 | Rht1 vs. Rht 13 | Rht1 vs. Rht5 + Rht13 | Rht1 vs. Rht1 + Rht5 + Rht13 |
---|
Plant height (PH), cm | 134 | 91 | 88 | 74 | −32 | −34 | −45 |
Peduncle length (PL), cm | 45 | 30 | 31 | 21 | −33 | −31 | −53 |
Peduncle internodal length (INTL), cm | 23 | 17 | 16 | 12 | −26 | −30 | −48 |
Spike length (SL), cm | 10 | 12 | 15 | 15 | 20 | 30 | 50 |
Number of spikelets per spike (NSS) | 19 | 21 | 19 | 25 | 11 | 0 | 32 |
Number of grains per spike (NGS) | 54 | 63 | 68 | 64 | 17 | 26 | 19 |
Number of tillers per plant (NTP) | 8 | 15 | 15 | 12 | 88 | 88 | 50 |
Grain yield per plant (GYP), g | 14 | 17 | 18 | 21 | 29 | 29 | 50 |