Modulation of Fat Deposition–Gut Interactions in Obese Mice by Administrating with Nobiletin
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Preparation and Grouping of Animal Models
2.3. Hematoxylin and Eosin Staining
2.4. Glucose Tolerance Tests and Serum Levels of TC and TG Analysis
2.5. RNA Extraction and RT-qPCR
2.6. 16S rRNA Gene Sequence Analysis
2.7. Statistics Analysis
3. Results
3.1. NOB Supervision Depresses HFD-Induced Obesity
3.2. NOB Ameliorates Hyperlipidemia and Lipid Metabolic Disorder in HFD-Induced Obese Mice
3.3. NOB Administration Regulates the Composition of Intestinal Flora in Mice
3.4. NOB Administration Improves the Intestinal Flora Diversity of Mice
3.5. NOB Administration Attenuates HFD−Induced Gut Microbial and Modified Metabolism Pathway
3.6. NOB Administration Converts the Correlation between Fat Deposition and Intestinal Flora
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Swinburn, B.A.; Sacks, G.; Hall, K.D.; McPherson, K.; Finegood, D.T.; Moodie, M.L.; Gortmaker, S.L. The global obesity pandemic: Shaped by global drivers and local environments. Lancet 2011, 378, 804–814. [Google Scholar] [CrossRef] [PubMed]
- Hill, J.O. Understanding and addressing the epidemic of obesity: An energy balance perspective. Endocr. Rev. 2006, 27, 750–761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morigny, P.; Boucher, J.; Arner, P.; Langin, D. Lipid and glucose metabolism in white adipocytes: Pathways, dysfunction and therapeutics. Nat. Rev. Endocrinol. 2021, 17, 276–295. [Google Scholar] [CrossRef] [PubMed]
- Tamboli, C.P.; Neut, C.; Desreumaux, P.; Colombel, J.F. Dysbiosis in inflammatory bowel disease. Gut 2004, 53, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Duca, F.; Gerard, P.; Covasa, M.; Lepage, P. Metabolic interplay between gut bacteria and their host. Front. Horm. Res. 2014, 42, 73–82. [Google Scholar]
- Backhed, F.; Ding, H.; Wang, T.; Hooper, L.V.; Koh, G.Y.; Nagy, A.; Semenkovich, C.F.; Gordon, J.I. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. USA 2004, 101, 15718–15723. [Google Scholar] [CrossRef] [Green Version]
- Backhed, F.; Manchester, J.K.; Semenkovich, C.F.; Gordon, J.I. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc. Natl. Acad. Sci. USA 2007, 104, 979–984. [Google Scholar] [CrossRef] [Green Version]
- Ley, R.E.; Backhed, F.; Turnbaugh, P.; Lozupone, C.A.; Knight, R.D.; Gordon, J.I. Obesity alters gut microbial ecology. Proc. Natl. Acad. Sci. USA 2005, 102, 11070–11075. [Google Scholar] [CrossRef] [Green Version]
- Armougom, F.; Henry, M.; Vialettes, B.; Raccah, D.; Raoult, D. Monitoring bacterial community of human gut microbiota reveals an increase in Lactobacillus in obese patients and methanogens in anorexic patients. PLoS ONE 2009, 4, e7125. [Google Scholar] [CrossRef] [Green Version]
- Million, M.; Angelakis, E.; Paul, M.; Armougom, F.; Leibovici, L.; Raoult, D. Comparative meta-analysis of the effect of Lactobacillus species on weight gain in humans and animals. Microb. Pathog. 2012, 53, 100–108. [Google Scholar] [CrossRef]
- Kalliomaki, M.; Collado, M.C.; Salminen, S.; Isolauri, E. Early differences in fecal microbiota composition in children may predict overweight. Am. J. Clin. Nutr. 2008, 87, 534–538. [Google Scholar] [CrossRef] [Green Version]
- Yin, Y.N.; Yu, Q.F.; Fu, N.; Liu, X.W.; Lu, F.G. Effects of four Bifidobacteria on obesity in high-fat diet induced rats. World J. Gastroenterol. 2010, 16, 3394–3401. [Google Scholar] [CrossRef]
- Malik, S.; Bhatia, J.; Suchal, K.; Gamad, N.; Dinda, A.K.; Gupta, Y.K.; Arya, D.S. Nobiletin ameliorates cisplatin-induced acute kidney injury due to its anti-oxidant, anti-inflammatory and anti-apoptotic effects. Exp. Toxicol. Pathol. 2015, 67, 427–433. [Google Scholar] [CrossRef]
- Yasuda, N.; Ishii, T.; Oyama, D.; Fukuta, T.; Agato, Y.; Sato, A.; Shimizu, K.; Asai, T.; Asakawa, T.; Kan, T.; et al. Neuroprotective effect of nobiletin on cerebral ischemia-reperfusion injury in transient middle cerebral arteryoccluded rats. Brain Res. 2014, 1559, 46–54. [Google Scholar] [CrossRef]
- Zhang, N.; Yang, Z.; Xiang, S.Z.; Jin, Y.G.; Wei, W.Y.; Bian, Z.Y.; Deng, W.; Tang, Q.Z. Nobiletin attenuates cardiac dysfunction, oxidative stress, and inflammatory in streptozotocin: Induced diabetic cardiomyopathy. Mol. Cell. Biochem. 2016, 417, 87–96. [Google Scholar] [CrossRef]
- Choi, Y.; Kim, Y.; Ham, H.; Park, Y.; Jeong, H.S.; Lee, J. Nobiletin suppresses adipogenesis by regulating the expression of adipogenic transcription factors and the activation of AMP-activated protein kinase (AMPK). J. Agric. Food Chem. 2011, 59, 12843–12849. [Google Scholar] [CrossRef]
- Lone, J.; Parray, H.A.; Yun, J.W. Nobiletin induces brown adipocyte-like phenotype and ameliorates stress in 3T3-L1 adipocytes. Biochimie 2018, 146, 97–104. [Google Scholar] [CrossRef]
- Saito, T.; Abe, D.; Sekiya, K. Nobiletin enhances differentiation and lipolysis of 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun. 2007, 357, 371–376. [Google Scholar] [CrossRef]
- Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [Green Version]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [Green Version]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ley, R.E.; Turnbaugh, P.J.; Klein, S.; Gordon, J.I. Microbial ecology: Human gut microbes associated with obesity. Nature 2006, 444, 1022–1023. [Google Scholar] [CrossRef]
- Hussain, T.; Tan, B.; Murtaza, G.; Liu, G.; Rahu, N.; Saleem Kalhoro, M.; Hussain Kalhoro, D.; Adebowale, T.O.; Usman Mazhar, M.; Rehman, Z.U.; et al. Flavonoids and type 2 diabetes: Evidence of efficacy in clinical and animal studies and delivery strategies to enhance their therapeutic efficacy. Pharmacol. Res. 2020, 152, 104629. [Google Scholar] [CrossRef]
- Eseberri, I.; Miranda, J.; Lasa, A.; Churruca, I.; Portillo, M.P. Doses of Quercetin in the Range of Serum Concentrations Exert Delipidating Effects in 3T3-L1 Preadipocytes by Acting on Different Stages of Adipogenesis, but Not in Mature Adipocytes. Oxid. Med. Cell. Longev. 2015, 2015, 480943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vessal, M.; Hemmati, M.; Vasei, M. Antidiabetic effects of quercetin in streptozocin-induced diabetic rats. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2003, 135C, 357–364. [Google Scholar] [CrossRef] [PubMed]
- Arias, N.; Macarulla, M.T.; Aguirre, L.; Martínez-Castaño, M.G.; Portillo, M.P. Quercetin can reduce insulin resistance without decreasing adipose tissue and skeletal muscle fat accumulation. Genes Nutr. 2014, 9, 361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zang, Y.; Zhang, L.; Igarashi, K.; Yu, C. The anti-obesity and anti-diabetic effects of kaempferol glycosides from unripe soybean leaves in high-fat-diet mice. Food Funct. 2015, 6, 834–841. [Google Scholar] [CrossRef]
- Floyd, Z.E.; Wang, Z.Q.; Kilroy, G.; Cefalu, W.T. Modulation of peroxisome proliferator-activated receptor gamma stability and transcriptional activity in adipocytes by resveratrol. Metabolism 2008, 57, S32–S38. [Google Scholar] [CrossRef] [Green Version]
- Szkudelski, T.; Szkudelska, K. Resveratrol and diabetes: From animal to human studies. Biochim. Biophys. Acta 2015, 1852, 1145–1154. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Zhang, X.; Guo, F.; Wu, W.; Zhang, T. Characterization of tetracycline resistant bacterial community in saline activated sludge using batch stress incubation with high-throughput sequencing analysis. Water Res. 2013, 47, 4207–4216. [Google Scholar] [CrossRef]
- Wang, P.; Gao, J.; Ke, W.; Wang, J.; Li, D.; Liu, R.; Jia, Y.; Wang, X.; Chen, X.; Chen, F.; et al. Resveratrol reduces obesity in high-fat diet-fed mice via modulating the composition and metabolic function of the gut microbiota. Free Radic. Biol. Med. 2020, 156, 83–98. [Google Scholar] [CrossRef]
- Li, A.; Wang, J.; Kou, R.; Chen, M.; Zhang, B.; Zhang, Y.; Liu, J.; Xing, X.; Peng, B.; Wang, S. Polyphenol-rich oolong tea alleviates obesity and modulates gut microbiota in high-fat diet-fed mice. Front Nutr. 2022, 9, 937279. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Chen, J.; Yi, K.; Peng, L.; Xie, J.; Gou, X.; Peng, T.; Tang, L. Phlorizin ameliorates obesity-associated endotoxemia and insulin resistance in high-fat diet-fed mice by targeting the gut microbiota and intestinal barrier integrity. Gut Microbes 2020, 12, 1–18. [Google Scholar] [CrossRef]
- Xu, P.; Hong, F.; Wang, J.; Cong, Y.; Dai, S.; Wang, S.; Wang, J.; Jin, X.; Wang, F.; Liu, J.; et al. Microbiome Remodeling via the Montmorillonite Adsorption-Excretion Axis Prevents Obesity-related Metabolic Disorders. EBioMedicine 2017, 16, 251–261. [Google Scholar] [CrossRef] [Green Version]
- Saad, M.J.; Santos, A.; Prada, P.O. Linking Gut Microbiota and Inflammation to Obesity and Insulin Resistance. Physiology 2016, 31, 283–293. [Google Scholar] [CrossRef] [Green Version]
- Flint, H.J.; Bayer, E.A.; Rincon, M.T.; Lamed, R.; White, B.A. Polysaccharide utilization by gut bacteria: Potential for new insights from genomic analysis. Nat. Rev. Microbiol. 2008, 6, 121–131. [Google Scholar] [CrossRef]
- Mardinoglu, A.; Shoaie, S.; Bergentall, M.; Ghaffari, P.; Zhang, C.; Larsson, E.; Bäckhed, F.; Nielsen, J. The gut microbiota modulates host amino acid and glutathione metabolism in mice. Mol. Syst. Biol. 2015, 11, 834. [Google Scholar] [CrossRef]
- Dai, Z.L.; Wu, G.; Zhu, W.Y. Amino acid metabolism in intestinal bacteria: Links between gut ecology and host health. Front. Biosci. Landmark Ed. 2011, 16, 1768–1786. [Google Scholar] [CrossRef] [Green Version]
- Schoeler, M.; Caesar, R. Dietary lipids, gut microbiota and lipid metabolism. Rev. Endocr. Metab. Disord. 2019, 20, 461–472. [Google Scholar] [CrossRef] [Green Version]
- Yoo, S.R.; Kim, Y.J.; Park, D.Y.; Jung, U.J.; Jeon, S.M.; Ahn, Y.T.; Huh, C.S.; McGregor, R.; Choi, M.S. Probiotics L. plantarum and L. curvatus in combination alter hepatic lipid metabolism and suppress diet-induced obesity. Obesity 2013, 21, 2571–2578. [Google Scholar] [CrossRef]
- An, H.M.; Park, S.Y.; Lee, D.K.; Kim, J.R.; Cha, M.K.; Lee, S.W.; Lim, H.T.; Kim, K.J.; Ha, N.J. Antiobesity and lipid-lowering effects of Bifidobacterium spp. in high fat diet-induced obese rats. Lipids Health Dis. 2011, 10, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baradaran, A.; Dehghanbanadaki, H.; Naderpour, S.; Pirkashani, L.M.; Rajabi, A.; Rashti, R.; Riahifar, S.; Moradi, Y. The association between Helicobacter pylori and obesity: A systematic review and meta-analysis of case-control studies. Clin. Diabetes Endocrinol. 2021, 7, 15. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Wu, P.; Tian, Y.; Liu, B.; Huang, L.; Liu, Z.; Lin, N.; Xu, N.; Ruan, Y.; Zhang, Z.; et al. Gut Microbiota Serves a Predictable Outcome of Short-Term Low-Carbohydrate Diet (LCD) Intervention for Patients with Obesity. Microbiol. Spectr. 2021, 9, e0022321. [Google Scholar] [CrossRef] [PubMed]
- Medawar, E.; Haange, S.B.; Rolle-Kampczyk, U.; Engelmann, B.; Dietrich, A.; Thieleking, R.; Wiegank, C.; Fries, C.; Horstmann, A.; Villringer, A.; et al. Gut microbiota link dietary fiber intake and short-chain fatty acid metabolism with eating behavior. Transl. Psychiatry 2021, 11, 500. [Google Scholar] [CrossRef] [PubMed]
- Song, W.; Song, C.; Li, L.; Wang, T.; Hu, J.; Zhu, L.; Yue, T. Lactobacillus alleviated obesity induced by high-fat diet in mice. J Food Sci. 2021, 86, 5439–5451. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward primers(5′-3′) | Reverse primers(5′-3′) |
GAPDH | TGGCCTTCCGTGTTCCTAC | GAGTTGCTGTTGAAGTCGCA |
C/EBPα | TGGACAAGAACAGCAACGAG | TCACTGGTCAACTCCAGCAC |
ap2 | AAGAAGTGGGAGTGGGCTTTG | CTCTTCACCTTCCTGTCGTCTG |
PPAR-γ | CCAAGAATACCAAAGTGCGATCA | CCCACAGACTCGGCACTCAAT |
SREBP-1c | GGAGCCATGGATTGCACATT | GGCCCGGGAAGTCACTGT |
FASN | GCTGCGGAAACTTCAGGAAAT | AGAGACGTGTCACTCCTGGACTT |
ATGL | TTCGCAATCTCTACCGCCTC | AAAGGGTTGGGTTGGTTCAG |
HSL | GCTGGGCTGTCAAGCACTGT | GTAACTGGGTAGGCTGCCAT |
LPL | CCAATGGAGGCACTTTCCA | TGGTCCACGTCTCCGAGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, C.; Guo, J.; Du, C.; Xu, Y. Modulation of Fat Deposition–Gut Interactions in Obese Mice by Administrating with Nobiletin. Genes 2023, 14, 1062. https://doi.org/10.3390/genes14051062
Zhao C, Guo J, Du C, Xu Y. Modulation of Fat Deposition–Gut Interactions in Obese Mice by Administrating with Nobiletin. Genes. 2023; 14(5):1062. https://doi.org/10.3390/genes14051062
Chicago/Turabian StyleZhao, Cunzhen, Jiahua Guo, Chunyu Du, and Yongjie Xu. 2023. "Modulation of Fat Deposition–Gut Interactions in Obese Mice by Administrating with Nobiletin" Genes 14, no. 5: 1062. https://doi.org/10.3390/genes14051062