Screening and Validation of Internal Reference Genes for Quantitative Real-Time PCR Analysis of Leaf Color Mutants in Dendrobium officinale
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Sampling
2.2. Selection of Candidate Internal RGs and Chlorophyll Pathway-Related Genes
2.3. Total RNA Extraction and cDNA Synthesis
2.4. qRT-PCR Analysis and Validation of the Most Reliable RG
2.5. Stability and Statistical Analyses
3. Results
3.1. Primers Specificity and Expression Profiles Analyses of Candidate RGs
3.2. Stability Analysis of Candidate Internal RGs
3.3. Validation of EF1α as the Most Reliable and Stable Internal RG
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, W.; Zhang, Y.; Mazumder, M.A.R.; Pan, R.; Akhter, D. Research progress on rice leaf color mutants. Crop Des. 2022, 1, 100015. [Google Scholar] [CrossRef]
- Zhao, M.H.; Li, X.; Zhang, X.X.; Zhang, H.; Zhao, X.Y. Mutation mechanism of leaf color in plants: A review. Forests 2020, 11, 851. [Google Scholar] [CrossRef]
- Jung, K.H.; Hur, J.; Ryu, C.H.; Choi, Y.; Chung, Y.Y.; Miyao, A.; Hirochika, H.; An, G. Characterization of a rice chlorophyll-deficient mutant using the T-DNA gene-trap system. Plant Cell Physiol. 2003, 44, 463–472. [Google Scholar] [CrossRef] [PubMed]
- Sheng, P.; Tan, J.; Jin, M.; Wu, F.; Zhou, K.; Ma, W.; Heng, Y.; Wang, J.; Guo, X.; Zhang, X.; et al. Albino midrib 1, encoding a putative potassium efflux antiporter, affects chloroplast development and drought tolerance in rice. Plant Cell Rep. 2014, 33, 1581–1594. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, A.; Tanaka, R. Chlorophyll metabolism. Curr. Opin. Plant Biol. 2006, 9, 248–255. [Google Scholar] [CrossRef]
- Falbel, T.G.; Staehelin, L.A. Partial blocks in the early steps of the chlorophyll synthesis pathway: A common feature of chlorophyll b-deficient mutants. Physiol. Plant. 1996, 97, 311–320. [Google Scholar] [CrossRef]
- Brestic, M.; Zivcak, M.; Kunderlikova, K.; Allakhverdiev, S.I. High temperature specifically affects the photoprotective responses of chlorophyll b-deficient wheat mutant lines. Photosynth. Res. 2016, 130, 251–266. [Google Scholar] [CrossRef]
- Lee, S.; Masclaux-Daubresse, C. Current understanding of leaf senescence in rice. Int. J. Mol. Sci. 2021, 22, 4515. [Google Scholar] [CrossRef]
- Fu, M.; Cheng, S.; Xu, F.; Chen, Z.; Liu, Z.; Zhang, W.; Zheng, J.; Wang, L. Advance In Mechanism Of Plant Leaf Colour Mutation. Not. Bot. Horti Agrobot. Cluj-Napoca 2021, 49, 12071. [Google Scholar] [CrossRef]
- Qi, L.; Shi, Y.; Li, C.; Liu, J.; Chong, S.-L.; Lim, K.-J.; Si, J.; Han, Z.; Chen, D. Glucomannan in Dendrobium catenatum: Bioactivities, Biosynthesis and Perspective. Genes 2022, 13, 1957. [Google Scholar] [CrossRef]
- Zhang, G.-Q.; Xu, Q.; Bian, C.; Tsai, W.-C.; Yeh, C.-M.; Liu, K.-W.; Yoshida, K.; Zhang, L.-S.; Chang, S.-B.; Chen, F.; et al. The Dendrobium catenatum Lindl. genome sequence provides insights into polysaccharide synthase, floral development and adaptive evolution. Sci. Rep. 2016, 6, 19029. [Google Scholar] [CrossRef]
- Xi, H.; Liu, J.; Li, Q.; Chen, X.; Liu, C.; Zhao, Y.; Yao, J.; Chen, D.; Si, J.; Liu, C.; et al. Genome-wide identification of Cellulose-like synthase D gene family in Dendrobium catenatum. Biotechnol. Biotechnol. Equip. 2021, 35, 1163–1176. [Google Scholar] [CrossRef]
- Yuan, Y.; Zuo, J.; Zhang, H.; Zu, M.; Yu, M.; Liu, S. Transcriptome and metabolome profiling unveil the accumulation of flavonoids in Dendrobium officinale. Genomics 2022, 114, 110324. [Google Scholar] [CrossRef]
- Cao, H.; Li, H.; Miao, Z.; Fu, G.; Yang, C.; Wu, L.; Zhao, P.; Shan, Q.; Ruan, J.; Wang, G.; et al. The preliminary study of leaf-color mutant in Dendrobium officinale. J. Nucl. Agric. Sci. 2017, 31, 461–471. [Google Scholar] [CrossRef]
- Ji, Y.; Yang, W.; Li, H.; Cao, H.; Lu, L.; Tian, M.; Sun, D.; Li, D. Study on chloroplast ultrastructure, photosynthetic pigments, and chlorophyll fluorescence characteristics of leaf color mutants in Dendrobium officinale Kimura et Migo. Plant Sci. J. 2020, 38, 260–268. [Google Scholar] [CrossRef]
- Cao, A.; Shao, D.; Cui, B.; Tong, X.; Zheng, Y.; Sun, J.; Li, H. Screening the reference genes for quantitative gene expression by RT-qPCR during SE initial dedifferentiation in four Gossypium hirsutum cultivars that have different SE capability. Genes 2019, 10, 497. [Google Scholar] [CrossRef]
- Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef]
- Liu, Q.; Qi, X.; Yan, H.; Huang, L.; Nie, G.; Zhang, X. Reference gene selection for quantitative real-time reverse-transcriptase PCR in annual ryegrass (Lolium multiflorum) subjected to various abiotic stresses. Molecules 2018, 23, 172. [Google Scholar] [CrossRef]
- Wang, L.; Dossou, S.S.K.; Wei, X.; Zhang, Y.; Li, D.; Yu, J.; Zhang, X. Transcriptome dynamics during black and white sesame (Sesamum indicum L.) seed development and identification of candidate genes associated with black pigmentation. Genes 2020, 11, 1399. [Google Scholar] [CrossRef]
- Wu, Y.; Zhou, J.; Liu, Y.; Gu, Y.; Zhang, H.; Ahmad, F.; Wang, G.; Ren, L. Selection and Validation of Reliable Reference Genes for qRT-PCR Normalization of Bursaphelenchus xylophilus from Different Temperature Conditions and Developmental Stages. Appl. Sci. 2022, 12, 2880. [Google Scholar] [CrossRef]
- Kou, X.; Zhang, L.; Yang, S.; Li, G.; Ye, J. Selection and validation of reference genes for quantitative RT-PCR analysis in peach fruit under different experimental conditions. Sci. Hortic. 2017, 225, 195–203. [Google Scholar] [CrossRef]
- Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.A.W.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Xu, H.; Cao, Y.; Yang, P.; Feng, Y.; Tang, Y.; Yuan, S.; Ming, J. Validation of reference genes for quantitative real-time pcr during bicolor tepal development in Asiatic hybrid lilies (Lilium spp.). Front. Plant Sci. 2017, 8, 669. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Wu, J.; Hua, Q.; Tel-Zur, N.; Xie, F.; Zhang, Z.; Chen, J.; Zhang, R.; Hu, G.; Zhao, J.; et al. Identification of reliable reference genes for quantitative real-time PCR normalization in pitaya. Plant Methods 2019, 15, 70. [Google Scholar] [CrossRef]
- Du, W.; Hu, F.; Yuan, S.; Liu, C. Selection of reference genes for quantitative real-time PCR analysis of photosynthesis-related genes expression in Lilium regale. Physiol. Mol. Biol. Plants 2019, 25, 1497–1506. [Google Scholar] [CrossRef]
- Wu, H.; Shi, N.; An, X.; Liu, C.; Fu, H.; Cao, L.; Feng, Y.; Sun, D.; Zhang, L. Candidate Genes for Yellow Leaf Color in Common Wheat (Triticum aestivum L.) and Major Related Metabolic Pathways according to Transcriptome Profiling. Int. J. Mol. Sci. 2018, 19, 1594. [Google Scholar] [CrossRef]
- Wan, H.; Zhao, Z.; Qian, C.; Sui, Y.; Malik, A.A.; Chen, J. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal. Biochem. 2010, 399, 257–261. [Google Scholar] [CrossRef]
- Liang, L.; He, Z.; Yu, H.; Wang, E.; Zhang, X.; Zhang, B.; Zhang, C.; Liang, Z. Selection and Validation of Reference Genes for Gene Expression Studies in Codonopsis pilosula Based on Transcriptome Sequence Data. Sci. Rep. 2020, 10, 1362. [Google Scholar] [CrossRef]
- Li, J.; Huang, H.; Shan, T.; Pang, S. Selection of reference genes for real-time RT-PCR normalization in brown alga Undaria pinnatifida. J. Appl. Phycol. 2019, 31, 787–793. [Google Scholar] [CrossRef]
- Yi, S.; Qian, Y.; Han, L.; Sun, Z.; Fan, C.; Liu, J.; Ju, G. Selection of reliable reference genes for gene expression studies in Rhododendron micranthum Turcz. Sci. Hortic. 2012, 138, 128–133. [Google Scholar] [CrossRef]
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using real-time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef]
- Ren, R.; Dai, P.-H.; Li, M.; Liu, Z.; Cao, F. Selection and stability evaluation of reference genes for real-time quantitative PCR in dove tree (Davidia involucrata). Plant Physiol. Commun. 2016, 52, 1565–1575. [Google Scholar] [CrossRef]
- Ma, L.; Cui, G.; Wang, X.; Jia, W.; Duan, Q.; Du, W.; Wang, J. Cloning and expression analysis of catalase (Ls-Cat1) gene in Lilium sargentiae Wilson. J. Nucl. Agric. Sci. 2017, 31, 1700–10707. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Li, F.; Cheng, Y.; Ma, L.; Li, S.; Wang, J. Identification of reference genes provides functional insights into meiotic recombination suppressors in Gerbera hybrida. Hortic. Plant J. 2022, 8, 123–132. [Google Scholar] [CrossRef]
- Tang, Q.Y.; Zhang, C.X. Data Processing System (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2013, 20, 254–260. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Ma, K.S.; Li, F.; Liang, P.Z.; Chen, X.W.; Liu, Y.; Gao, X.W. Identification and validation of reference genes for the normalization of gene expression data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae). J. Insect Sci. 2016, 16. [Google Scholar] [CrossRef]
- Yang, Y.Y.; Zhao, L.J.; Yang, G.J.; Zhang, Y.; Fu, P.Y.; Hu, J.W.; Liu, Y.; Wang, N. Selection and Validation of Reference Genes for Leaf Color Phenotype in “Maiyuanjinqiu”, a Catalpa fargesii Variety, by qRT-PCR. For. Res. 2022, 35, 123–131. [Google Scholar] [CrossRef]
- Zhang, J.R.; Feng, Y.Y.; Yang, M.J.; Xiao, Y.; Liu, Y.S.; Yuan, Y.; Li, Z.; Zhang, Y.; Zhuo, M.; Zhang, J.; et al. Systematic screening and validation of reliable reference genes for qRT-PCR analysis in Okra (Abelmoschus esculentus L.). Sci. Rep. 2022, 12, 12913. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Wang, Q.; Li, Y.; Gao, L.; Lv, F.; Yang, R.; Wang, P. Candidate reference genes for quantitative gene expression analysis in Lagerstroemia indica. Mol. Biol. Rep. 2021, 48, 1677–1685. [Google Scholar] [CrossRef] [PubMed]






| No | Genes | Primers (5′-3′) | Product Length (bp) | Tm Value/°C |
|---|---|---|---|---|
| 1 | Actin | F: CCCTTTATGCTAGTGGTCGAA; R: CCTGAGAATCGCATGTGGTA | 110 | 60 |
| 2 | UBQ | F: GCCGACTACAACATCCAGAA; R: TGATGGTCTTGCCTGTGAG | 100 | 60 |
| 3 | GAPDH | F: ATTTCTTGGGTGACAGCAG; R: TGTCATACCAAGCCACGA | 93 | 60 |
| 4 | EF1α | F: GCTGTGAAGGATCTAAAGCG; R: TGGGAGGTAAAGTTGGCG | 83 | 60 |
| 5 | β-TUB | F: GGCAAGATGAGCACCAAAG; R: GGAATCCACTCCACGAAG | 83 | 60 |
| 6 | α-TUB | F: GAGAGGTTGTCCGTGGACTA; R: CTACTGCTGTGGAAACCTG | 82 | 60 |
| 7 | RPL13AD | F: CGGGCAAAGGTTGCATAC; R: CGAGTTTCTCTTCAGCTGTT | 82 | 60 |
| 8 | PIP1-2 | F: TTGGCGCTGAGATCATCG; R: TGGAACATGAGAGTCCCTG | 92 | 60 |
| 9 | ALB3 | F: GTTGCTAGGGTTCGGATGA; R: AAGTAATTCCGCCCAAGTC | 82 | 60 |
| 10 | CYCB1-2 | F: TACCAAGATGCCCTTCGC; R: GTCTCCCGCAGATATTCCAG | 83 | 60 |
| Ranking | Reference Genes | Geomean of Ranking Values |
|---|---|---|
| 1 | EF1α | 1.260 |
| 2 | CYCB1-2 | 2.000 |
| 3 | RPL13AD | 3.000 |
| 4 | β-TUB | 3.175 |
| 5 | UBQ10 | 5.593 |
| 6 | α-TUB | 5.646 |
| 7 | GAPDH | 7.268 |
| 8 | Actin | 7.319 |
| 9 | PIP1-2 | 9.000 |
| 10 | ALB3 | 10.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, H.; Li, H.; Lu, L.; Ji, Y.; Ma, L.; Li, S. Screening and Validation of Internal Reference Genes for Quantitative Real-Time PCR Analysis of Leaf Color Mutants in Dendrobium officinale. Genes 2023, 14, 1112. https://doi.org/10.3390/genes14051112
Cao H, Li H, Lu L, Ji Y, Ma L, Li S. Screening and Validation of Internal Reference Genes for Quantitative Real-Time PCR Analysis of Leaf Color Mutants in Dendrobium officinale. Genes. 2023; 14(5):1112. https://doi.org/10.3390/genes14051112
Chicago/Turabian StyleCao, Hua, Han Li, Lin Lu, Yulu Ji, Lulin Ma, and Shenchong Li. 2023. "Screening and Validation of Internal Reference Genes for Quantitative Real-Time PCR Analysis of Leaf Color Mutants in Dendrobium officinale" Genes 14, no. 5: 1112. https://doi.org/10.3390/genes14051112
APA StyleCao, H., Li, H., Lu, L., Ji, Y., Ma, L., & Li, S. (2023). Screening and Validation of Internal Reference Genes for Quantitative Real-Time PCR Analysis of Leaf Color Mutants in Dendrobium officinale. Genes, 14(5), 1112. https://doi.org/10.3390/genes14051112
