Molecular Characterization and Function of Bone Morphogenetic Protein 7 (BMP7) in the Pacific Abalone, Haliotis discus hannai
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Cloning and Sequence Analysis
2.3. Single Nucleotide Polymorphism Analysis
2.4. RNA Interference of hdh-BMP7
2.5. Real-Time Quantitative Reverse Transcription PCR
2.6. Statistical Analysis
3. Results
3.1. Characterization of Hdh-BMP7
3.2. Expression Detection of Hdh-BMP7
3.3. SNPs in Hdh-BMP7
3.4. Effects of RNA Interference
3.5. Verification of the Lvpan Abalone
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Feng, X.; Derynck, R. Specificity and versatility in TGF-β signaling through Smads. Annu. Rev. Cell Dev. Biol. 2005, 21, 659–693. [Google Scholar] [CrossRef] [PubMed]
- Massague, J. TGF-β in cancer. Cell 2008, 134, 215–230. [Google Scholar] [CrossRef] [PubMed]
- Ramesh, S.; Wildey, G.; Howe, P. Transforming growth factor β (TGFβ)-induced apoptosis: The rise and fall of Bim. Cell Cycle 2009, 8, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Ma, B.W.; Wang, X.C.; Zha, X.J.; Sheng, C.J.; Yang, P.; Qu, S. Potential Functions of the BMP Family in Bone, Obesity, and Glucose Metabolism. J. Diabetes Res. 2021, 2021, 6707464. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.Y.; Wong, J.C.; Chan, P.S.; Tan, H.; Liao, D.; Chen, W.M.; Tan, L.W.; Ackers-Johnson, M.; Wakimoto, H.; Seidman, J.G.; et al. Yin Yang 1 Suppresses Dilated Cardiomyopathy and Cardiac Fibrosis through Regulation of Bmp7 and Ctgf. Circ. Res. 2019, 125, 834–846. [Google Scholar] [CrossRef]
- Kingsley, D. The TGF-β superfamily: New members, new receptors, and new genetic tests of function in different organisms. Genes Dev. 1994, 8, 133–146. [Google Scholar] [CrossRef]
- Zhao, J.; Cui, B.; Yao, H.; Lin, Z.; Dong, Y. A Potential Role of Bone Morphogenetic Protein 7 in Shell Formation and Growth in the Razor Clam Sinonovacula constricta. Front. Physiol. 2020, 11, 1059. [Google Scholar] [CrossRef]
- Groppe, J.; Hinck, C.S.; Samavarchi-Tehrani, P.; Zubieta, C.; Schuermann, J.P.; Taylor, A.B.; Schwarz, P.M.; Wrana, J.L.; Hinck, A.P. Cooperative assembly of TGF-β superfamily signaling complexes is mediated by two disparate mechanisms and distinct modes of receptor binding. Mol. Cell 2008, 29, 157–168. [Google Scholar] [CrossRef]
- Tzavlaki, K.; Moustakas, A. TGF-β Signaling. Biomolecules 2020, 10, 487. [Google Scholar] [CrossRef]
- Derynck, R.; Budi, E.H. Specificity, versatility, and control of TGF-β family signaling. Sci. Signal. 2019, 12, eaav5183. [Google Scholar] [CrossRef]
- Li, S.N.; Wu, J.F. TGF-β/SMAD signaling regulation of mesenchymal stem cells in adipocyte commitment. Stem Cell Res. Ther. 2020, 11, 41. [Google Scholar] [CrossRef]
- Wang, X.; Meng, X.; Song, B.; Qiu, X.; Liu, H. SNPs in the myostatin gene of the mollusk Chlamys farreri: Association with growth traits. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2010, 155, 327–330. [Google Scholar] [CrossRef]
- Li, B.; Zhou, Y.L.; Gu, W.B.; Wang, L.Z.; Xu, Y.P.; Cheng, Y.X.; Chen, D.Y.; Li, B.W.; Xiao, Y.; Dong, W.R.; et al. Identification and functional analysis of transforming growth factor-β type III receptor (TβR3) from Scylla paramamosain: The first evidence of TβR3 involved in development and innate immunity in invertebrates. Fish Shellfish Immunol. 2020, 105, 41–52. [Google Scholar] [CrossRef]
- Niu, D.H.; Wang, L.; Bai, Z.Y.; Xie, S.M.; Zhao, H.G.; Li, J.L. Identification and expression characterization of the myostatin (MSTN) gene and association analysis with growth traits in the razor clam Sinonovacula constricta. Gene 2015, 555, 297–304. [Google Scholar] [CrossRef]
- Shu, L.; Yang, Y.; Huang, H.; Ye, H. A bone morphogenetic protein ligand and receptors in mud crab: A potential role in the ovarian development. Mol. Cell. Endocrinol. 2016, 434, 99–107. [Google Scholar] [CrossRef]
- Salazar, V.; Gamer, L.; Rosen, V. BMP signaling in skeletal development, disease and repair. Nat. Rev. Endocrinol. 2016, 12, 203. [Google Scholar] [CrossRef]
- Sánchez-Duffhues, G.; Hiepen, C.; Knaus, P.; ten Dijke, P. Bone morphogenetic protein signaling in bone homeostasis. Bone 2015, 80, 43–59. [Google Scholar] [CrossRef]
- Wordinger, R.; Clark, A. Bone morphogenetic proteins and their receptors in the eye. Exp. Biol. Med. 2007, 232, 979–992. [Google Scholar] [CrossRef]
- Cook, S.D.; Rueger, D.C. Osteogenic protein-1: Biology and applications. Clin. Orthop. Relat. Res. 1996, 324, 29. [Google Scholar] [CrossRef]
- Panagiotou, O.A.; Evangelou, E.; Ioannidis, J.P. Genome-wide significant associations for variants with minor allele frequency of 5% or less—An overview: A HuGE review. Am. J. Epidemiol. 2010, 172, 869–889. [Google Scholar] [CrossRef]
- Lyons, K.M.; Hogan, B.L.; Robertson, E.J. Colocalization of BMP7 and BMP2 RNAs suggests that these factors cooperatively mediate tissue interactions during murine development. Mech. Dev. 1995, 50, 71–83. [Google Scholar] [CrossRef] [PubMed]
- Dudley, A.T.; Lyons, K.M.; Robertson, E.J. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 1995, 15, 2795–2807. [Google Scholar] [CrossRef] [PubMed]
- Dudley, A.T.; Robertson, E.J. Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev. Dyn. 1997, 208, 349–362. [Google Scholar] [CrossRef]
- Luo, G.; Hofmann, C.; Bronckers, A.L.; Sohocki, M.; Bradley, A.; Karsenty, G. BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev. 1995, 9, 2808–2820. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Wang, G.; Zhou, Y.; Yang, W. The characterization and potential roles of bone morphogenetic protein 7 during spermatogenesis in Chinese mitten crab Eriocheir sinensis. Gene 2018, 673, 119–129. [Google Scholar] [CrossRef]
- Schmal, H.; Mehlhorn, A.T.; Pilz, I.H.; Dovi-Akue, D.; Kirchhoff, C.; Südkamp, N.P.; Gerlach, U.; Lohrmann, C.; Niemeyer, P. Immunohistological localization of BMP-2, BMP-7, and their receptors in knee joints with focal cartilage lesions. Sci. World J. 2012, 2012, 467892. [Google Scholar] [CrossRef]
- Asahina, I.; Sampath, T.; Hauschka, P. Human osteogenic protein-1 induces chondroblastic, osteoblastic, and/or adipocytic differentiation of clonal murine target cells. Exp. Cell Res. 1996, 222, 38–47. [Google Scholar] [CrossRef]
- Han, Q.; Gou, S.; Wang, L. In vivo bone morphogenetic protein 7 gene transfection mediated by polyethyleneimine for femoral fracture healing in old rats. J. Clin. Rehabil. Tissue Eng. Res. 2008, 12, 1205–1208. [Google Scholar]
- Hurtig, M.; Chubinskaya, S.; Dickey, J.; Rueger, D. BMP7 protects against progression of cartilage degeneration after impact injury. J. Orthop. Res. 2009, 27, 602–611. [Google Scholar] [CrossRef]
- Puglisi, R.; Montanari, M.; Chiarella, P.; Stefanini, M.; Boitani, C. Regulatory role of BMP2 and BMP7 in spermatogonia and Sertoli cell proliferation in the immature mouse. Eur. J. Endocrinol. 2004, 151, 511–520. [Google Scholar] [CrossRef]
- Monsivais, D.; Clementi, C.; Peng, J.; Fullerton, P., Jr.; Prunskaite-Hyyryläinen, R. BMP7 induces uterine receptivity and blastocyst attachment. Endocrinology 2017, 158, 979–992. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Li, L.; Shouzhi, W.; Xi, C.; Hui, L. Association between polymorphism of BMP7 gene and growth and body composition traits in broiler chickens. China Poult. 2013, 35, 6–10. [Google Scholar]
- Huang, Y.Z.; Wang, X.L.; He, H.; Lan, X.Y.; Lei, C.Z.; Zhang, C.L.; Chen, H. Identification and genetic effect of haplotype in the bovine BMP7 gene. Gene 2013, 532, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Guo, F.; Qu, H.; Luo, C.; Wang, J.; Shu, D. Associations between variants of bone morphogenetic protein 7 gene and growth traits in chickens. Br. Poult. Sci. 2018, 59, 264–269. [Google Scholar] [CrossRef] [PubMed]
- Sartori, R.; Schirwis, E.; Blaauw, B.; Bortolanza, S.; Zhao, J.H.; Enzo, E.; Stantzou, A.; Mouisel, E.; Toniolo, L.; Ferry, A.; et al. BMP signaling controls muscle mass. Nat. Genet. 2013, 45, 1309–1318. [Google Scholar] [CrossRef]
- Winbanks, C.E.; Chen, J.L.; Qian, H.W.; Liu, Y.Y.; Bernardo, B.C.; Beyer, C.; Watt, K.I.; Thomson, R.E.; Connor, T.; Turner, B.J.; et al. The bone morphogenetic protein axis is a positive regulator of skeletal muscle mass. J. Cell Biol. 2013, 203, 345–357. [Google Scholar] [CrossRef]
- Dong, Y. Transcriptome Analysis Using 454 Pyrosequencing and Cloning and Expression of Growth-Related Genes for the Blood Clam Tegillarca granosa (Linnaeus, 1758). Ph.D. Thesis, Ocean University of China, Qingdao, China, 2012. [Google Scholar]
- Yan, F.; Luo, S.; Jiao, Y.; Deng, Y.W.; Du, X.D.; Huang, R.L.; Wang, Q.H.; Chen, W.Y. Molecular characterization of the BMP7 gene and its potential role in shell formation in Pinctada martensii. Int. J. Mol. Sci. 2014, 15, 21215. [Google Scholar] [CrossRef]
- Fan, S.; Zhou, D.; Liu, B.; Deng, Z.; Guo, Y.; Yu, D. Molecular cloning and expression analysis of BMP 7b from Pinctada fucata. South China Fish. Sci. 2018, 14, 121–126. [Google Scholar]
- Lin, J. Cloning and Expression Analysis of Genes Involved in the Pearl Formation of Hyriopsis cumingii. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2014. [Google Scholar]
- Guo, X.M.; Ford, S.E.; Zhang, F.S. Molluscan aquaculture in China. J. Shellfish Res. 1999, 18, 19–31. [Google Scholar]
- Huang, J.F.; You, W.W.; Luo, X.; Ke, C.H. iTRAQ-Based Identification of Proteins Related to Muscle Growth in the Pacific Abalone, Haliotis discus hannai. Int. J. Mol. Sci. 2017, 18, 2237. [Google Scholar] [CrossRef]
- Huang, J.; Zhou, M.; Chen, J.; Ke, C. A Potential Negative Regulatory Function of Myostatin in the Growth of the Pacific Abalone, Haliotis discus hannai. Biology 2023, 12, 14. [Google Scholar] [CrossRef]
- Naipil, C.C.; Muñoz, V.V.; Valdés, J.A.; Molina, A.; Escárate, C.G. RNA interference in Haliotis rufescens myostatin evidences upregulation of insulin signaling pathway. Agric. Gene 2016, 1, 93–99. [Google Scholar] [CrossRef]
- Elliott, N.G. Genetic improvement programmes in abalone: What is the future? Aquac. Res. 2000, 31, 51–59. [Google Scholar] [CrossRef]
- You, W.W.; Guo, Q.; Fan, F.; Ren, P.; Luo, X.; Ke, C.H. Experimental hybridization and genetic identifification of Pacifific abalone Haliotis discus hannai and green abalone. Aquaculture 2015, 448, 243–249. [Google Scholar] [CrossRef]
- Wu, Y.; He, J.; Yao, G.; Liang, H.; Huang, X. Molecular cloning, characterization, and expression of two TNFRs from the pearl oyster Pinctada fucata martensii. Fish Shellfish Immunol. 2020, 98, 147–159. [Google Scholar] [CrossRef]
- Huang, J.F.; Luo, X.; Huang, M.Q.; Liu, G.M.; You, W.W.; Ke, C.H. Identification and characteristics of muscle growth-related microRNA in the Pacific abalone, Haliotis discus hannai. BMC Genom. 2018, 19, 915. [Google Scholar] [CrossRef]
- Marques, C.L.; Fernandez, I.; Viegas, M.N.; Cox, C.J.; Martel, P.; Rosa, J.; Cancela, M.L.; Laize, V. Comparative analysis of zebrafish bone morphogenetic proteins 2, 4 and 16: Molecular and evolutionary perspectives. Cell. Mol. Life. Sci. 2016, 73, 841–857. [Google Scholar] [CrossRef]
- Pan, S.Y. Association between the Polymorphisms of BMPs, TGF-β RΙ and Growth Traits in Meretrix meretrix. Master’s Thesis, Ocean University of Shanghai, Shanghai, China, 2019. [Google Scholar]
- Xiao, Y.T.; Xiang, L.; Shao, J.Z. Bone morphogenetic protein. Biochem. Biophys. Res. Commun. 2007, 362, 550–553. [Google Scholar] [CrossRef]
- Shawi, M.; Serluca, F.C. Identification of a BMP7 homolog in zebrafish expressed in developing organ systems. Gene Expr. Patterns 2008, 8, 369–375. [Google Scholar] [CrossRef]
- Otsuka, F. Multifunctional bone morphogenetic protein system in endocrinology. Acta Med. Okayama 2013, 67, 75–86. [Google Scholar]
- Ai, J.L.; Li, Z.M.; Liu, J.Y.; Shen, Y.C. Single nucleotide polymorphisms of myostatin gene and its association with growth traits in Haliotis diversicolor supertexta. J. Trop. Oceanogr. 2019, 38, 78–85. [Google Scholar]
- Ono, Y.; Calhabeu, F.; Morgan, J.E.; Katagiri, T.; Amthor, H.; Zammit, P.S. BMP signalling permits population expansion by preventing premature myogenic differentiation in muscle satellite cells. Cell Death Differ. 2011, 18, 222–234. [Google Scholar] [CrossRef] [PubMed]
- Aoyama, K.; Yamane, A.; Suga, T.; Suzuki, E.; Fukui, T.; Nakamura, Y. Bone morphogenetic protein-2 functions as a negative regulator in the differentiation of myoblasts, but not as an inducer for the formations of cartilage and bone in mouse embryonic tongue. BMC Dev. Biol. 2011, 11, 44. [Google Scholar] [CrossRef] [PubMed]
- Sartori, R.; Gregorevic, P.; Sandri, M. TGFβ and BMP signaling in skeletal muscle: Potential significance for muscle-related disease. Trends. Endocrinol. Metab. 2014, 25, 464–471. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.Y.; Li, X.X.; Wang, W.; Chen, X.; Yu, P.; Wang, J.J.; Xu, Y.X. Effect of BMPR IB gene silencing by siRNA on apoptosis and steroidogenesis of porcine granulosa cells. Genet. Mol. Res. 2014, 13, 9964. [Google Scholar] [CrossRef]
- Heldin, C.H.; Miyazono, K.; Dijke, P.T. TGF-β signaling from cell membrane to nucleus through SMAD proteins. Nature 1997, 390, 465–471. [Google Scholar] [CrossRef]
- Miyazono, K. TGF-β signaling by Smad proteins. Cytokine Growth Factor Rev. 2000, 11, 15–22. [Google Scholar] [CrossRef]
Primer Name | Sequence Information (5′-3′) |
---|---|
hdh-BMP7-F | CACAGAAGGGGATCGAGTCA |
hdh-BMP7-R | AGGCTACGAAAAGGTCACGT |
hdh-BMP7-dsF | TAATACGACTCACTATAGGGGCCACCAAGACTTCCACATT |
hdh-BMP7-dsR | TAATACGACTCACTATAGGGGATCGCTATCCATCCGAAAA |
EGFP-dsF | TAATACGACTCACTATAGGGGTGCCCATCCTGGTCGAGCT |
EGFP-dsR | TAATACGACTCACTATAGGGTGCACGCTGCCGTCCTCGAT |
hdh-BMP7-qF | GCGGTCCCATCTTCGTCA |
hdh-BMP7-qR | TGCACGTTCTTTGTACAGCC |
hdh-BMPR I-qF | GACCTCATAGAACAGTCCC |
hdh-BMPR I-qR | ACCATAACGCCCCTTGCCT |
hdh-BMPR II-qF | GGCGGGGAGAGATGTAATG |
hdh-BMPR II-qR | TAAGTTGGGTCGGGTGTAG |
hdh-Smad1-qF | GGACTCCTCTCCAACGTCAA |
hdh-Smad1-qR | ACATTCCGCAAACACCTCAC |
hdh-MHC-qF | GACCCCAACGACCCTGATAT |
hdh-MHC-qR | TCTTCTCCCTTGGTGCTCTG |
β-actin-qF | GGTATCCTCACCCTCAAGT |
β-actin-qR | GGGTCATCTTTTCACGGTTG |
Locus | Genotype | Sample Number | Shell Length (mm) | Shell Width (mm) | Total Weight (g) | Muscle Weight (g) | MW/TW |
---|---|---|---|---|---|---|---|
570 C > T | CT | 111 | 73.76 ± 9.82 a | 49.64 ± 6.27 a | 42.07 ± 16.40 a | 17.48 ± 7.92 a | 0.4064 ± 0.0458 a |
TT | 104 | 73.99 ± 9.61 a | 49.86 ± 6.21 a | 41.25 ± 15.29 a | 16.73 ± 7.15 a | 0.3981 ± 0.0407 a | |
CC | 4 | 71.19 ± 7.99 a | 48.03 ± 4.85 a | 36.63 ± 15.55 a | 15.30 ± 8.35 a | 0.4071 ± 0.0501 a | |
606 C > T | CC | 111 | 74.47 ± 9.60 a | 50.11 ± 6.13 a | 42.10 ± 15.57 a | 17.06 ± 7.30 a | 0.3975 ± 0.0416 a |
TC | 106 | 73.21 ± 9.48 a | 49.30 ± 6.14 a | 41.05 ± 15.75 a | 17.08 ± 7.68 a | 0.4066 ± 0.0451 a | |
744 A > G | AA | 139 | 73.67 ± 9.72 a | 49.66 ± 6.18 a | 42.55 ± 16.36 a | 17.62 ± 7.83 a | 0.4060 ± 0.0439 a |
GA | 74 | 74.30 ± 9.20 a | 49.88 ± 6.08 a | 40.15 ± 14.59 a | 16.33 ± 6.95 a | 0.3985 ± 0.0422 ab | |
GG | 4 | 69.57 ± 16.74 a | 47.47 ± 10.31 a | 32.95 ± 15.75 a | 12.13 ± 6.51 a | 0.3595 ± 0.0385 b | |
805 A > G | AG | 107 | 73.44 ± 9.29 a | 49.50 ± 6.08 a | 41.53 ± 16.17 a | 17.20 ± 7.77 a | 0.4056 ± 0.0448 a |
GG | 106 | 74.07 ± 9.96 a | 49.88 ± 6.26 a | 41.47 ± 15.45 a | 16.91 ± 7.33 a | 0.3994 ± 0.0426 a | |
AA | 5 | 75.21 ± 12.42 a | 49.81 ± 8.41 a | 41.84 ± 17.68 a | 16.80 ± 8.31 a | 0.3929 ± 0.0403 a | |
819 A > G | AA | 86 | 73.47 ± 9.41 a | 49.56 ± 5.95 a | 41.88 ± 16.24 a | 17.58 ± 7.83 a | 0.4115 ± 0.0433 a |
GA | 97 | 74.32 ± 9.69 a | 50.09 ± 6.39 a | 42.40 ± 15.87 a | 17.27 ± 7.56 a | 0.3987 ± 0.0448 bc | |
GG | 35 | 73.10 ± 10.30 a | 48.94 ± 6.30 a | 38.14 ± 14.31 a | 15.14 ± 6.59 a | 0.3895 ± 0.0370 c | |
834 T > A | TT | 174 | 73.14 ± 9.74 a | 49.20 ± 6.24 a | 40.48 ± 15.74 a | 16.49 ± 7.47 a | 0.3988 ± 0.0445 a |
AT | 42 | 75.74 ± 8.59 a | 51.24 ± 5.50 a | 44.51 ± 14.95 a | 18.70 ± 7.15 a | 0.4144 ± 0.0367 b | |
852 C > G | CC | 133 | 72.93 ± 9.47 a | 49.33 ± 6.09 a | 41.33 ± 15.97 a | 17.12 ± 7.66 a | 0.4058 ± 0.0440 a |
GC | 80 | 75.28 ± 9.43 a | 50.29 ± 6.11 a | 41.97 ± 15.47 a | 17.06 ± 7.34 a | 0.3982 ± 0.0421 ab | |
GG | 4 | 69.57 ± 16.74 a | 47.47 ± 10.31 a | 32.95 ± 15.75 a | 12.13 ± 6.51 a | 0.3595 ± 0.0385 b | |
903 G > C | GG | 124 | 73.08 ± 9.88 a | 49.36 ± 6.30 a | 41.80 ± 16.26 a | 17.39 ± 7.84 a | 0.4070 ± 0.0445 a |
CG | 86 | 74.83 ± 8.86 a | 50.17 ± 5.85 a | 40.82 ± 14.64 a | 16.53 ± 6.88 a | 0.3979 ± 0.0407 a | |
CC | 7 | 72.16 ± 14.87 a | 48.48 ± 9.01 a | 42.29 ± 22.71 a | 16.69 ± 10.60 a | 0.3781 ± 0.0506 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Zhou, M.; You, W.; Luo, X.; Ke, C. Molecular Characterization and Function of Bone Morphogenetic Protein 7 (BMP7) in the Pacific Abalone, Haliotis discus hannai. Genes 2023, 14, 1128. https://doi.org/10.3390/genes14061128
Huang J, Zhou M, You W, Luo X, Ke C. Molecular Characterization and Function of Bone Morphogenetic Protein 7 (BMP7) in the Pacific Abalone, Haliotis discus hannai. Genes. 2023; 14(6):1128. https://doi.org/10.3390/genes14061128
Chicago/Turabian StyleHuang, Jianfang, Mingcan Zhou, Weiwei You, Xuan Luo, and Caihuan Ke. 2023. "Molecular Characterization and Function of Bone Morphogenetic Protein 7 (BMP7) in the Pacific Abalone, Haliotis discus hannai" Genes 14, no. 6: 1128. https://doi.org/10.3390/genes14061128