Application of High-Resolution Melting and DNA Barcoding for Discrimination and Taxonomy Definition of Rocket Salad (Diplotaxis spp.) Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. DNA Barcode Primer Design
2.3. Amplification and Sequencing
2.4. High-Resolution Melting Analysis
2.5. Phylogenetic Tree Data Analysis
2.6. Genetic Diversity and Population Structure
3. Results
3.1. Sequence Comparisons
3.2. High-Resolution Melting Profiles
3.3. Phylogenetic Analysis
3.4. Population Structure
4. Discussion
5. Conclusions
Supplementary Materials
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Warwick, S.I. Brassicaceae in Agriculture. In Genetics and Genomics of the Brassicaceae; Warwick, S.I., Ed.; Springer: New York, NY, USA, 2010; pp. 33–65. [Google Scholar]
- Tripodi, P.; Coelho, P.S.; Guijarro-Real, C. Breeding advances and prospects in rocket salad (Eruca vesicaria ssp. sativa Mill.) cultivation. In Advances in Plant Breeding Strategies: Vegetable Crops; Springer International Publishing: Cham, Switzerland, 2021; pp. 95–133. [Google Scholar]
- Gómez-Campo, C. Taxonomy. In Biology of Brassica Coenospecies; Elsevier: Amsterdam, The Netherlands, 1999; pp. 3–32. [Google Scholar]
- Martín, J.P.; Sánchez-Yélamo, M.D. Genetic relationships among species of the genus Diplotaxis (Brassicaceae) using inter-simple sequence repeat markers. Theor. Appl. Genet. 2000, 101, 1234–1241. [Google Scholar] [CrossRef]
- Harberd, D.J.; McArthur, E.D. The chromosome constitution of Diplotaxis muralis (L.) DC. Watsonia 1972, 9, 131–135. [Google Scholar]
- Tripodi, P.; Francese, G.; Mennella, G. Rocket Salad: Crop Description, Bioactive Compounds and Breeding Perspectives. Adv. Hortic. Sci. 2017, 31, 107–113. [Google Scholar]
- Gómez-Campo, C. Morphology and morphotaxonomy of the Tribe Brassiceae. In Brassica Crops and Wild Allies; Tsunoda, S., Hinata, K., Gómez-Campo, C., Eds.; Japan Scientific Societies Press: Tokyo, Japan, 1980; pp. 3–31. [Google Scholar]
- Gómez-Campo, C.; Martínez-Laborde, J.B. Reajustes taxonómicos y nomenclaturales en la tribu Brassiceae (Cruciferae). An. Jardín Bot. Madrid 1998, 56, 379–381. [Google Scholar]
- D’antuono, L.F.; Elementi, S.; Neri, R. Glucosinolates in Diplotaxis and Eruca leaves: Diversity, taxonomic relations and applied aspects. Phytochemistry 2008, 69, 187–199. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Yélamo, M.D. A chemosystematic survey of flavonoids in the Brassicinae: Diplotaxis. Bot. J. Linn. Soc. 1994, 115, 9–18. [Google Scholar] [CrossRef]
- Eschmann-Grupe, G.; Hurka, H.; Neuffer, B. Species relationships within Diplotaxis (Brassicaceae) and the phylogenetic origin of D. muralis. Plant. Syst. Evol. 2004, 243, 13–29. [Google Scholar] [CrossRef]
- Warwick, S.I.; Black, L.D.; Aguinagalde, I. Molecular systematics of Brassica and allied genera (subtribe Brassicinae, Brassiceae)—Chloroplast DNA variation in the genus Diplotaxis. Theorl Appl. Genet. 1992, 83, 839–850. [Google Scholar] [CrossRef]
- Warwick, S.I.; Sauder, C.A. Phylogeny of tribe Brassiceae (Brassicaceae) based on chloroplast restriction site polymorphisms and nuclear ribosomal internal transcribed spacer and chloroplast trnL intron sequences. Can. J. Bot. 2005, 83, 467–483. [Google Scholar]
- Yan, M.; Xiong, Y.; Liu, R.; Deng, M.; Song, J. The application and limitation of universal chloroplast markers in discriminating east Asian evergreen oaks. Front. Plant. Sci. 2018, 9, 569. [Google Scholar] [CrossRef] [Green Version]
- Hollingsworth, P.M.; Graham, S.W.; Little, D.P. Choosing and Using a Plant DNA Barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef]
- Dunning, L.T.; Savolainen, V. Broad-scale amplification of matK for DNA barcoding plants, a technical note. Bot. J. Linn. Soc. 2010, 164, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Bafeel, S.O.; Arif, I.A.; Bakir, M.A.; Al Homaidan, A.A.; Al Farhan, A.H.; Khan, H.A. DNA barcoding of arid wild plants using rbcL gene sequences. Genet. Mol. Res. 2012, 11, 1934–1941. [Google Scholar] [CrossRef] [PubMed]
- China Plant BOL Group; Li, D.Z.; Gao, L.M.; Li, H.T.; Wang, H.; Ge, X.J.; Liu, J.Q.; Chen, Z.D.; Zhou, S.L.; Chen, S.L.; et al. Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc. Natl. Acad. Sci. USA 2011, 108, 19641–19646. [Google Scholar] [PubMed]
- Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; Fazekas, A.J.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar]
- Kress, W.J. Plant DNA Barcodes: Applications Today and in the Future. Front. Plant. Syst. Evol. 2017, 55, 291–307. [Google Scholar] [CrossRef] [Green Version]
- Müller, K.F.; Borsch, T.; Hilu, K.W. Phylogenetic utility of rapidly evolving DNA at high taxonomical levels: Contrasting matK, trnT-F, and rbcL in basal angiosperms. Mol. Phylogen. Evol. 2006, 41, 99–117. [Google Scholar] [CrossRef]
- Howard, C.; Lockie-Williams, C.; Slater, A. Applied Barcoding: The Practicalities of DNA Testing for Herbals. Plants 2020, 9, 1150. [Google Scholar] [CrossRef] [PubMed]
- Simko, I. High-resolution DNA melting analysis in plant research. Trends Plant. Sci. 2016, 21, 528–537. [Google Scholar] [CrossRef]
- Jaakola, L.; Suokas, M.; Häggman, H. Novel Approaches Based on DNA Barcoding and High-Resolution Melting of Amplicons for Authenticity Analyses of Berry Species. Food Chem. 2010, 123, 494–500. [Google Scholar] [CrossRef]
- Chen, W.; Chen, X.; Xu, J.; Cai, J.; Wang, X. Identification of Dendrobium officinale using DNA barcoding method combined with HRM and qPCR technology. Food Anal. Meth. 2022, 15, 1310–1320. [Google Scholar] [CrossRef]
- Song, M.; Li, J.; Xiong, C.; Liu, H.; Liang, J. Applying high-resolution melting (HRM) technology to identify five commonly used Artemisia species. Sci. Rep. 2016, 6, 34133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, W.; Li, J.; Xiong, C.; Zhao, B.; Chen, S. The Potential Power of Bar-HRM Technology in Herbal Medicine Identification. Front. Plant. Sci. 2016, 7, 367. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, J.; Wu, X.; Liu, C.; Newmaster, S.; Ragupathy, S.; Kress, W.J. Progress in the Use of DNA Barcodes in the Identification and Classification of Medicinal Plants. Ecotoxicol. Environ. Saf. 2021, 208, 111691. [Google Scholar] [CrossRef]
- Qiao, J.; Zhang, X.; Chen, B.; Huang, F.; Xu, K.; Huang, Q.; Huang, Y.; Hu, Q.; Wu, X. Comparison of the cytoplastic genomes by resequencing: Insights into the genetic diversity and the phylogeny of the agriculturally important genus Brassica. BMC Genom. 2020, 21, 480. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Falush, D.; Stephens, M.; Pritchard, J.K. Inference of population structure using multilocus genotype data: Dominant markers and null alleles. Mol. Ecol. Not. 2007, 7, 574–578. [Google Scholar] [CrossRef]
- Earl, D.A.; VonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Cons. Genet. Res. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Wickham, H. Programming with Ggplot2. In ggplot2; Springer: Berling/Heidelberg, Germany, 2016; pp. 241–253. [Google Scholar]
- Adhikari, S.; Saha, S.; Biswas, A.; Rana, T.S.; Bandyopadhyay, T.K.; Ghosh, P. Application of molecular markers in plant genome analysis: A review. Nucleus 2017, 60, 283–297. [Google Scholar] [CrossRef]
- Mehmood, F.; Abdullah; Ubaid, Z.; Bao, Y.; Poczai, P.; Mirza, B. Comparative plastomics of Ashwagandha (Withania, Solanaceae) and identification of mutational hotspots for barcoding medicinal plant. Plants 2020, 9, 752. [Google Scholar] [CrossRef]
- Hellberg, R.S.; Isaacs, R.B.; Hernandez, E.L. Identification of shark species in commercial products using DNA barcoding. Fish. Res. 2019, 210, 81–88. [Google Scholar] [CrossRef]
- Wurzbacher, C.; Larsson, E.; Bengtsson-Palme, J.; Van den Wyngaert, S.; Svantesson, S.; Kristiansson, E.; Kagami, M.; Nilsson, R.H. Introducing ribosomal tandem repeat barcoding for fungi. Mol. Ecol. Resour. 2019, 19, 118–127. [Google Scholar] [CrossRef] [Green Version]
- Choudhary, P.; Singh, B.N.; Chakdar, H.; Saxena, A.K. DNA Barcoding of Phytopathogens for Disease Diagnostics and Bio-Surveillance. World J. Microbiol. Biotechnol. 2021, 37, 54. [Google Scholar] [CrossRef]
- Ongchai, S.; Chokchaitaweesuk, C.; Kongdang, P.; Chomdej, S.; Buddhachat, K. In vitro chondroprotective potential of Senna alata and Senna tora in porcine cartilage explants and their species differentiation by DNA barcoding-high resolution melting (Bar-HRM) analysis. PLoS ONE 2019, 14, e0215664. [Google Scholar] [CrossRef]
- Thongkhao, K.; Tungphatthong, C.; Phadungcharoen, T.; Sukrong, S. The use of plant DNA barcoding coupled with HRM analysis to differentiate edible vegetables from poisonous plants for food safety. Food Control 2020, 109, 106896. [Google Scholar] [CrossRef]
- Prantl, K. Diplotaxis. In Die Naturlichen Pflanzenfamilien; Wilhelm Engelmann: Leipzig, Germany, 1915. [Google Scholar]
- Schulz, O.E. Diplotaxis. In Das Pflanzenreich IV; Engler, A., Ed.; Wilhelm Engelmann: Leipzig, Germany, 1919; Volume 105, pp. 149–179. [Google Scholar]
- Martínez-Laborde, J.B. Notes on the taxonomy of Diplotaxis DC. (Brassiceae). Bot. J. Linn. Soc. 1991, 106, 67–71. [Google Scholar] [CrossRef]
- Takahata, Y.; Hinata, K. Studies on cytodemes in subtribe Brassicinae (Cruciferae). Tohoku J. Agric. Res. 1983, 33, 111–124. [Google Scholar]
- Mummenhoff, K.; Eschmann-Grupe, G.; Zunk, K. Subunit polypeptide composition of Rubisco indicates Diplotaxis viminea as maternal parent species of amphiploid Diplotaxis muralis. Phytochemistry 1993, 34, 429–431. [Google Scholar] [CrossRef]
- Mader, E.E.; Ruzicka, J.; Schmiderer, C.; Novak, J. Quantitative high-resolution melting analysis for detecting adulterations. Anal. Biochem. 2011, 409, 153–155. [Google Scholar] [CrossRef]
- Jiang, K.W.; Zhang, R.; Zhang, Z.F.; Pan, B.; Tian, B. DNA barcoding and molecular phylogeny of Dumasia (Fabaceae: Phaseoleae) reveals a cryptic lineage. Plant. Divers. 2020, 42, 376–385. [Google Scholar] [CrossRef]
Marker Name | Foward Primer (5′–3′) | Reverse Primer (3′–5′) | Amplicon Size |
---|---|---|---|
ITS1 | TTAGGCCGTGCGTATAGCTT | TTGCGTTCAAAGACTCGATG | 249 bp |
trnL-F | AGAAATTCCCGGTCCAAAAC | GGCCGTTACCGAAGTATCATT | 107 bp |
rbcL | CGGAGTTCCACCTGAAGAAG | TTGTAACGGTCAAGGCTGGT | 105 bp |
matK | TACGCCGCTTCTGATGAATA | TCTTTAGCCAACGACCCAAT | 267 bp |
HRM500 | GATTCGAACCGTAGACCTGCTC | CCTTAAGGTGTAGCAAGTTTCA | 115 bp |
HRM500 (322) | ITS1 (274) | matk (241) | rbcl (73) | trnL-F (80) | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Seq # | A | C | G | T | Seq | A | C | G | T | Seq | A | C | G | T | Seq | A | C | G | T | Seq | A | C | G | T | |
D. ac * | 312 | 106 | 49 | 45 | 112 | 214 | 63 | 52 | 56 | 43 | 233 | 75 | 28 | 39 | 91 | 67 | 13 | 18 | 17 | 19 | 76 | 23 | 15 | 12 | 26 |
D. as | 312 | 109 | 48 | 45 | 110 | 215 | 64 | 51 | 54 | 46 | 235 | 77 | 28 | 40 | 90 | 67 | 13 | 18 | 17 | 19 | 76 | 24 | 14 | 12 | 26 |
D. be | 313 | 108 | 48 | 45 | 112 | 216 | 66 | 52 | 53 | 45 | 234 | 75 | 30 | 39 | 90 | 67 | 13 | 19 | 17 | 18 | 71 | 24 | 22 | 10 | 15 |
D. br | 315 | 110 | 47 | 44 | 114 | 217 | 68 | 52 | 52 | 45 | 235 | 78 | 29 | 37 | 91 | 67 | 13 | 18 | 17 | 19 | 67 | 23 | 13 | 11 | 20 |
D. bv | 313 | 106 | 48 | 45 | 114 | 216 | 62 | 53 | 57 | 44 | 234 | 76 | 31 | 37 | 90 | 69 | 14 | 18 | 17 | 20 | 80 | 23 | 18 | 12 | 27 |
D. du | 313 | 105 | 49 | 47 | 112 | 217 | 66 | 52 | 55 | 44 | 235 | 76 | 30 | 38 | 91 | 68 | 14 | 19 | 17 | 18 | 76 | 23 | 15 | 12 | 26 |
D. er | 313 | 108 | 48 | 45 | 112 | 218 | 68 | 51 | 53 | 46 | 234 | 76 | 29 | 38 | 91 | 68 | 14 | 18 | 17 | 19 | 78 | 23 | 17 | 12 | 26 |
D. ha | 313 | 108 | 48 | 45 | 112 | 217 | 70 | 50 | 52 | 45 | 235 | 77 | 29 | 38 | 91 | 68 | 14 | 18 | 17 | 19 | 78 | 23 | 17 | 12 | 26 |
D. ib | 313 | 108 | 48 | 45 | 112 | 214 | 67 | 52 | 52 | 43 | 236 | 77 | 31 | 38 | 90 | 70 | 14 | 20 | 17 | 19 | 78 | 24 | 16 | 12 | 26 |
D. il | 314 | 108 | 48 | 45 | 113 | 213 | 63 | 51 | 56 | 43 | 236 | 77 | 31 | 38 | 90 | 68 | 14 | 18 | 17 | 19 | 79 | 23 | 17 | 12 | 27 |
D. mu | 310 | 109 | 48 | 44 | 109 | 215 | 64 | 51 | 56 | 44 | 239 | 78 | 31 | 38 | 92 | 69 | 15 | 19 | 17 | 18 | 79 | 24 | 16 | 12 | 27 |
D. si | 314 | 110 | 48 | 44 | 112 | 264 | 79 | 68 | 51 | 66 | 235 | 76 | 29 | 39 | 91 | 68 | 14 | 18 | 17 | 19 | 78 | 25 | 14 | 13 | 26 |
D. sm | 314 | 104 | 49 | 47 | 114 | 214 | 63 | 51 | 56 | 44 | 235 | 76 | 31 | 38 | 90 | 68 | 14 | 19 | 17 | 18 | 76 | 23 | 15 | 12 | 26 |
D. te | 312 | 104 | 49 | 47 | 112 | 216 | 65 | 51 | 56 | 44 | 236 | 77 | 29 | 40 | 90 | 68 | 14 | 19 | 17 | 18 | 77 | 24 | 15 | 12 | 26 |
D. tn | 316 | 108 | 49 | 44 | 115 | 216 | 64 | 51 | 54 | 47 | 236 | 82 | 29 | 37 | 88 | 68 | 14 | 19 | 17 | 18 | 76 | 25 | 13 | 12 | 26 |
D. vi | 309 | 109 | 47 | 43 | 110 | 217 | 66 | 52 | 55 | 44 | 236 | 77 | 31 | 39 | 89 | 68 | 14 | 18 | 17 | 19 | 78 | 24 | 16 | 12 | 26 |
D. vr | 315 | 110 | 48 | 46 | 111 | 215 | 67 | 48 | 52 | 48 | 233 | 77 | 32 | 35 | 89 | 67 | 13 | 18 | 17 | 19 | 79 | 23 | 16 | 14 | 26 |
D. ac | D. as | D. be | D. br | D. bv | D. du | D. er | D. ha | D. ib | D. il | D. mu | D. si | D. sm | D. te | D. tn | D. vi | D. vr | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
D. ac | 0.005 | 0.007 | 0.005 | 0.005 | 0.004 | 0.005 | 0.005 | 0.004 | 0.003 | 0.004 | 0.009 | 0.004 | 0.004 | 0.005 | 0.004 | 0.006 | |
D. as | 0.025 | 0.006 | 0.004 | 0.006 | 0.006 | 0.005 | 0.006 | 0.005 | 0.005 | 0.006 | 0.009 | 0.006 | 0.006 | 0.006 | 0.006 | 0.005 | |
D. be | 0.049 | 0.032 | 0.007 | 0.008 | 0.007 | 0.007 | 0.008 | 0.007 | 0.007 | 0.008 | 0.010 | 0.008 | 0.008 | 0.008 | 0.008 | 0.007 | |
D. br | 0.026 | 0.018 | 0.042 | 0.006 | 0.006 | 0.005 | 0.006 | 0.006 | 0.005 | 0.006 | 0.009 | 0.006 | 0.006 | 0.006 | 0.006 | 0.005 | |
D. bv | 0.022 | 0.033 | 0.058 | 0.034 | 0.006 | 0.006 | 0.006 | 0.005 | 0.004 | 0.006 | 0.009 | 0.006 | 0.006 | 0.007 | 0.006 | 0.006 | |
D. du | 0.014 | 0.029 | 0.049 | 0.030 | 0.030 | 0.005 | 0.006 | 0.005 | 0.004 | 0.005 | 0.010 | 0.003 | 0.003 | 0.006 | 0.005 | 0.006 | |
D. er | 0.021 | 0.020 | 0.045 | 0.020 | 0.029 | 0.026 | 0.006 | 0.005 | 0.005 | 0.005 | 0.009 | 0.005 | 0.006 | 0.006 | 0.005 | 0.005 | |
D. ha | 0.026 | 0.035 | 0.059 | 0.035 | 0.032 | 0.029 | 0.032 | 0.005 | 0.005 | 0.006 | 0.010 | 0.006 | 0.006 | 0.006 | 0.005 | 0.006 | |
D. ib | 0.013 | 0.026 | 0.049 | 0.027 | 0.022 | 0.019 | 0.025 | 0.026 | 0.003 | 0.004 | 0.009 | 0.005 | 0.005 | 0.006 | 0.003 | 0.006 | |
D. il | 0.011 | 0.021 | 0.046 | 0.022 | 0.014 | 0.015 | 0.020 | 0.025 | 0.009 | 0.004 | 0.009 | 0.004 | 0.004 | 0.006 | 0.004 | 0.006 | |
D. mu | 0.014 | 0.027 | 0.052 | 0.028 | 0.028 | 0.019 | 0.023 | 0.030 | 0.018 | 0.013 | 0.010 | 0.004 | 0.004 | 0.005 | 0.003 | 0.006 | |
D. si | 0.083 | 0.080 | 0.103 | 0.083 | 0.084 | 0.088 | 0.084 | 0.091 | 0.078 | 0.078 | 0.085 | 0.010 | 0.010 | 0.010 | 0.009 | 0.010 | |
D. sm | 0.014 | 0.029 | 0.052 | 0.030 | 0.030 | 0.008 | 0.026 | 0.030 | 0.020 | 0.015 | 0.015 | 0.086 | 0.003 | 0.006 | 0.004 | 0.006 | |
D. te | 0.016 | 0.032 | 0.054 | 0.033 | 0.033 | 0.006 | 0.028 | 0.033 | 0.022 | 0.018 | 0.016 | 0.091 | 0.008 | 0.005 | 0.005 | 0.006 | |
D. tn | 0.026 | 0.029 | 0.052 | 0.030 | 0.039 | 0.030 | 0.030 | 0.036 | 0.032 | 0.027 | 0.026 | 0.092 | 0.028 | 0.026 | 0.006 | 0.006 | |
D. vi | 0.014 | 0.027 | 0.052 | 0.028 | 0.028 | 0.019 | 0.023 | 0.026 | 0.011 | 0.013 | 0.007 | 0.084 | 0.016 | 0.019 | 0.028 | 0.006 | |
D. vr | 0.030 | 0.020 | 0.045 | 0.022 | 0.035 | 0.035 | 0.025 | 0.036 | 0.032 | 0.027 | 0.028 | 0.087 | 0.033 | 0.035 | 0.032 | 0.028 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tripodi, P. Application of High-Resolution Melting and DNA Barcoding for Discrimination and Taxonomy Definition of Rocket Salad (Diplotaxis spp.) Species. Genes 2023, 14, 1594. https://doi.org/10.3390/genes14081594
Tripodi P. Application of High-Resolution Melting and DNA Barcoding for Discrimination and Taxonomy Definition of Rocket Salad (Diplotaxis spp.) Species. Genes. 2023; 14(8):1594. https://doi.org/10.3390/genes14081594
Chicago/Turabian StyleTripodi, Pasquale. 2023. "Application of High-Resolution Melting and DNA Barcoding for Discrimination and Taxonomy Definition of Rocket Salad (Diplotaxis spp.) Species" Genes 14, no. 8: 1594. https://doi.org/10.3390/genes14081594