Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sample Collections
2.2. DNA Extraction and Quantification
2.3. Primers Selection and PCR Amplification
2.4. Nucleotide Sequencing and Phylogenetic Analysis
3. Results
3.1. DNA Sequence Analysis and Characterizations of Barcodes
3.2. Nucleotide Sequence Analysis and Phylogeny of Genotype-1 Based on ITS2
3.3. Nucleotide Sequence Analysis and Phylogeny of Genotype-2 Based on UBE3
3.4. Nucleotide Sequence Analysis and Phylogeny of Genotype-3 Based on rbcLa
3.5. Nucleotide Sequence Analysis and Phylogeny of Genotype-4 Based on rbcLc
3.6. Nucleotide Sequence Analysis and Phylogeny of Genotype-5 Based onrpoC1
3.7. DNA Barcode of Selected Genotypes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wani, M.S.; Hussain, A.; Ganie, S.; Munshi, A.; Lal, E.; Gupta, R. Juglans regia—A review. Int. J. Latest Res. Sci. Technol 2016, 5, 90–97. [Google Scholar]
- Frei, J. A Brief History of Juglandaceae. Arnoldia 2021, 78, 10–17. [Google Scholar] [CrossRef]
- Luo, X.; Zhou, H.; Cao, D.; Yan, F.; Chen, P.; Wang, J.; Woeste, K.; Chen, X.; Fei, Z.; An, H. Domestication and selection footprints in Persian walnuts (Juglans regia). PLoS Genet. 2022, 18, e1010513. [Google Scholar] [CrossRef]
- Shigaeva, J.; Darr, D. On the socio-economic importance of natural and planted walnut (Juglans regia L.) forests in the Silk Road countries: A systematic review. For. Policy Econ. 2020, 118, 102233. [Google Scholar] [CrossRef]
- Sharma, M.; Sharma, M.; Sharma, M. A comprehensive review on ethnobotanical, medicinal and nutritional potential of walnut (Juglans regia L.). Proc. Indian Natl. Sci. Acad. 2022, 88, 601–616. [Google Scholar] [CrossRef]
- Bernard, A.; Lheureux, F.; Dirlewanger, E. Walnut: Past and future of genetic improvement. Tree Genet. Genomes 2018, 14, 1. [Google Scholar] [CrossRef]
- Sharma, V.; Singh, J.; Sidhu, G.S. Biotechnological Interventions for Improvement of Temperate Nuts. In Temperate Nuts; Springer: Singapore, 2023; pp. 247–267. [Google Scholar]
- Guo, Z.; Jin, Q.; Zhao, Z.; Yu, W.; Li, G.; Cheng, Y.; Wu, C. Analysis of Phylogenetic Relationships in The Walnut Family Based on Internal Transcribed Spacer Sequences and Secondary Structures (ITS2). 2021. Available online: https://assets-eu.researchsquare.com/files/rs-501634/v1/1b2f9c95-c758-4b25-b7a3-2be436c4f5e3.pdf?c=1631882771 (accessed on 28 October 2024).
- Shah, R.; Bakshi, P.; Jasrotia, A.; Wali, V.; Sharma, S.; Gupta, M.; Gupta, R.; Jamwal, M. Comparative morpho-molecular characterization of elite walnut variety Parbat (JWSP-06) with local selections of north-western Himalayan region of Jammu and Kashmir, India. Sci. Hortic. 2023, 319, 112176. [Google Scholar] [CrossRef]
- Khadivi-Khub, A.; Ebrahimi, A.; Sheibani, F.; Esmaeili, A. Phenological and pomological characterization of Persian walnut to select promising trees. Euphytica 2015, 205, 557–567. [Google Scholar] [CrossRef]
- Meng, X.; Li, Y.; Li, S.; Zhou, Y.; Gan, R.-Y.; Xu, D.-P.; Li, H.-B. Dietary sources and bioactivities of melatonin. Nutrients 2017, 9, 367. [Google Scholar] [CrossRef]
- Khan, M.P.Z. Floral Diversity, Ethnobotanical and Cultural Significance of Medicinally Important Wild Edible Fruits in Northern Pakistan. Ph.D. Thesis, Quaid-i-Azam University, Islamabad, Pakistan, 2018. [Google Scholar]
- Ur-Rahman, I.; Sher, H.; Bussmann, R. Reference Guide on High Value Medicinal and Aromatic Plants–Sustainable Management and Cultivation Practices; University of Swat: Swat, Pakistan, 2019. [Google Scholar]
- Kamil, M.; Khan, I.; Rauf, A.; Bawazeer, S.; Bawazeer, S.; Rauf, A.; Irfan, M. Chemical divergence of the Juglans regia L. across districts Swat and Dir, Khyber Pakhtunkhwa, Pakistan. Braz. J. Biol. 2022, 84, e259731. [Google Scholar] [CrossRef]
- Ahmed, S.; Ibrahim, M.; Nantasenamat, C.; Nisar, M.F.; Malik, A.A.; Waheed, R.; Ahmed, M.Z.; Ojha, S.C.; Alam, M.K. Pragmatic applications and universality of DNA barcoding for substantial organisms at species level: A review to explore a way forward. BioMed Res. Int. 2022, 2022, 1846485. [Google Scholar] [CrossRef] [PubMed]
- Letsiou, S.; Madesis, P.; Vasdekis, E.; Montemurro, C.; Grigoriou, M.E.; Skavdis, G.; Moussis, V.; Koutelidakis, A.E.; Tzakos, A.G. DNA Barcoding as a Plant Identification Method. Appl. Sci. 2024, 14, 1415. [Google Scholar] [CrossRef]
- Mahima, K.; Sunil Kumar, K.N.; Rakhesh, K.V.; Rajeswaran, P.S.; Sharma, A.; Sathishkumar, R. Advancements and future prospective of DNA barcodes in the herbal drug industry. Front. Pharmacol. 2022, 13, 947512. [Google Scholar] [CrossRef] [PubMed]
- Andújar, C.; Arribas, P.; Yu, D.W.; Vogler, A.P.; Emerson, B.C. Why the COI barcode should be the community DNA metabarcode for the metazoa. Mol. Ecol. 2018, 27, 3968–3975. [Google Scholar] [CrossRef]
- Espinosa Prieto, A.; Hardion, L.; Debortoli, N.; Beisel, J.N. Finding the perfect pairs: A matchmaking of plant markers and primers for multi-marker eDNA metabarcoding. Mol. Ecol. Resour. 2024, 24, e13937. [Google Scholar] [CrossRef]
- Loeuille, B.; Thode, V.; Siniscalchi, C.; Andrade, S.; Rossi, M.; Pirani, J.R. Extremely low nucleotide diversity among thirty-six new chloroplast genome sequences from Aldama (Heliantheae, Asteraceae) and comparative chloroplast genomics analyses with closely related genera. PeerJ 2021, 9, e10886. [Google Scholar] [CrossRef]
- Osman, S.A. The Power of DNA Barcoding for Plant Identification. Egypt. J. Chem. 2024, 67, 633–646. [Google Scholar] [CrossRef]
- Gupta, M.K.; Senthilkumar, S.; Rangan, L. 3,5-Dihydroxy 4′,7-dimethoxyflavone–DNA interaction study for nucleic acid detection and differential cell staining. Int. J. Biol. Macromol. 2024, 261, 129713. [Google Scholar] [CrossRef]
- Phukan, A.; Gayan, J.; Ravindran, A.; Nabis, B. A standardized protocol for the genomic DNA isolation from the leaf of Camellia sinensis (Linn.) O. Kuntze. J. Food Agric. Environ. 2018, 16, 33–37. [Google Scholar]
- Drábková, L.Z. DNA extraction from herbarium specimens. In Molecular Plant Taxonomy: Methods and Protocols; Humana Press: Totowa, NJ, USA, 2014; pp. 69–84. [Google Scholar]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Consortium, F.B.; List, F.B.C.A.; Bolchacova, E. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef]
- Suo, Z.; Chen, L.; Pei, D.; Jin, X.; Zhang, H. A new nuclear DNA marker from ubiquitin ligase gene region for genetic diversity detection of walnut germplasm resources. Biotechnol. Rep. 2015, 5, 40–45. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Cheng, T.; Li, C.; Xu, C.; Long, P.; Chen, C.; Zhou, S. Discriminating plants using the DNA barcode rbc L b: An appraisal based on a large data set. Mol. Ecol. Resour. 2014, 14, 336–343. [Google Scholar] [CrossRef] [PubMed]
- Hasebe, M.; Omori, T.; Nakazawa, M.; Sano, T.; Kato, M.; Iwatsuki, K. rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. Proc. Natl. Acad. Sci. USA 1994, 91, 5730–5734. [Google Scholar] [CrossRef]
- CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar] [CrossRef]
- Pokharel, S.; Khanal, B.C.; Basnet, A.; Pandey, G.R.; Basnet, S. DNA extraction and PCR optimization for DNA barcode analysis of commercially-grown coffee varieties in Nepal. Kathmandu Univ. J. Sci. Eng. Technol. 2023, 17. [Google Scholar] [CrossRef]
- Soldati, A. Characterisation of Apparent Mismatches Detected during Routine Short Tandem Repeat Analysis in Parentage Investigations. Master’s Thesis, University of the Free State, Bloemfontein, South Africa, 2023. [Google Scholar]
- Asif, S.; Khan, M.; Arshad, M.W.; Shabbir, M.I. PCR Optimization for Beginners: A Step by Step Guide. Res. Mol. Med. 2021, 9, 81–102. [Google Scholar] [CrossRef]
- Duineveld, B.M.; Kowalchuk, G.A.; Keijzer, A.; van Elsas, J.D.; van Veen, J.A. Analysis of bacterial communities in the rhizosphere of chrysanthemum via denaturing gradient gel electrophoresis of PCR-amplified 16S rRNA as well as DNA fragments coding for 16S rRNA. Appl. Environ. Microbiol. 2001, 67, 172–178. [Google Scholar] [CrossRef]
- Schwessinger, B.; Sperschneider, J.; Cuddy, W.S.; Garnica, D.P.; Miller, M.E.; Taylor, J.M.; Dodds, P.N.; Figueroa, M.; Park, R.F.; Rathjen, J.P. A near-complete haplotype-phased genome of the dikaryotic wheat stripe rust fungus Puccinia striiformis f. sp. tritici reveals high interhaplotype diversity. MBio 2018, 9, 1–24. [Google Scholar] [CrossRef]
- Kobiowu, A. Sequence Analysis and In Vitro Genome Editing of Atlantic salmon MHC-I-F10 Gene in Atlantic salmon Macrophage Cell line TO Cell. Master’s Thesis, Norwegian University of Life Sciences, Ås, Norway, 2022. [Google Scholar]
- Chatla, D.; Pamulapati, P.; Kola, S.; Naranji, M.K. Genetic identification of grouper fishes (Perciformes: Serranidae: Epinephelus) through DNA barcoding from Nizampatnam coastal waters: DNA barcoding of grouper fishes (Perciformes: Serranidae: Epinephelus). TAXA 2024, 3, ad23302. [Google Scholar]
- Jones, R.C.; Nicolle, D.; Steane, D.A.; Vaillancourt, R.E.; Potts, B.M. High density, genome-wide markers and intra-specific replication yield an unprecedented phylogenetic reconstruction of a globally significant, speciose lineage of Eucalyptus. Mol. Phylogenetics Evol. 2016, 105, 63–85. [Google Scholar] [CrossRef]
- Panda, R.; Nehra, A.K.; Ram, H.; Karikalan, M.; Garg, R.; Nala, R.R.; Pawde, A. Phylogenetic analysis and haplotype networking of Hepatozoon felis infecting wild animals in Gir National Park, Gujarat, India. Parasitol. Res. 2024, 123, 92. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- Pollegioni, P.; Woeste, K.; Chiocchini, F.; Del Lungo, S.; Ciolfi, M.; Olimpieri, I.; Tortolano, V.; Clark, J.; Hemery, G.E.; Mapelli, S. Rethinking the history of common walnut (Juglans regia L.) in Europe: Its origins and human interactions. PLoS ONE 2017, 12, e0172541. [Google Scholar] [CrossRef]
- Yang, C.-q.; Lv, Q.; Zhang, A.-b. Sixteen years of DNA barcoding in China: What has been done? What can Be done? Front. Ecol. Evol. 2020, 8, 57. [Google Scholar] [CrossRef]
- Chen, Z.; Gao, L.; Wang, H.; Feng, S. Molecular Identification and Phylogenetic Analysis of Cymbidium Species (Orchidaceae) Based on the Potential DNA Barcodes matK, rbcL, psbA-trnH, and Internal Transcribed Spacer. Agronomy 2024, 14, 933. [Google Scholar] [CrossRef]
- Han, Q.; Zhang, Y.; Shu, Y.; Chen, J.; Zhang, Y.; Zhou, W.; Zhang, Z. Identification of Common Adulterants in Walnut Beverage Based on Plant DNA Barcode Technology. bioRxiv 2018. [Google Scholar] [CrossRef]
- Aradhya, M.K.; Potter, D.; Gao, F.; Simon, C.J. Molecular phylogeny of Juglans (Juglandaceae): A biogeographic perspective. Tree Genet. Genomes 2007, 3, 363–378. [Google Scholar] [CrossRef]
- Stevens, K.A.; Woeste, K.; Chakraborty, S.; Crepeau, M.W.; Leslie, C.A.; Martínez-García, P.J.; Puiu, D.; Romero-Severson, J.; Coggeshall, M.; Dandekar, A.M. Genomic variation among and within six Juglans species. G3 Genes Genomes Genet. 2018, 8, 2153–2165. [Google Scholar] [CrossRef] [PubMed]
- Ji, F.; Ma, Q.; Zhang, W.; Liu, J.; Feng, Y.; Zhao, P.; Song, X.; Chen, J.; Zhang, J.; Wei, X. A genome variation map provides insights into the genetics of walnut adaptation and agronomic traits. Genome Biol. 2021, 22, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Öztoprak, H. Evolutionary Persistence and Speciation under Ancient Asexuality. Ph.D. Thesis, Universität zu Köln, Köln, Germany, 2023. [Google Scholar]
- Jennings, R.M.; Etter, R.J.; Ficarra, L. Population differentiation and species formation in the deep sea: The potential role of environmental gradients and depth. PLoS ONE 2013, 8, e77594. [Google Scholar] [CrossRef][Green Version]
- Soltis, D.E.; Soltis, P.S.; Mort, M.E.; Chase, M.W.; Savolainen, V.; Hoot, S.B.; Morton, C.M. Inferring complex phylogenies using parsimony: An empirical approach using three large DNA data sets for angiosperms. Syst. Biol. 1998, 47, 32–42. [Google Scholar] [CrossRef] [PubMed]
- Qi, H.; Fan, P.; Wang, Y.; Liu, J. Genetic diversity and population structure of Juglans regia from six provinces in northern China. Biodivers. Sci. 2023, 31, 23120. [Google Scholar]
- Teske, D.; Peters, A.; Möllers, A.; Fischer, M. Genomic profiling: The strengths and limitations of chloroplast genome-based plant variety authentication. J. Agric. Food Chem. 2020, 68, 14323–14333. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Liu, Y.; Li, L.; Meng, H.; Yang, Y.; Dong, Z.; Wang, L.; Wu, G. Genome-wide identification and characterization of bHLH transcription factors related to anthocyanin biosynthesis in red walnut (Juglans regia L.). Front. Genet. 2021, 12, 632509. [Google Scholar] [CrossRef]
- Yildiz, E.; Pinar, H.; Uzun, A.; Yaman, M.; Sumbul, A.; Ercisli, S. Identification of genetic diversity among Juglans regia L. genotypes using molecular, morphological, and fatty acid data. Genet. Resour. Crop Evol. 2021, 68, 1425–1437. [Google Scholar] [CrossRef]
- Xiang, X.-G.; Wang, W.; Li, R.-Q.; Lin, L.; Liu, Y.; Zhou, Z.-K.; Li, Z.-Y.; Chen, Z.-D. Large-scale phylogenetic analyses reveal fagalean diversification promoted by the interplay of diaspores and environments in the Paleogene. Perspect. Plant Ecol. Evol. Syst. 2014, 16, 101–110. [Google Scholar] [CrossRef]
- Doğan, Y.; Kafkas, S.; Sütyemez, M.; Akça, Y.; Türemiş, N. Assessment and characterization of genetic relationships of walnut (Juglans regia L.) genotypes by three types of molecular markers. Sci. Hortic. 2014, 168, 81–87. [Google Scholar] [CrossRef]
- Abbasi Holasou, H.; Mohammadzadeh Jalaly, H.; Mohammadi, R.; Panahi, B. Genetic diversity and structure of superior spring frost tolerant genotypes of Persian walnut (Juglans regia L.) in East Azerbaijan province of Iran, characterized using inter simple sequence repeat (ISSR) markers. Genet. Resour. Crop Evol. 2023, 70, 539–548. [Google Scholar] [CrossRef]
- Martínez-García, P.J.; Crepeau, M.W.; Puiu, D.; Gonzalez-Ibeas, D.; Whalen, J.; Stevens, K.A.; Paul, R.; Butterfield, T.S.; Britton, M.T.; Reagan, R.L. The walnut (Juglans regia) genome sequence reveals diversity in genes coding for the biosynthesis of non-structural polyphenols. Plant J. 2016, 87, 507–532. [Google Scholar] [CrossRef]
- Zhao, P.; Zhou, H.-J.; Potter, D.; Hu, Y.-H.; Feng, X.-J.; Dang, M.; Feng, L.; Zulfiqar, S.; Liu, W.-Z.; Zhao, G.-F. Population genetics, phylogenomics and hybrid speciation of Juglans in China determined from whole chloroplast genomes, transcriptomes, and genotyping-by-sequencing (GBS). Mol. Phylogenetics Evol. 2018, 126, 250–265. [Google Scholar] [CrossRef]
Genotypes | Collection Sites | Latitude (N) | Longitude (E) |
---|---|---|---|
Genotype-1 | Shingli bala Battagram | 34°40′42″ | 72°59′05″ |
Genotype-2 | Sanger valley Kaghan | 34°34′55″ | 73°22′43″ |
Genotype-3 | Jared valley Kaghan | 34°40′34″ | 73°33′24″ |
Genotype-4 | Rashang valley Allai | 34°49′10″ | 73°7′30″ |
Genotype-5 | Shatial upper Kohistan | 35°31′37″ | 73°32′36″ |
Barcode Region | Primers | Sequence 5′–3′ | References |
---|---|---|---|
ITS2 | F | 5′ATGCGATACTTGGTGTGAAT3′ | [25] |
UBE3 | F | 5′TCGCCTCCAAGTTCAGTG3′ | [26] |
rbcLa | F | 5′ATGTCACCACAAACAGAGACTAAAGC3′ | [27] |
rbcLc | F | 5′TGAAAACGTGAATTCCCAACCGTTTATGCG3′ | [28] |
rpoC1 | F | 5′AATCTATGCAGGGTAGGCGC3′ | [29] |
Primers | Sequence (bp) | Query Cover | E-Value | % Identity |
---|---|---|---|---|
ITS2 | 335 | 94 | 0 | 99.77 |
UBE3 | 768 | 92 | 0 | 100 |
rbcLa | 698 | 99 | 0 | 100 |
rbcLc | 587 | 38 | 0 | 96.89 |
rpoC1 | 646 | 58 | 0 | 99.65 |
Barcode Region | Total Characters | Conserved Sites | Variable Site | Parsimony Info | Singleton |
---|---|---|---|---|---|
ITS2 | 335 | 326 | 7 | 0 | 7 |
UBE3 | 768 | 465 | 303 | 288 | 15 |
rbcLa | 698 | 698 | 0 | 0 | 0 |
rbcLc | 587 | 538 | 5 | 5 | 5 |
rpoC1 | 646 | 331 | 239 | 0 | 239 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sajjad, S.; Islam, M.; Muhammad, K.; Ghafoor, S.-u.; Ullah, I.; Khan, A.; Siraj, M.; Alrefaei, A.F.; Shah, J.A.; Ali, S. Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis. Genes 2024, 15, 1417. https://doi.org/10.3390/genes15111417
Sajjad S, Islam M, Muhammad K, Ghafoor S-u, Ullah I, Khan A, Siraj M, Alrefaei AF, Shah JA, Ali S. Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis. Genes. 2024; 15(11):1417. https://doi.org/10.3390/genes15111417
Chicago/Turabian StyleSajjad, Sajjad, Muhammad Islam, Khushi Muhammad, Sajid-ul Ghafoor, Irfan Ullah, Asif Khan, Muhammad Siraj, Abdulwahed Fahad Alrefaei, Jawad Ali Shah, and Sajid Ali. 2024. "Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis" Genes 15, no. 11: 1417. https://doi.org/10.3390/genes15111417
APA StyleSajjad, S., Islam, M., Muhammad, K., Ghafoor, S.-u., Ullah, I., Khan, A., Siraj, M., Alrefaei, A. F., Shah, J. A., & Ali, S. (2024). Comprehensive Evaluation of Cryptic Juglans Genotypes: Insight from Molecular Markers and Phylogenetic Analysis. Genes, 15(11), 1417. https://doi.org/10.3390/genes15111417